ID: 1151246181

View in Genome Browser
Species Human (GRCh38)
Location 17:72796645-72796667
Sequence GGCACAGCGTGCCCCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151246181 Original CRISPR GGCACAGCGTGCCCCCTCCA GGG (reversed) Intronic