ID: 1151249328

View in Genome Browser
Species Human (GRCh38)
Location 17:72821414-72821436
Sequence AAGAACCGATTGAACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52780
Summary {0: 1, 1: 4, 2: 244, 3: 5946, 4: 46585}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151249326_1151249328 2 Left 1151249326 17:72821389-72821411 CCAGCTACTCAGGAGGCGGAGGC 0: 326
1: 87682
2: 194410
3: 231057
4: 159969
Right 1151249328 17:72821414-72821436 AAGAACCGATTGAACTCAGGAGG 0: 1
1: 4
2: 244
3: 5946
4: 46585
1151249324_1151249328 3 Left 1151249324 17:72821388-72821410 CCCAGCTACTCAGGAGGCGGAGG 0: 412
1: 100196
2: 206734
3: 241376
4: 154667
Right 1151249328 17:72821414-72821436 AAGAACCGATTGAACTCAGGAGG 0: 1
1: 4
2: 244
3: 5946
4: 46585
1151249321_1151249328 11 Left 1151249321 17:72821380-72821402 CCTGTAGTCCCAGCTACTCAGGA 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
Right 1151249328 17:72821414-72821436 AAGAACCGATTGAACTCAGGAGG 0: 1
1: 4
2: 244
3: 5946
4: 46585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151249328 Original CRISPR AAGAACCGATTGAACTCAGG AGG Intronic
Too many off-targets to display for this crispr