ID: 1151248739

View in Genome Browser
Species Human (GRCh38)
Location 17:72817151-72817173
Sequence TGTACAGGCTTCAGAACCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 1, 2: 35, 3: 93, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151248739_1151248745 19 Left 1151248739 17:72817151-72817173 CCAATGGTTCTGAAGCCTGTACA 0: 1
1: 1
2: 35
3: 93
4: 248
Right 1151248745 17:72817193-72817215 GTGCTTCTGATGAGGGCCTCGGG 0: 3
1: 52
2: 367
3: 890
4: 1266
1151248739_1151248743 12 Left 1151248739 17:72817151-72817173 CCAATGGTTCTGAAGCCTGTACA 0: 1
1: 1
2: 35
3: 93
4: 248
Right 1151248743 17:72817186-72817208 TCAACATGTGCTTCTGATGAGGG 0: 1
1: 1
2: 35
3: 180
4: 753
1151248739_1151248744 18 Left 1151248739 17:72817151-72817173 CCAATGGTTCTGAAGCCTGTACA 0: 1
1: 1
2: 35
3: 93
4: 248
Right 1151248744 17:72817192-72817214 TGTGCTTCTGATGAGGGCCTCGG 0: 1
1: 2
2: 30
3: 75
4: 370
1151248739_1151248742 11 Left 1151248739 17:72817151-72817173 CCAATGGTTCTGAAGCCTGTACA 0: 1
1: 1
2: 35
3: 93
4: 248
Right 1151248742 17:72817185-72817207 GTCAACATGTGCTTCTGATGAGG 0: 1
1: 1
2: 14
3: 142
4: 727

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151248739 Original CRISPR TGTACAGGCTTCAGAACCAT TGG (reversed) Intronic
902200573 1:14830547-14830569 TGTACAGCCTGCAGAACTGTGGG - Intronic
902368069 1:15990243-15990265 TGTACAGCATTCAGAGCCAGAGG - Intergenic
902694314 1:18129951-18129973 TTTCCAGCCTCCAGAACCATGGG + Intronic
903998663 1:27324680-27324702 TGTATAGCCTGCAGAAGCATGGG - Intronic
904580591 1:31541014-31541036 TGTACAGCTTGCAGAACCATAGG - Intergenic
906403945 1:45526538-45526560 AGTAAAGATTTCAGAACCATGGG + Intergenic
906753536 1:48287723-48287745 TGTACAGCCTGCAGAAACATGGG + Intergenic
907692732 1:56686492-56686514 TGTACAGCCTGCAGAACTGTGGG - Intronic
908007456 1:59741476-59741498 TGTATAGCCTGCAGAACCATGGG + Intronic
908675448 1:66598545-66598567 TGTACAGCCTGCAGAACCGTGGG - Intronic
909719185 1:78747556-78747578 TGTACAGCCTGCAGAACCATGGG - Intergenic
910194987 1:84630863-84630885 TGTACAGGCTGCTGACCCACAGG + Exonic
911307525 1:96249123-96249145 TGTCCTGGCTTCAGAACCTTAGG + Intergenic
914382828 1:147134104-147134126 TGTGCAGCCTGCAGAACTATGGG - Intergenic
915777228 1:158502887-158502909 TGTAAAGTTTGCAGAACCATGGG - Intergenic
916499015 1:165370454-165370476 TGTACAGCCTGCAGAACTATGGG + Intergenic
917408900 1:174737726-174737748 TGTACAGCTTGCAGAAACATGGG - Intronic
919176256 1:194022183-194022205 TGTACAGTCTGCAGAAACGTGGG + Intergenic
919317332 1:195988585-195988607 TGTATAGCCTGCAGAACCATGGG + Intergenic
919605004 1:199670904-199670926 TGTACAGCCCGCAGAACCATGGG - Intergenic
920172171 1:204078971-204078993 TGCAAAGGCTTCATCACCATGGG - Intronic
922325747 1:224526759-224526781 TGTACAGCCTGCAGAACCATGGG - Intronic
923393743 1:233540404-233540426 TGTACAGCCTGCAGAACCATGGG - Intergenic
1063550114 10:7024244-7024266 TGTACAGCCTACACAACCATGGG + Intergenic
1063696564 10:8341275-8341297 TCTACATCCTGCAGAACCATGGG - Intergenic
1064557450 10:16561667-16561689 TGTACAGCTTGCAGAACCATGGG + Intergenic
1064944475 10:20772345-20772367 TGTACAGCCTGAAGAACCATGGG + Intergenic
1065035261 10:21631550-21631572 TGTACAGCCTGCAGAACTGTGGG - Intronic
1065609962 10:27463213-27463235 TGTACAGCCTGTGGAACCATAGG - Intergenic
1065628023 10:27651090-27651112 TGTACAGCCTGCAAAACCATGGG + Intergenic
1066473946 10:35726123-35726145 TGTACAGTCGGCAGAACCACGGG + Intergenic
1067077057 10:43193924-43193946 TGTCCAGGCCTGAGAACCGTGGG + Intergenic
1068686637 10:59876970-59876992 TGTACAGGCCTCGGAGCAATAGG - Intronic
1068735416 10:60408521-60408543 TGTACAGCTTGCAGAACAATGGG + Intronic
1069335771 10:67348473-67348495 TGTACAGCCTGCAGAACAGTGGG - Intronic
1071284912 10:84135567-84135589 TGTATAGCCTGCAGAATCATGGG + Intergenic
1072188636 10:93063515-93063537 TCTCCAGACTTCAGAACAATGGG + Intronic
1072324647 10:94285918-94285940 CAGACAGGCTTCAGAGCCATAGG - Intronic
1072532349 10:96331375-96331397 TATACATCCTGCAGAACCATGGG - Intronic
1073799326 10:107024215-107024237 TGCACACCCTTCAGAACCAGGGG - Intronic
1074395914 10:113097743-113097765 TTTACTGGCTTCAGAAACACAGG + Intronic
1074473669 10:113750267-113750289 TGTACAGCTTGCAGAACCATGGG - Intergenic
1074731373 10:116379978-116380000 TGTACAGCCTGCAGAACCGTGGG + Exonic
1074749877 10:116574719-116574741 TTTCCAGCCTACAGAACCATGGG - Intergenic
1074875962 10:117613615-117613637 TCAAAAGGCTTCAGAAACATTGG + Intergenic
1075512367 10:123082949-123082971 TGTACAGAGCTCAGAACCACAGG + Intergenic
1076046077 10:127295165-127295187 TGTACAGCCTGCAGAACTATGGG - Intronic
1076564871 10:131391607-131391629 TGGACACGCTACAGAACCAGGGG - Intergenic
1078826823 11:14937890-14937912 TGTACAGCCTGCAGAACTGTGGG - Intronic
1079615508 11:22487744-22487766 CTTCCAGCCTTCAGAACCATGGG + Intergenic
1080109933 11:28555232-28555254 TGTACAGCCTGCAGAACCATGGG + Intergenic
1080480722 11:32647162-32647184 TGTACAGCCTGCAGAACCATGGG - Intronic
1084503868 11:69553306-69553328 TGTATAGGAATCAGAAGCATTGG + Intergenic
1084737789 11:71116959-71116981 TGTACAGCCTGCAGAACCGTGGG + Intronic
1084989880 11:72912934-72912956 TGTACAGCCTGCAGAACCATGGG - Intronic
1085482361 11:76833234-76833256 TGTACATCCCCCAGAACCATAGG + Intergenic
1085544886 11:77309174-77309196 GGTACAGCCTGCAGAACCAAGGG - Intergenic
1085960749 11:81458648-81458670 TGTACAGCCTACAGAACCGTAGG + Intergenic
1088561250 11:111118426-111118448 TATACAGCCTGCAGAACCATGGG + Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1090805626 11:130200321-130200343 TATACAGCCTGCAGAACCATGGG - Intronic
1093223274 12:16449155-16449177 TGTACAGCCTGCAGAACTGTGGG - Intronic
1093481158 12:19605153-19605175 TGTACAGCCCATAGAACCATGGG + Intronic
1093730421 12:22559916-22559938 TGTACAGCCTGCAGAATCGTAGG + Intergenic
1094169957 12:27480828-27480850 TGTACAGCTTACAGAACCATAGG + Intronic
1094242375 12:28243021-28243043 TGTACAACCTGCAGAACCGTGGG + Intronic
1095311674 12:40705745-40705767 TGTACAGCCTGCAGAACCGTGGG - Intronic
1095317610 12:40785254-40785276 TGTACAGCCTACAGAACCATGGG - Intronic
1096065836 12:48739544-48739566 TGTACAGCCTGTAGAACCATGGG - Intergenic
1097403620 12:59160995-59161017 TGTACAGCCTGCGGAACCGTGGG - Intergenic
1097860975 12:64518327-64518349 TATACAGTCTGCAGAACCATGGG - Intergenic
1098055663 12:66502768-66502790 TGTACAGCCTGCAGAACTGTGGG + Intronic
1099270745 12:80507115-80507137 TGTACAGGCTTCTGCATAATTGG + Intronic
1099796573 12:87408287-87408309 TGTATAGCCTACAGAACCATAGG + Intergenic
1100019337 12:90050507-90050529 TGTACAGCCTGCAAAACTATAGG + Intergenic
1101510813 12:105390824-105390846 AGTAGAGCCTGCAGAACCATGGG - Intronic
1101895126 12:108750795-108750817 TGTCCCGGGTTCAGAACCACTGG - Intergenic
1103184148 12:118941806-118941828 TGTACAGTCTGCAGAACTGTGGG + Intergenic
1103221222 12:119247361-119247383 TTTAGAGGCAGCAGAACCATGGG + Intergenic
1103430626 12:120882218-120882240 TATACAGGGTTCAGTACTATCGG + Intronic
1104531963 12:129580293-129580315 TGTACAGGCTTCAGCTGGATGGG - Intronic
1104693600 12:130846575-130846597 TTTACAGGCTGCAGACTCATGGG + Intergenic
1106130418 13:26934828-26934850 TGTACAGGCTGCAGAACCATAGG + Intergenic
1106220712 13:27744233-27744255 TGTACAGCCTGCAGAACTGTGGG + Intergenic
1107127854 13:36863813-36863835 AGTACAGCCTGCAGACCCATGGG + Intronic
1107950532 13:45457325-45457347 TGTACAGCCTGCAGAACTATGGG + Intergenic
1109371611 13:61428223-61428245 TGTACAGCCTGCAGAAACATGGG - Intergenic
1110276966 13:73651745-73651767 TGTACAGCCTACAGAACCATAGG - Intergenic
1110370551 13:74735155-74735177 TGTACAGCCTGCAGAACTGTGGG + Intergenic
1111458153 13:88509972-88509994 TGTATAGCCTGCAGAACCATGGG - Intergenic
1111494961 13:89035430-89035452 TGTACAGTCTGCAGAACCATGGG + Intergenic
1111584197 13:90262748-90262770 TGTACAGCCTGCAGAACTGTGGG - Intergenic
1111961225 13:94812662-94812684 TGTACAGTCTGTAGAACCATGGG + Intergenic
1112450867 13:99508589-99508611 TGTACAGCCTGCAGAACTGTGGG - Intronic
1113496433 13:110733670-110733692 TGTACAGCCTGCAGAACCATAGG - Intergenic
1115440232 14:33425970-33425992 TGTTCAAACTTGAGAACCATTGG + Intronic
1115929163 14:38471506-38471528 TGTACAGCCTGCAGAACCATGGG - Intergenic
1116353763 14:43901005-43901027 TGTCCAGGTTTCAGAGCCCTGGG + Intergenic
1117062899 14:51981085-51981107 TGTGCAGGCTGCAGAAGCAGGGG + Intergenic
1117652785 14:57924265-57924287 TATACAGTCTGCAGACCCATGGG - Intronic
1117805808 14:59489722-59489744 TGTACAGCCTGCAAAACCATGGG - Intronic
1118747254 14:68783120-68783142 TGTGCAAGCTTGAGAGCCATTGG + Intergenic
1119178356 14:72586483-72586505 TGTACAGCCCACAGAACCACAGG + Intergenic
1119693588 14:76695439-76695461 AGTCCAGGCTGCAGAGCCATGGG + Intergenic
1120100436 14:80438637-80438659 TGTATAGCCTGCAGAATCATGGG + Intergenic
1120583691 14:86285521-86285543 TTTCCAGGCTGCAAAACCATGGG + Intergenic
1120724486 14:87922637-87922659 TGTACAGCCTGCAGAACCATGGG - Intronic
1120752044 14:88206896-88206918 ATTACAGGGTTCAGAACCACTGG + Intronic
1120768396 14:88353012-88353034 TGTACAGCCTGCAGAACAGTAGG + Intergenic
1121467774 14:94127118-94127140 TGTACAGTCTGCAGAACTGTGGG + Intergenic
1122765638 14:104067707-104067729 TGTACAGCCTGCAGAACCATGGG - Intergenic
1123143266 14:106104323-106104345 GGTTCAGGCTTCAGACCAATGGG + Intergenic
1123962618 15:25421327-25421349 TGTACAGCCTGCAGCACCAGGGG + Intronic
1124073320 15:26415809-26415831 TGTTCAGCCTACAGAACCGTGGG + Intergenic
1125242814 15:37595940-37595962 TGTTCAACCTTCAAAACCATAGG + Intergenic
1125362260 15:38876574-38876596 TGGACAGCCCTCAGAACCACAGG + Intergenic
1126126109 15:45296064-45296086 TGTACAGCCTGCAGAACAGTGGG - Intergenic
1128870999 15:71155142-71155164 TGTACAGCCTGCAGAACTGTGGG - Intronic
1129814116 15:78537073-78537095 TCTAAAGGCTTGAGAACCAGAGG - Intronic
1129990906 15:79962113-79962135 CTTACAGGTTTCAGAACCTTGGG + Intronic
1130811789 15:87386802-87386824 TGTACAGCCTGCAGAACCGTGGG - Intergenic
1135995152 16:27242331-27242353 TGTACAGATCTCAGAACAATAGG - Intronic
1136717589 16:32296344-32296366 TGTACAATCTGCAGAACCAAGGG - Intergenic
1136835965 16:33502608-33502630 TGTACAATCTGCAGAACCAAGGG - Intergenic
1137348925 16:47693386-47693408 TGAACAGGCGTCAGATCGATGGG + Exonic
1137464651 16:48697350-48697372 TGTACAGCCTGAAGAACTATGGG - Intergenic
1137802886 16:51277351-51277373 TCTGCAGGCTTCAGAAACAAGGG + Intergenic
1139023129 16:62777488-62777510 TGTAAATGCTTCACAAACATGGG - Intergenic
1140343719 16:74191069-74191091 TGAACAGGCTTCAAATCCCTTGG - Intergenic
1141235411 16:82211405-82211427 TGTACAGCCTGCAGAACCATGGG - Intergenic
1141381927 16:83584766-83584788 TGTACAACCTGCAGAACCATGGG - Intronic
1141498375 16:84426108-84426130 TGTACGGCCTGTAGAACCATAGG - Intronic
1203008839 16_KI270728v1_random:221430-221452 TGTACAATCTGCAGAACCAAGGG + Intergenic
1203146142 16_KI270728v1_random:1802929-1802951 TGTACAATCTGCAGAACCAAGGG - Intergenic
1142766572 17:2067758-2067780 TGCAGAGGCTGCAGAACCCTGGG - Intronic
1143942717 17:10559383-10559405 TGTTCAGGGTTGAGAACCACTGG - Intergenic
1144209023 17:12999430-12999452 GGCACAGGCTTTGGAACCATCGG - Intronic
1146239431 17:31203750-31203772 TGGACTGGCTAAAGAACCATGGG - Intronic
1148463960 17:47853506-47853528 TGCACAGGCTTTAGCACCTTAGG - Intronic
1149067475 17:52497439-52497461 TGTACAGCCTGCAGAACTGTGGG - Intergenic
1149298667 17:55284579-55284601 TGCCCAGGCTTCCCAACCATGGG - Intronic
1150956757 17:69868267-69868289 TGTACAGCCTGCAGAAGCATGGG - Intergenic
1150963463 17:69940089-69940111 TGTACAGCCTGCAGAACCATGGG + Intergenic
1151002144 17:70389835-70389857 TGGAGAGGCCTCAGAATCATGGG - Intergenic
1151126592 17:71851955-71851977 TGTACAGCCTGTAGAACCATTGG + Intergenic
1151248739 17:72817151-72817173 TGTACAGGCTTCAGAACCATTGG - Intronic
1152373268 17:79903820-79903842 TGCACAAGCTCTAGAACCATCGG + Intergenic
1153603698 18:6809473-6809495 TGTACAACCCACAGAACCATGGG - Intronic
1154284964 18:13046072-13046094 TATACAGCCTGCAGAACTATGGG - Intronic
1154474423 18:14742237-14742259 TGTACAATCTGCAGAACCAAGGG - Intronic
1155552800 18:26983557-26983579 TGTATAGCCTGCAGAGCCATGGG + Intronic
1155660048 18:28238657-28238679 TGTACAGCCTGCAGAACCATGGG - Intergenic
1156887784 18:42155690-42155712 TATTCAGGGTTCAGAACCAATGG - Intergenic
1157897489 18:51482915-51482937 TTCCCAGCCTTCAGAACCATGGG + Intergenic
1158274992 18:55757545-55757567 TTCCCAGCCTTCAGAACCATGGG - Intergenic
1158490201 18:57903033-57903055 TGTCTAGGCTTGAGAACCCTTGG - Intergenic
1159083303 18:63759856-63759878 TGTGGAGGCCTCAGAATCATGGG - Intronic
1160035052 18:75292643-75292665 TGTACAGGTTTCTGAACATTTGG - Intergenic
1160155601 18:76431803-76431825 TATACAGTCTGCAGAACCGTGGG + Intronic
1162602606 19:11680448-11680470 TGTGCAGTCTGCAGAATCATGGG - Intergenic
1162880970 19:13659062-13659084 TGTGCAAGTTGCAGAACCATTGG - Intergenic
1164523817 19:28999136-28999158 TATACAGCCTGCAGAACCATGGG - Intergenic
1164883252 19:31754452-31754474 TGTACAGCCTGCGGAACCATGGG - Intergenic
1165150401 19:33756872-33756894 TGTACAGCCTCCAGAGCCCTGGG - Intronic
1165154101 19:33777117-33777139 CCTCCAGGCCTCAGAACCATGGG - Intergenic
1166355354 19:42224229-42224251 TGTGTAGGCTTCAGAGACATGGG + Exonic
1168451694 19:56471267-56471289 TGTACAACCTGCAGAACCGTGGG + Intronic
925312547 2:2896114-2896136 TGTACAGCCTGCAGATTCATGGG - Intergenic
928571611 2:32614972-32614994 TGTACAGCCTACAGAACCATGGG - Intronic
930276996 2:49323316-49323338 TGTACAGCCTGCAGAATCATGGG - Intergenic
931410581 2:62026238-62026260 TGTACAGCCTGCAGAACTGTAGG - Intronic
932061028 2:68497548-68497570 TGTACAGGCTACAGAACTGTGGG + Intronic
932528619 2:72501440-72501462 TGTACAGCCTGCAGAACCTTGGG + Intronic
933131570 2:78678934-78678956 CTTCCAGCCTTCAGAACCATGGG - Intergenic
934551549 2:95265831-95265853 TGTACAGCCCACAGAACCGTGGG + Intergenic
935282617 2:101532296-101532318 TTTACAGGCTACAAAACCTTGGG - Intergenic
936168723 2:110148386-110148408 TGTACAGTCTGCAGAACCAGGGG + Intronic
937574114 2:123398264-123398286 TGTTCAAGTTTGAGAACCATTGG + Intergenic
937760842 2:125601873-125601895 TTTGGAGGCTGCAGAACCATTGG + Intergenic
938339261 2:130524381-130524403 TGGACAGGCATCAGAATCACAGG + Intronic
938350578 2:130596369-130596391 TGGACAGGCATCAGAATCACAGG - Intronic
939452951 2:142397591-142397613 TGTACAACCTGCAGAACCATGGG + Intergenic
939607275 2:144268300-144268322 TGTACAGCCTGCAGAACCGTGGG + Intronic
939768092 2:146279030-146279052 TCTACAAGCTTCAGAATCCTTGG - Intergenic
941952655 2:171172793-171172815 TGTACAGCCTGCAGAACTGTGGG + Intronic
941997125 2:171611361-171611383 TGTATAGCCTGCAGAACCGTGGG + Intergenic
942340361 2:174937907-174937929 TGTACATTCTGCAGAACAATGGG + Intronic
943184644 2:184591929-184591951 TTTCCAGCCCTCAGAACCATAGG + Intergenic
943238658 2:185356254-185356276 TGTATAGCCTGCAGAACCATGGG + Intergenic
943348501 2:186770024-186770046 TGTAAAGCCTGCAGAACCATTGG - Intergenic
944037458 2:195312732-195312754 TGTACAGCCTGCAGAACCATGGG - Intergenic
945328640 2:208514299-208514321 TGTACAGTCTGTGGAACCATGGG - Intronic
946837143 2:223783851-223783873 GTAACAGGCTTCAGAACCATGGG - Intronic
946837530 2:223787246-223787268 TATACAGCCTTCAGAACCATGGG + Intronic
1169639911 20:7740417-7740439 TGTACAGACTGCAGAACCATGGG + Intergenic
1170313680 20:15018974-15018996 TGTACAGCCTGCAGAATCATTGG + Intronic
1170947436 20:20903933-20903955 TGTACAGACTTCAGAGCTCTTGG + Intergenic
1171884950 20:30645349-30645371 TTTACAGCCTGCAGAACCATGGG - Intergenic
1172755788 20:37283409-37283431 TTTTCAGGTTTCACAACCATGGG + Intergenic
1173029181 20:39338919-39338941 TTTACAGGCCTCAGAGCCCTCGG - Intergenic
1174142721 20:48427470-48427492 TGCAAAGTCTTCAGAACCAGGGG - Intergenic
1174829322 20:53798108-53798130 TGTACAGCCTGCAGAACCCTAGG + Intergenic
1174924844 20:54748126-54748148 TGTACAGCCTGCAGAACGATGGG - Intergenic
1177023714 21:15895881-15895903 TGAACTGGCCTCAGAACCACTGG + Intergenic
1177529550 21:22341789-22341811 TGCACAGCTTGCAGAACCATAGG - Intergenic
1177714580 21:24822626-24822648 TGTTCATGGTTGAGAACCATTGG - Intergenic
1178408609 21:32346258-32346280 TGTACAGCCTGCAGACGCATGGG + Intronic
1179563534 21:42232253-42232275 TGGACAGGCTTCATATCCAAGGG + Intronic
949889428 3:8722510-8722532 TGTACAGCCTGCAGAACCATGGG + Intronic
951441745 3:22731581-22731603 TGTACAGCCTACAGAACTGTGGG - Intergenic
951524946 3:23644551-23644573 TGTCCTGGCTTCAGAACCCTGGG - Intergenic
953592988 3:44277922-44277944 TGTAAAGCCTGCAGAACCATGGG + Intronic
955522086 3:59784925-59784947 TGTACAGCCTGCAGAACTATGGG - Intronic
955946418 3:64198785-64198807 TGTTCAGGCTTCAGACCCGGCGG + Exonic
956008066 3:64801663-64801685 GGTGCAGGCTTCAGAATCAAAGG + Intergenic
956552857 3:70481156-70481178 TGTACAGCCTGCAGAACCATGGG - Intergenic
957560994 3:81820705-81820727 TGTATAGCCTGCAGAACCATGGG - Intergenic
957599935 3:82320995-82321017 TCTACAGCCTGCAGAATCATGGG - Intergenic
957843545 3:85701040-85701062 TGTATACCCTGCAGAACCATGGG - Intronic
958444216 3:94194963-94194985 TGTAAAGCCTGCAAAACCATGGG + Intergenic
958650952 3:96936105-96936127 TGTACATGCTGCAGCTCCATAGG + Intronic
958736622 3:98016485-98016507 TGTATGGCCTGCAGAACCATGGG + Intronic
959389497 3:105757108-105757130 TGTACAGCCTGCATAACCAAGGG + Intronic
961360334 3:126363292-126363314 TGTACAGCCTGCAGAACTGTGGG - Intergenic
962076861 3:132091124-132091146 AGTACAGGCTACACAACCAAAGG + Intronic
962121581 3:132565893-132565915 TGTACAGCCTGCAGAACCATGGG + Intronic
962324556 3:134422587-134422609 TGTAAAGCCTGCAGAACCATAGG + Intergenic
962440755 3:135413744-135413766 TGTACAACCTGCAGAACCGTGGG + Intergenic
962476141 3:135757040-135757062 TGAATATGCTTCAGAACCCTGGG - Intergenic
962507298 3:136060650-136060672 TGTACAGTCTGCAGAACTGTGGG + Intronic
962960641 3:140308234-140308256 AGTACAGGCTTCAGGGCCAGAGG + Intronic
963067211 3:141273301-141273323 CTTACAGGCTTCAGGACCTTAGG + Intronic
963342282 3:144051443-144051465 TGTGCAGTCTTCACAACCAAAGG + Intergenic
964135654 3:153342111-153342133 TGGACAGCCTGCAGAGCCATTGG + Intergenic
964856578 3:161152149-161152171 TGTACAGGCTGCAGAATTGTGGG - Intronic
965788370 3:172361003-172361025 TGTACAGCCTACAGAACCAAAGG - Intronic
966271506 3:178112584-178112606 TGTACAGCCTGCAGAGCTATGGG + Intergenic
966283056 3:178257761-178257783 CGTTCAGTCTTCAGAACCATGGG + Intergenic
967386864 3:188920533-188920555 TGTACAACCTGCAGAACCATGGG + Intergenic
967441569 3:189515005-189515027 GGTACAGGCTACAAAACTATAGG - Intergenic
967911314 3:194544765-194544787 TGTACAGCCTGCAGAACCAAGGG + Intergenic
967992308 3:195140524-195140546 TGTACAGTCTGCAGAACTGTGGG - Intronic
970524036 4:16913424-16913446 TGCACATGATGCAGAACCATCGG - Intergenic
970658811 4:18261408-18261430 TGTACATGTTTCAAAACAATAGG - Intergenic
971835780 4:31761272-31761294 TGTACAGTCTGCAGAACCGTGGG - Intergenic
973029952 4:45325069-45325091 TGTACAGCCTGCAGAACCATAGG + Intergenic
973342291 4:49017681-49017703 TGAACAGCCTGTAGAACCATGGG - Intronic
974636714 4:64572983-64573005 TGCACAGCCTGCAGAATCATGGG + Intergenic
974787109 4:66632960-66632982 TTTACAGCCTGCAGAACCATGGG - Intergenic
976437306 4:85032984-85033006 TTTCCAGACTTCAGAACTATGGG - Intergenic
976946842 4:90780909-90780931 TGTACAGTCTGCAGAACTGTGGG - Intronic
977720017 4:100229100-100229122 TGTACAGCTGGCAGAACCATGGG + Intergenic
978528748 4:109693221-109693243 TGTACAGCCTGCAGAACTGTAGG + Intronic
979049178 4:115908973-115908995 TGTATAGCCTGCAGAACCATGGG - Intergenic
979860476 4:125687084-125687106 TGTACAGTCTGCAGAGCCATAGG - Intergenic
979861795 4:125702756-125702778 TGGACAGCATTCAGAACCAGAGG - Intergenic
980830831 4:138127921-138127943 TGTACAGCCTGCAGAACTATAGG + Intergenic
981901765 4:149873767-149873789 TGTACAGTCTGTAGAACCATGGG - Intergenic
982337355 4:154255493-154255515 GGTCCAGGGTTCAGATCCATTGG - Intronic
982607694 4:157535895-157535917 TGTACAGGGTGCAGAACTGTGGG + Intergenic
982897923 4:160957525-160957547 TGTACATTCTCCAGAACCCTGGG - Intergenic
983277019 4:165630318-165630340 TGTACAGTGTTCAAAGCCATAGG + Intergenic
984042869 4:174758119-174758141 TGAACAGCCTACAGAACTATGGG + Intronic
984215577 4:176909742-176909764 TGTACAGCCTGCAGAACTCTGGG + Intergenic
985199560 4:187470818-187470840 TGTCCAGCCTGCAGAACCATAGG + Intergenic
987264924 5:16243330-16243352 TGTACAGCCTACAGAATCATGGG + Intergenic
987477511 5:18409760-18409782 CGTATAGCCTGCAGAACCATAGG - Intergenic
988492146 5:31713923-31713945 TGTACAGCCTGCAGAACCATGGG + Intronic
988517528 5:31917707-31917729 TGTACAGCCTGCAGAACTGTGGG - Intronic
988981177 5:36570826-36570848 TGTGCAGGCTTCTGAGCAATGGG - Intergenic
990995693 5:61730263-61730285 TGTACAGCCTGCAGAATTATGGG - Intronic
992198409 5:74361918-74361940 AGCACAGGCTTGAGAACAATGGG - Intergenic
994941524 5:106329555-106329577 TGTACAGTCTGCAGAACCATGGG + Intergenic
994979351 5:106853697-106853719 TTTACAGGCTTCACAGCCACTGG + Intergenic
995242018 5:109896053-109896075 TGTACAGCCTGCAGAACCATAGG - Intergenic
995810143 5:116097672-116097694 CGTACAGCCTGCAGAACCGTGGG - Intronic
996914246 5:128693495-128693517 TGTACAGTCTGCAAAACCATGGG - Intronic
996929339 5:128867235-128867257 TGGCAAGGCTTCAGAATCATGGG - Intronic
997022602 5:130019039-130019061 TGTACAGCCTGCAGAACCATGGG + Intronic
997768525 5:136529629-136529651 TGTATAGCCTGCAGAACCGTGGG - Intergenic
997905418 5:137811688-137811710 TATACAGCCTGTAGAACCATGGG + Intergenic
998277497 5:140770580-140770602 TGTACAGTCTGCCAAACCATTGG + Intergenic
998591639 5:143485382-143485404 TGTACAGCCTGCAGAACTATGGG - Intergenic
998873596 5:146576763-146576785 TGTACAGCCTGCAGAACTGTGGG - Intergenic
1000646804 5:163769444-163769466 TGTACAGGGTGCAGAGCTATGGG - Intergenic
1000671095 5:164064009-164064031 TGTACAGCCTGCAGAATCATGGG + Intergenic
1000862611 5:166474651-166474673 TGTACAGCCTGCAGAATCATGGG + Intergenic
1000955047 5:167533348-167533370 TGTACAGGCTTGAGTACAATGGG + Intronic
1001630239 5:173169510-173169532 TGAACAGGCTTCAGAAGCAATGG + Intergenic
1002394656 5:178943204-178943226 TGTACAGCCTACAGAACCGTGGG - Intronic
1003168853 6:3704468-3704490 TGTACAGCCTGCAGAACTGTAGG + Intergenic
1003916450 6:10791060-10791082 TGTACAACCTGCAGAACCATGGG + Intronic
1003977854 6:11360711-11360733 TGTATAGCCTGCAGAACCGTGGG + Intronic
1004219347 6:13732253-13732275 TGTACAGGGTTCAGAAAAACAGG - Intergenic
1004624183 6:17359160-17359182 TGTACAGCCTGCAGAACCGTAGG + Intergenic
1005221332 6:23592116-23592138 TGTATGGCCTACAGAACCATGGG + Intergenic
1005228360 6:23670594-23670616 TGTAGAGGCTGTAGCACCATGGG - Intergenic
1008562247 6:52734720-52734742 TGTACAGTCTGCAGAAACATGGG - Intergenic
1008750939 6:54733270-54733292 TGTGCAGTCTGCAGAACTATTGG - Intergenic
1011245479 6:85317185-85317207 TATACAGCCTACAGAACCATGGG + Intergenic
1012080457 6:94751217-94751239 TGTACAGCCTGCAGAGCCAAGGG + Intergenic
1012429728 6:99152003-99152025 TCCATAGGCTTCAGACCCATAGG + Intergenic
1012711822 6:102616753-102616775 TGTACAGGTTCCAGTACAATTGG - Intergenic
1015696266 6:135983286-135983308 TGAACTGACTTCAGAACCAAGGG + Intronic
1015873214 6:137797890-137797912 TATACAGCCTGCAGAACCATGGG - Intergenic
1015907816 6:138135871-138135893 TGCACAGCCTGCAAAACCATGGG + Intergenic
1017925296 6:158906640-158906662 TGTATAGCCTGCAAAACCATTGG + Intronic
1019089666 6:169518100-169518122 TTTGCAGGCTTCAGACCCAATGG + Intronic
1020502863 7:8944945-8944967 TGTACAGCCTGCAGAACTGTGGG - Intergenic
1021409698 7:20316001-20316023 TTTTCAGGCTTCAGAACTATGGG + Intergenic
1021543964 7:21791931-21791953 TGTACAGCCTGCAGAATCATGGG - Intronic
1023328792 7:39090531-39090553 TCTCCAGGCTTCAGTACCTTGGG + Intronic
1023616607 7:42026230-42026252 TGGACGGGGTTCAGAACCGTAGG + Exonic
1024176359 7:46844768-46844790 CATCCAGGCTTGAGAACCATTGG + Intergenic
1024609056 7:51047330-51047352 TGTAATGGCCTCTGAACCATGGG - Intronic
1026534915 7:71231555-71231577 TTTTCAGCCTTCAGAATCATGGG - Intronic
1027838500 7:83278059-83278081 AGTTCAGGCTTCAGGACAATGGG + Intergenic
1029664137 7:101983568-101983590 TGTACAACCTGCAGAACCATGGG - Intronic
1029690742 7:102179712-102179734 TTCACAGGCTTCAGAGCCAGGGG + Intronic
1030648369 7:112089829-112089851 TGTACAGCCTGCAGAATCATGGG + Intronic
1032651617 7:133884992-133885014 TGTTCAGTCCTTAGAACCATGGG + Intronic
1033105089 7:138513448-138513470 TGTACAGCCTGAAGAACCATGGG - Intronic
1034437025 7:151067397-151067419 TGTACAACCTTCACAACCAAAGG - Intronic
1035014931 7:155757739-155757761 TGTAAAGCCTGCAGAACCCTGGG - Intronic
1036081488 8:5561521-5561543 TGAACAGGTTTCAGTAACATTGG - Intergenic
1036510119 8:9392296-9392318 TGTACAGACTGCAGAACCATGGG + Intergenic
1036599555 8:10247862-10247884 GGTACAGCCTTCAGATCCCTGGG + Intronic
1039015311 8:33141604-33141626 TGTAGAGCCTTCAGAACAAAGGG + Intergenic
1039026836 8:33267756-33267778 TATACAGGGTTCTGTACCATTGG - Intergenic
1041216799 8:55608782-55608804 TATACAGCCTGCAGAACCATGGG - Intergenic
1042247499 8:66722750-66722772 TGTACAGCCTGCAGAACCATGGG - Intronic
1042501474 8:69514225-69514247 TGTACAGTCTGCAGAACTGTCGG - Intronic
1043600173 8:81928197-81928219 TGTACCTGGTTGAGAACCATTGG + Intergenic
1044552931 8:93532332-93532354 TGCACAGCCTGCAGAACCATGGG + Intergenic
1045097288 8:98811023-98811045 TGTACAACCTGCAGAACCATGGG + Intronic
1045720866 8:105109190-105109212 TCTAAAGGCCTCAGAACCAGGGG - Intronic
1045987417 8:108264680-108264702 TGTACAGCCTGCAGAACTGTGGG + Intronic
1046184956 8:110700957-110700979 TGTATAGTCTTCAAAAGCATGGG + Intergenic
1047784409 8:128139697-128139719 TGTATAGACTTGAGAACCAGGGG - Intergenic
1047852381 8:128871412-128871434 TGTACAGGTTTCATCACAATAGG + Intergenic
1048578868 8:135714622-135714644 TATACAGTCTGCAGAACCTTAGG - Intergenic
1048956727 8:139543602-139543624 AGTACATGCTACAGAACCAGAGG - Intergenic
1049839451 8:144761722-144761744 TGTACAGCCTGCAGAACCATGGG + Intergenic
1049859800 8:144890580-144890602 TGGACAGGCTCCTGAACCATAGG - Intronic
1050961411 9:11738118-11738140 CCTACAGGCCTCAGAACCAGAGG + Intergenic
1051040828 9:12808935-12808957 TGTACAGCCTGCAGAACCATGGG - Intronic
1051724120 9:20071164-20071186 TGCACAGCCTTCAGAACTGTGGG + Intergenic
1052493181 9:29192811-29192833 TGAACAAACTGCAGAACCATGGG - Intergenic
1052779247 9:32763646-32763668 TGTACAGCCCACAGAACCATGGG + Intergenic
1053083619 9:35198427-35198449 TGTACAGCCTACAGAACTGTGGG + Intronic
1054797776 9:69318550-69318572 TGTAGAGTCTGCAGAACCATGGG - Intergenic
1056890487 9:90487548-90487570 TGTACAGTGTTTAAAACCATGGG - Intergenic
1057158654 9:92868552-92868574 TGTACAGCCTGCAGAACCATGGG - Intronic
1059475257 9:114541336-114541358 TATAGAGCCTGCAGAACCATGGG + Intergenic
1059795062 9:117685522-117685544 TGTAGAGGCTTCAGAAACAAAGG - Intergenic
1060319970 9:122549344-122549366 TGTACAGCCTGCAGAACCATGGG + Intergenic
1186974956 X:14892213-14892235 TGTATAGCCTGCAGAACCATGGG - Intronic
1187039693 X:15580504-15580526 AGCACAGGCTTCAGAATCCTAGG - Intronic
1187633500 X:21201505-21201527 TTTACAGCCTGCAGAATCATGGG - Intergenic
1188956256 X:36437544-36437566 AGTTCAGGCTTCAGGACAATAGG - Intergenic
1189594538 X:42549837-42549859 TGTACAGCCTACAGAACCATGGG - Intergenic
1190537555 X:51445180-51445202 TGTACAACCTGCAGAACCATGGG - Intergenic
1190834817 X:54090653-54090675 TGTACAGTTTTCAGAACAATGGG + Intronic
1190852639 X:54261303-54261325 TTTTCAGGATTCAGAACCCTTGG + Intronic
1190959008 X:55227152-55227174 TGTATAGCCTGCAGAACCATGGG + Intronic
1190959293 X:55229217-55229239 TGTGCAGCCTGCAGAACTATGGG + Intronic
1192069559 X:67922808-67922830 TGTGCTGGGTTCAGAACCAGTGG + Intergenic
1193025006 X:76837638-76837660 TGTACAGCCTGCAGAATTATGGG - Intergenic
1195197173 X:102510227-102510249 TGTACATGCTTCAGCATCACAGG - Intergenic
1196805609 X:119582612-119582634 TGGACATACTTCAGAACCGTTGG + Exonic
1197812261 X:130455642-130455664 TGCACGGCCTGCAGAACCATGGG + Intergenic
1197848491 X:130830954-130830976 TTCCCAGCCTTCAGAACCATAGG - Intronic
1198070482 X:133143415-133143437 TGTACAGCCTACAGAACTGTGGG + Intergenic
1198266474 X:135013786-135013808 TGCACAGGCATTCGAACCATTGG + Intergenic
1199493202 X:148423978-148424000 CCTAAAGGCTTGAGAACCATGGG + Intergenic
1199574989 X:149305299-149305321 TGTACAGAATTGAGAACCACTGG - Intergenic
1201372172 Y:13277844-13277866 TGTACCGGGCTCAGAGCCATTGG + Intronic
1201586495 Y:15566986-15567008 TCTAAAGGCATCAGAAACATAGG - Intergenic