ID: 1151249326

View in Genome Browser
Species Human (GRCh38)
Location 17:72821389-72821411
Sequence GCCTCCGCCTCCTGAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673444
Summary {0: 326, 1: 87682, 2: 194410, 3: 231057, 4: 159969}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151249326_1151249329 5 Left 1151249326 17:72821389-72821411 CCAGCTACTCAGGAGGCGGAGGC 0: 326
1: 87682
2: 194410
3: 231057
4: 159969
Right 1151249329 17:72821417-72821439 AACCGATTGAACTCAGGAGGCGG 0: 1
1: 17
2: 1385
3: 22225
4: 68735
1151249326_1151249331 8 Left 1151249326 17:72821389-72821411 CCAGCTACTCAGGAGGCGGAGGC 0: 326
1: 87682
2: 194410
3: 231057
4: 159969
Right 1151249331 17:72821420-72821442 CGATTGAACTCAGGAGGCGGAGG 0: 2
1: 476
2: 10637
3: 52977
4: 114797
1151249326_1151249327 -1 Left 1151249326 17:72821389-72821411 CCAGCTACTCAGGAGGCGGAGGC 0: 326
1: 87682
2: 194410
3: 231057
4: 159969
Right 1151249327 17:72821411-72821433 CACAAGAACCGATTGAACTCAGG 0: 1
1: 2
2: 114
3: 2222
4: 15906
1151249326_1151249328 2 Left 1151249326 17:72821389-72821411 CCAGCTACTCAGGAGGCGGAGGC 0: 326
1: 87682
2: 194410
3: 231057
4: 159969
Right 1151249328 17:72821414-72821436 AAGAACCGATTGAACTCAGGAGG 0: 1
1: 4
2: 244
3: 5946
4: 46585
1151249326_1151249332 14 Left 1151249326 17:72821389-72821411 CCAGCTACTCAGGAGGCGGAGGC 0: 326
1: 87682
2: 194410
3: 231057
4: 159969
Right 1151249332 17:72821426-72821448 AACTCAGGAGGCGGAGGTTGTGG 0: 102
1: 2486
2: 8639
3: 13723
4: 16196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151249326 Original CRISPR GCCTCCGCCTCCTGAGTAGC TGG (reversed) Intronic
Too many off-targets to display for this crispr