ID: 1151251208

View in Genome Browser
Species Human (GRCh38)
Location 17:72836757-72836779
Sequence TGCTAAAGGCTGCCACTTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151251208_1151251212 -1 Left 1151251208 17:72836757-72836779 CCCGTAAGTGGCAGCCTTTAGCA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1151251212 17:72836779-72836801 ATTATTGGTATATTTTATTATGG 0: 1
1: 0
2: 7
3: 59
4: 715
1151251208_1151251213 23 Left 1151251208 17:72836757-72836779 CCCGTAAGTGGCAGCCTTTAGCA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1151251213 17:72836803-72836825 CAATGATGCATGCCTTTGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151251208 Original CRISPR TGCTAAAGGCTGCCACTTAC GGG (reversed) Intronic
905106057 1:35564300-35564322 TGCTGAAGGCTGTCACTGATGGG - Intronic
905785108 1:40749247-40749269 ACCTAAACCCTGCCACTTACTGG + Intronic
907401214 1:54226104-54226126 TGGGAGAGGCTGCCACTGACAGG - Intronic
907909096 1:58811581-58811603 TTCTCAAGGTGGCCACTTACTGG + Intergenic
912491316 1:110064309-110064331 TCCTAAAGTCTACCACTTACTGG - Intronic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
913547191 1:119880806-119880828 TTCTAAACACTGCCACTGACAGG - Intergenic
913557014 1:119977531-119977553 TTCTAAACACTGCCACTGACAGG + Intronic
917332904 1:173900805-173900827 TGCTGAAGGCTTCCTGTTACTGG + Exonic
1063662680 10:8044931-8044953 TGCTAATGGATGCCACTGGCCGG + Intergenic
1065460903 10:25963195-25963217 GACTAAAGACTGCCAATTACAGG + Intronic
1070926095 10:80222830-80222852 AGCTAAATGCTGCCACCTGCCGG + Intergenic
1071770523 10:88724539-88724561 TGCTAAAAGCTGCCACATTTGGG - Exonic
1072239547 10:93482738-93482760 AGCTAAAGGGTGCCTCTTACTGG + Intergenic
1075811090 10:125225460-125225482 TGCTGAAGGCTGCCAATTTCAGG - Intergenic
1077386975 11:2274330-2274352 TGCTGTAGGATTCCACTTACAGG - Intergenic
1078900671 11:15639595-15639617 TGCTGAAGGCTGGCTCTTCCTGG + Intergenic
1079154211 11:17929322-17929344 TGCTCAAGGCAGCCACTAAGAGG + Intronic
1080611102 11:33904662-33904684 TATTACAGGCTGCCCCTTACGGG + Intergenic
1084212971 11:67632325-67632347 TGCTGAAGGGTGCCACAGACAGG - Exonic
1085407973 11:76275410-76275432 TGCTAAAGGCAACCAGTTAGTGG + Intergenic
1085580749 11:77648079-77648101 TGCCAAAAGCTGCAACTTAGGGG + Intergenic
1086402117 11:86469562-86469584 TGCGAGAAGCTCCCACTTACCGG + Intronic
1088818872 11:113440335-113440357 TGATAAAGGCATGCACTTACAGG + Intronic
1092258760 12:6941365-6941387 TGCTCACAGCTGCCCCTTACCGG + Exonic
1096743247 12:53709816-53709838 TGCACAAGGCAGCCACTCACTGG + Intronic
1105641339 13:22268214-22268236 TGCTTAGGGCTGCCACAAACTGG + Intergenic
1106175699 13:27329366-27329388 TGCTAAAGTCTGCCACGCACTGG + Intergenic
1106368848 13:29111833-29111855 TGCTAATTGCTGCCTGTTACAGG - Intronic
1108423207 13:50271556-50271578 TGCTAAAGGCTCTCATCTACTGG + Intronic
1110713511 13:78675570-78675592 AACTAAAGGCTGCCAATTATAGG - Intergenic
1113138448 13:107119542-107119564 ATCTAAAATCTGCCACTTACTGG + Intergenic
1113568418 13:111335682-111335704 TGCTAACGATTGCCACTTTCAGG - Intronic
1114248769 14:20939172-20939194 AGCTAAAGGCTGTCAGATACAGG - Intergenic
1115039024 14:28898440-28898462 CTCTAAAGCCTGCTACTTACAGG + Intergenic
1125217617 15:37294676-37294698 TGCAAATGGCAGCAACTTACTGG - Intergenic
1125319842 15:38474323-38474345 TGTTATAGGCTACCACCTACAGG - Intronic
1126627257 15:50696917-50696939 TCCCAAAGACTCCCACTTACAGG - Intergenic
1129053392 15:72801155-72801177 TCCTTAATTCTGCCACTTACTGG + Intergenic
1129758678 15:78114130-78114152 TGCTAAAAGCTGCCAGTTGAAGG - Intronic
1133000748 16:2850269-2850291 TGGTGAATCCTGCCACTTACAGG + Intergenic
1133385025 16:5362773-5362795 TGCTATATGATTCCACTTACAGG - Intergenic
1134517302 16:14897438-14897460 AGGGAAAGACTGCCACTTACTGG - Intronic
1134704970 16:16296092-16296114 AGGGAAAGACTGCCACTTACTGG - Intergenic
1134962571 16:18416022-18416044 AGGGAAAGACTGCCACTTACTGG + Intergenic
1134966868 16:18498621-18498643 AGGGAAAGACTGCCACTTACTGG + Intronic
1136530614 16:30866145-30866167 TGCTAAAGGCAGCGTCTTTCAGG + Intronic
1139698524 16:68692642-68692664 TGCTAGAGTCTGCAAATTACTGG + Intronic
1141390145 16:83657783-83657805 TGCTGAAGGATGCCACTGGCAGG - Intronic
1143515044 17:7415257-7415279 TGCAAGAGGAGGCCACTTACTGG - Intronic
1145861734 17:28216913-28216935 GGCAAAAGGCTCCCACTTCCAGG + Intergenic
1146662061 17:34671319-34671341 TATTAATGGCTCCCACTTACAGG - Intergenic
1148602179 17:48902695-48902717 TGCTAAACACTGACACTTCCAGG - Intergenic
1151251208 17:72836757-72836779 TGCTAAAGGCTGCCACTTACGGG - Intronic
1152794876 17:82301925-82301947 TGCTGAGGGCTGTCACTTGCCGG - Intergenic
1164477019 19:28583605-28583627 TGCTCAGGGCTGTCACTTAGGGG - Intergenic
926192395 2:10738612-10738634 TCCAAATGGCTGCCATTTACTGG - Intronic
941160339 2:162027999-162028021 GGCTCAAGGCTGCCACTGAAGGG - Intronic
944165477 2:196714901-196714923 TGCAAAAGACGGCAACTTACAGG - Intronic
947670434 2:231932334-231932356 TGATAAAGGCTGGCACATAAAGG + Intergenic
948939407 2:241188613-241188635 TGCGAATGGCTGCCACTGCCTGG + Exonic
1174158955 20:48536760-48536782 TACTCAAGGTGGCCACTTACTGG - Intergenic
1175015920 20:55790483-55790505 TGATAAAGGCTGACACAGACAGG - Intergenic
1178452896 21:32720349-32720371 TGATAATGGCTACCACTTACTGG - Intronic
1179433086 21:41338499-41338521 TTCTAAACGCTGGTACTTACAGG - Exonic
1179605923 21:42514837-42514859 TGCTAAAGCCTGCCCTTTCCGGG + Intronic
1180688813 22:17693240-17693262 TGATAATAGCTACCACTTACTGG - Intronic
949633256 3:5952805-5952827 TGATAAAGGCTGCCAGTCAAGGG - Intergenic
951514910 3:23548126-23548148 TTCTAAAGACTGCCTCTTTCAGG + Intronic
953803353 3:46046426-46046448 TGCTGAAGGCAGTCACTTCCTGG - Intergenic
958878979 3:99647953-99647975 TGCTCAACTGTGCCACTTACGGG - Intronic
964482726 3:157159252-157159274 TTCTAAAGGTTTCCACTTCCTGG + Intronic
970550165 4:17172171-17172193 TGAAAAAGGCCACCACTTACGGG - Intergenic
971230495 4:24797186-24797208 AGCTAAGAGCTGCCATTTACTGG + Intronic
972088023 4:35243586-35243608 TGTTAATCGCTGACACTTACTGG + Intergenic
973784148 4:54319437-54319459 TGCCAAAGGATGCCTCTTAAGGG + Intergenic
974700024 4:65430673-65430695 TGCTAAGGTCTGCCAATTCCTGG - Intronic
975626386 4:76352706-76352728 TGCTAATGGCTGGCACTTTGTGG - Intronic
976844731 4:89474645-89474667 TGCTAAAGGCTCCTCCTTCCTGG + Intergenic
977483473 4:97610240-97610262 TTCTAAAGGATTCCACTTAGTGG - Intronic
978189782 4:105897587-105897609 TTCTCAAGGCTGCCACTCACAGG - Intronic
978331366 4:107616400-107616422 TGCTAATGTCTGTCATTTACAGG - Intronic
983338039 4:166421101-166421123 TGGTAAATGCTGCCAGTTATGGG + Intergenic
983537050 4:168868991-168869013 TGGTACAGGCTGCCACTGCCTGG + Intronic
983627507 4:169816452-169816474 TCCTTAAGGCTGCCCCTAACTGG - Intergenic
984797065 4:183671493-183671515 TGCTAAAGGCTGCAAATAAAAGG - Intronic
986759812 5:10869665-10869687 TGGTAAAGGCTCACACTTCCAGG + Intergenic
987192300 5:15490716-15490738 GGCTAAATGCTGACACTTATTGG + Intergenic
993504877 5:88696160-88696182 TGCTAAGAGCTTCCACTTAGCGG - Intergenic
993626091 5:90226601-90226623 GGCCAAAGGCTGCAACTAACAGG - Intergenic
997293835 5:132757313-132757335 AGGTAAAGGCTGCCTCTTCCTGG + Intronic
999108271 5:149093205-149093227 TGCTTATGGCTGCCACTGCCAGG + Intergenic
1006811371 6:36822441-36822463 TCCTAAAGGTTGCCCCTTCCAGG - Intronic
1009481643 6:64166365-64166387 TGCACAAGGCTTCCACTAACAGG + Intronic
1012052322 6:94361504-94361526 TGCTGAAGGCTGCTAGGTACTGG - Intergenic
1015643135 6:135358985-135359007 TGCTAAAGGCTGTCATATGCAGG + Intronic
1015838766 6:137453030-137453052 TGCGACAGGCTGACACTGACAGG - Intergenic
1020499426 7:8897717-8897739 TGCTACAGGCTGTCACTCACTGG - Intergenic
1021108078 7:16662102-16662124 TTATAAAGGCTGACCCTTACTGG + Intronic
1022049793 7:26655095-26655117 TGCTAAAAGCAGTGACTTACAGG + Intergenic
1023913581 7:44572087-44572109 TGCTCAAAGCTGCCCCTTAGGGG + Intronic
1026152108 7:67796657-67796679 AGCCAAAGGTTGCAACTTACAGG + Intergenic
1027138912 7:75643057-75643079 TGGTAGAGGCTGACACCTACTGG + Intronic
1031002976 7:116438744-116438766 TGAGAAAGGCTGCCTCTTATTGG - Intronic
1043228414 8:77765223-77765245 TGGTAATGCCTGACACTTACAGG - Intergenic
1049799163 8:144509836-144509858 TGCTCCTGGCTGCCACCTACTGG + Exonic
1051930479 9:22379399-22379421 TGCGAAAGCCTGTCACTTAGGGG + Intergenic
1056321964 9:85443622-85443644 TTCTAAAGGGAGCCACTTATGGG - Intergenic
1056753634 9:89368773-89368795 TGTTCATGCCTGCCACTTACTGG + Intronic
1060069344 9:120532809-120532831 TGCTAAAGGCGGCATCTTCCTGG - Intronic
1186747820 X:12587521-12587543 TGCAAAAGGCTACATCTTACAGG - Intronic
1200233825 X:154458834-154458856 TGCCCGAGGTTGCCACTTACAGG + Intronic