ID: 1151248179

View in Genome Browser
Species Human (GRCh38)
Location 17:72812394-72812416
Sequence TAGAATCTAGAGTCTAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151248179 Original CRISPR TAGAATCTAGAGTCTAGGGT TGG Intronic
900914787 1:5629057-5629079 TTGACTCTAGAGTCTGAGGTAGG + Intergenic
901711311 1:11117782-11117804 TAGAATTTAGTGTTTAGGCTGGG + Intronic
904048892 1:27626280-27626302 GAGAATGGAGAGTTTAGGGTGGG + Intronic
905270275 1:36783066-36783088 TAGAGTCTAAGGTCTAGGGGTGG - Intergenic
905897604 1:41558736-41558758 TAGAGACTAGAGCCAAGGGTAGG - Intronic
907374827 1:54027952-54027974 TCTACACTAGAGTCTAGGGTGGG - Intergenic
907921894 1:58921824-58921846 GAGAGTCTCCAGTCTAGGGTGGG - Intergenic
908581590 1:65523060-65523082 TAGAATTTACATTCTAGGCTAGG - Intronic
908617305 1:65936624-65936646 TAGAGTTGAGTGTCTAGGGTAGG + Intronic
910177863 1:84450419-84450441 TAGAAACTAGAATCCAGGGCTGG + Intergenic
910913671 1:92265478-92265500 TAGAATCAAGAGTGTTGGCTGGG + Intronic
910924803 1:92387407-92387429 TAGAATTTAGAGTTTAGGTTGGG - Exonic
912072425 1:105828315-105828337 CAGAATTTAGACTCTGGGGTAGG - Intergenic
912789555 1:112638608-112638630 TAAAATCTAAAGTCTGGGCTGGG - Intronic
918486634 1:185035838-185035860 TAGAACCTAGAGTCTAGGTCAGG + Intergenic
922508935 1:226146576-226146598 CAAAGTCTGGAGTCTAGGGTTGG - Exonic
924088273 1:240476922-240476944 TAGAATCTGTAGGCTAGGGGTGG + Intergenic
1065069574 10:22008658-22008680 GAGAATCCAGAGTATTGGGTGGG + Intergenic
1065618057 10:27549298-27549320 TAGAAAATATAGTCTAGGTTAGG + Intergenic
1068013890 10:51489492-51489514 TTGAATCAGGAGTCTTGGGTGGG - Intronic
1068943940 10:62709331-62709353 TAGAATATAGAGTGTACTGTTGG - Intergenic
1070782428 10:79145428-79145450 AAGAACACAGAGTCTAGGGTTGG + Intronic
1072986586 10:100146134-100146156 TAGAATCAACAGTCTTGGGCTGG - Intergenic
1073429259 10:103475777-103475799 TGGAATCTGGAGTCTAGGCTGGG + Intronic
1075485019 10:122814836-122814858 TAAAATCTCAAGTCTAGAGTAGG + Intergenic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1079113361 11:17621390-17621412 TAATATGTAGAGTATAGGGTAGG - Intronic
1083044553 11:59722058-59722080 TAAAATCTGGAGTCTGGGGGAGG + Intronic
1084024062 11:66436969-66436991 TAGATTCTAGAGGATGGGGTGGG - Intronic
1084936769 11:72590812-72590834 AAGAATCTAGGGGCTAGGGATGG - Intronic
1086167483 11:83796543-83796565 TAGAATTTAGAAACTAGGGAAGG - Intronic
1091805498 12:3353149-3353171 TATAAACCAGAGTCTGGGGTTGG + Intergenic
1096666747 12:53171284-53171306 TAGAATCAGGAGCCCAGGGTTGG + Intronic
1098102738 12:67035791-67035813 TAGAATATAAAGACTAGGTTAGG - Intergenic
1098665409 12:73155674-73155696 TAGAATCTAGAGTCTAGAGAGGG - Intergenic
1102457385 12:113079113-113079135 CTGAATCTGGAGTCCAGGGTAGG - Intronic
1104879264 12:132058643-132058665 TAAAATCCATAGTCTAGGCTGGG - Intronic
1106073769 13:26439752-26439774 AAGTATCTAGAGTCTGGGATGGG + Intergenic
1106983112 13:35313649-35313671 TAGAGTTTACAGTCTAGTGTGGG + Intronic
1107254443 13:38406869-38406891 TACAATCTAGAGTATATAGTTGG - Intergenic
1107272943 13:38642108-38642130 TAGAATCAAGAGTTTTGGGATGG - Intergenic
1107451650 13:40515506-40515528 TAAAATCTAGAGCCCAGGCTGGG + Intergenic
1108155602 13:47581405-47581427 AAGAATATATAGTCTATGGTTGG - Intergenic
1108880152 13:55103769-55103791 TAGAACATAGAGTGTAGGCTGGG + Intergenic
1109689955 13:65873460-65873482 CAGAATTTAGAGTCTAAAGTGGG - Intergenic
1113335963 13:109376155-109376177 TAAAATCTAGAGATTAGGTTAGG - Intergenic
1116934398 14:50724217-50724239 TAGAATATATGGTCTAGGTTGGG + Intronic
1117159866 14:52978760-52978782 GAGAATCTAGAGTCTTAGGCAGG + Intergenic
1118814677 14:69301685-69301707 TAGAATCAAGAATCTAGGGAAGG + Intronic
1121987473 14:98521692-98521714 TAGATTGTAGATACTAGGGTGGG + Intergenic
1124993883 15:34703932-34703954 TAGAATATGGAGTCTCGGATGGG - Intergenic
1133675120 16:8063869-8063891 TAGCCTATAGAGTCTAGGCTTGG - Intergenic
1133684584 16:8154234-8154256 TAGAATTTAAAGTCTAGGCCGGG - Intergenic
1135799048 16:25475354-25475376 TTGAAACTAGAGTCCAGGCTCGG + Intergenic
1135881374 16:26260883-26260905 TAGAATCTACAGTCTAATGGAGG + Intergenic
1138431207 16:56970288-56970310 CAGAATCTATATCCTAGGGTTGG - Intronic
1139000767 16:62506997-62507019 TAGACTTTAGAGTTTATGGTGGG + Intergenic
1141967507 16:87456232-87456254 TAGAATTTAGATTTTAGGGCTGG + Intronic
1146209352 17:30930010-30930032 TACAATCAAGAGTCCAGGCTGGG - Intronic
1146232296 17:31123492-31123514 TAGAAGTTAGAGACTAGGCTGGG - Intronic
1146410491 17:32579455-32579477 TAGAATCTGGAGTATAGGGAGGG - Intronic
1148954771 17:51344572-51344594 TAGAATTTAGTGTCTAGTGGAGG - Intergenic
1151247266 17:72804442-72804464 TAGAATCTAAAGTCGAGGGTTGG + Intronic
1151248179 17:72812394-72812416 TAGAATCTAGAGTCTAGGGTTGG + Intronic
1155343311 18:24834827-24834849 TAGAATCCAGAGTCAAGGTTTGG + Intergenic
1157498158 18:48171044-48171066 TAGAATCTGGAACCTAAGGTTGG + Intronic
1158706054 18:59793139-59793161 TAGAATCTAGAGCTTTGGGCCGG - Intergenic
1160141645 18:76328662-76328684 GTGACTCTAGACTCTAGGGTGGG - Intergenic
1160569275 18:79805805-79805827 TAAAATCTAGAGTCTAGTTGTGG + Intergenic
1163226381 19:15964257-15964279 TAGAATCCAGAGTCCAGGCAGGG - Intergenic
1163498105 19:17658483-17658505 TAAAGTCTAGGGGCTAGGGTAGG + Intronic
1164398576 19:27887401-27887423 TAGCATTTGGAGACTAGGGTTGG - Intergenic
931658706 2:64536045-64536067 TAGAATTTAGAATATAGTGTAGG + Intronic
936757641 2:115734354-115734376 TAGAACTTAGAGTTTACGGTGGG + Intronic
939289914 2:140180733-140180755 TAGAATCAATAGTCCAGGGCTGG - Intergenic
940170521 2:150825124-150825146 GTGAGTCTGGAGTCTAGGGTGGG - Intergenic
940498643 2:154466267-154466289 TAGAAGGAAGAATCTAGGGTAGG + Intergenic
943771920 2:191727005-191727027 TAAAACCTAGAATTTAGGGTTGG - Intergenic
945432630 2:209781877-209781899 TAAAATATAGAATCTAGGGACGG - Intronic
947274762 2:228377969-228377991 TAGATTCTAAAGATTAGGGTGGG - Intergenic
947314789 2:228844439-228844461 TAGAATTTACAATCTAGGTTGGG - Intergenic
947382281 2:229556389-229556411 CAGAATCTATAGTCTTGGATGGG + Intronic
947772930 2:232685261-232685283 TAAAAAATAAAGTCTAGGGTGGG + Intergenic
1170988981 20:21284818-21284840 TTGAGTCTAGAGTCTTAGGTCGG - Intergenic
1172758291 20:37303294-37303316 TAGTATCTAGAGGCTACAGTTGG + Intronic
1177053575 21:16270713-16270735 CAGAATTTAGATTCTAAGGTGGG - Intergenic
1179093581 21:38291266-38291288 GAGAACCTAGATTCTAGGATGGG - Intronic
1181892507 22:26076019-26076041 TAGAAGGTAGTGTGTAGGGTGGG - Intergenic
953100341 3:39819503-39819525 TAGAATCTACACCCTAGGATGGG - Intronic
953395173 3:42563449-42563471 TAGAATTTACAGTTTAGGTTTGG - Intronic
953457408 3:43054095-43054117 TCAAAACTAGAGTCCAGGGTGGG + Intronic
957869997 3:86079369-86079391 TAGAATATATACTCTAGGGAAGG + Intergenic
959620210 3:108391755-108391777 CAGAAACTAGAATCCAGGGTAGG - Exonic
962194135 3:133343846-133343868 TAGATTTGAGAGTCCAGGGTTGG + Intronic
968864945 4:3202719-3202741 TAGAATCTATAGGCTAGGTGTGG + Intronic
969596691 4:8153033-8153055 TGGAATCTAGGCTCTGGGGTTGG + Intronic
970590344 4:17554716-17554738 TAAAATGTGGAGTCTAGGGAAGG - Intergenic
971341963 4:25778833-25778855 CAGAAAATAGAGTCTAGGGGTGG + Intronic
971384939 4:26133841-26133863 TAGAATCTAGAGTCTGAAGAGGG - Intergenic
974028901 4:56758078-56758100 TAGGATGGAAAGTCTAGGGTAGG + Intergenic
976335288 4:83878625-83878647 TAGAAGCTAGAGTCTAGTGTGGG + Intergenic
976590044 4:86840212-86840234 TAGAATCCAGAGTGTCGGCTGGG - Intronic
981766572 4:148257444-148257466 TAGAATCCAGACTTTAGGTTAGG + Intronic
985785785 5:1893433-1893455 CAGAATCTAGAGAATAGGCTGGG - Intergenic
986455633 5:7915083-7915105 AAGAATGCACAGTCTAGGGTGGG + Intergenic
987216392 5:15742280-15742302 TAAAATATAGAGTCTGGGGAAGG + Intronic
987649460 5:20721332-20721354 TAGAATCTTTATTCTAGGATTGG - Intergenic
987716111 5:21573811-21573833 TAGAATTTATAGTCTAGGCCAGG + Intergenic
988746097 5:34140213-34140235 TAGAATCTTTATTCTAGGATTGG + Intergenic
990058645 5:51618760-51618782 TAGACTTTACAGTCTAGTGTGGG + Intergenic
990448151 5:55912132-55912154 TATAATCTATAGACCAGGGTAGG - Intronic
990556686 5:56943378-56943400 TAGAATCTAGAGGTTAGCCTGGG + Intronic
990599103 5:57339426-57339448 TAGAAAATAAAGTCTAGGCTGGG - Intergenic
992116264 5:73541007-73541029 TGGGACCCAGAGTCTAGGGTAGG + Intergenic
992389069 5:76313709-76313731 TAGAATCTGGAGTCTAGACCAGG + Intronic
993935064 5:93988911-93988933 TAGACTCTAGACTCCAGGGCAGG - Intronic
995876848 5:116799329-116799351 TAGAGTTTACAGTCTAGGGAAGG + Intergenic
995973825 5:118006726-118006748 GAGAATCTGGACTCCAGGGTGGG - Intergenic
996341446 5:122443566-122443588 TTGAATCTTGAGTCTAGTCTGGG - Intronic
996710320 5:126536924-126536946 TATAAGCCAGAGTCTAGTGTAGG - Intergenic
1002573031 5:180154879-180154901 TGGAGTCAAGAGTCCAGGGTGGG - Intronic
1004871332 6:19907390-19907412 TAGAATCCTGAGGCTTGGGTAGG - Intergenic
1005544253 6:26848438-26848460 TAGAATCTTTATTCTAGGATTGG + Intergenic
1007297157 6:40833317-40833339 CAGAAATTAGAGCCTAGGGTGGG - Intergenic
1009015039 6:57890065-57890087 TAGAATCTTTATTCTAGGATTGG + Intergenic
1009838493 6:69036533-69036555 TGGAATTTAAAGTCTAGCGTGGG + Intronic
1015018090 6:128438296-128438318 TAGAATGAAGAGCCAAGGGTTGG - Intronic
1017600424 6:156074605-156074627 TAGAGTCTAGAGTTTAGGGGAGG - Intergenic
1020821535 7:12974170-12974192 TAGAATCTATAGTGTAGTCTTGG + Intergenic
1021231590 7:18092088-18092110 TAGAATCTCTGGTGTAGGGTGGG + Intronic
1021793991 7:24234832-24234854 TACAATGTAGAGTCAAGGTTGGG + Intergenic
1022234930 7:28452379-28452401 TATAATCATGTGTCTAGGGTGGG - Intronic
1027854432 7:83491026-83491048 TAGCATCCAGAGTCTAGGCCTGG - Intronic
1029246111 7:99202885-99202907 TGGAATCTAGATTCTAGTGGGGG - Intronic
1030440628 7:109584165-109584187 TAGAGGATAGAGTCTAGAGTTGG + Intergenic
1031911001 7:127516580-127516602 TAGAATTTACAGTCTAGAGGAGG - Intergenic
1033645678 7:143301654-143301676 TAGTATCTAGAGTCTGTCGTAGG + Intronic
1036000661 8:4599997-4600019 TAGAAATGAAAGTCTAGGGTTGG + Intronic
1036628221 8:10490612-10490634 TAGAATCTAGAGTTTATGTTAGG - Intergenic
1043060780 8:75499704-75499726 TAGAATTTAGAGTCCAGTGGGGG + Intronic
1045339347 8:101238555-101238577 TAGGATCTAGAGCCTAGGGTGGG - Intergenic
1045554837 8:103206091-103206113 CAGTTTCCAGAGTCTAGGGTTGG + Intronic
1048160971 8:132021576-132021598 CAGAATGTAGAGTCAAGGGAGGG + Intergenic
1057051537 9:91927852-91927874 TAGAATCTAGAGGCTGGGCGCGG - Intronic
1057710923 9:97443325-97443347 TAGAATATACAGTCTAAGGTGGG + Intronic
1058114623 9:101070790-101070812 TTGAATTTACATTCTAGGGTGGG - Intronic
1058115481 9:101079870-101079892 AAGAATGGAGAGTCTAGGCTGGG - Intronic
1058419652 9:104821546-104821568 GAGCATCTAGAGTTAAGGGTAGG - Intronic
1059950927 9:119461737-119461759 TTGAATCTCGAGTCTAGGTCAGG - Intergenic
1060643579 9:125259651-125259673 TACAATTTACAATCTAGGGTAGG - Intergenic
1061467216 9:130790957-130790979 TAAATTATAGAATCTAGGGTAGG + Intronic
1061725114 9:132578283-132578305 TAGACTCTAGAATCCAGGGCTGG - Intergenic
1188772454 X:34169438-34169460 TAGAATCTAAAGTCTACAGTGGG + Intergenic
1189839914 X:45064309-45064331 CAGAAGCTAGAGTTTAGGGGAGG + Intronic
1192724112 X:73729445-73729467 GGGATGCTAGAGTCTAGGGTTGG - Intergenic
1196862058 X:120038001-120038023 TAAAAGCTAGAGACTAGGCTGGG + Intergenic
1199056173 X:143297561-143297583 TAAAAATTAGAGTCTGGGGTAGG + Intergenic