ID: 1151249324

View in Genome Browser
Species Human (GRCh38)
Location 17:72821388-72821410
Sequence CCTCCGCCTCCTGAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703385
Summary {0: 412, 1: 100196, 2: 206734, 3: 241376, 4: 154667}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151249324_1151249329 6 Left 1151249324 17:72821388-72821410 CCCAGCTACTCAGGAGGCGGAGG 0: 412
1: 100196
2: 206734
3: 241376
4: 154667
Right 1151249329 17:72821417-72821439 AACCGATTGAACTCAGGAGGCGG 0: 1
1: 17
2: 1385
3: 22225
4: 68735
1151249324_1151249332 15 Left 1151249324 17:72821388-72821410 CCCAGCTACTCAGGAGGCGGAGG 0: 412
1: 100196
2: 206734
3: 241376
4: 154667
Right 1151249332 17:72821426-72821448 AACTCAGGAGGCGGAGGTTGTGG 0: 102
1: 2486
2: 8639
3: 13723
4: 16196
1151249324_1151249327 0 Left 1151249324 17:72821388-72821410 CCCAGCTACTCAGGAGGCGGAGG 0: 412
1: 100196
2: 206734
3: 241376
4: 154667
Right 1151249327 17:72821411-72821433 CACAAGAACCGATTGAACTCAGG 0: 1
1: 2
2: 114
3: 2222
4: 15906
1151249324_1151249331 9 Left 1151249324 17:72821388-72821410 CCCAGCTACTCAGGAGGCGGAGG 0: 412
1: 100196
2: 206734
3: 241376
4: 154667
Right 1151249331 17:72821420-72821442 CGATTGAACTCAGGAGGCGGAGG 0: 2
1: 476
2: 10637
3: 52977
4: 114797
1151249324_1151249328 3 Left 1151249324 17:72821388-72821410 CCCAGCTACTCAGGAGGCGGAGG 0: 412
1: 100196
2: 206734
3: 241376
4: 154667
Right 1151249328 17:72821414-72821436 AAGAACCGATTGAACTCAGGAGG 0: 1
1: 4
2: 244
3: 5946
4: 46585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151249324 Original CRISPR CCTCCGCCTCCTGAGTAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr