ID: 1151257166

View in Genome Browser
Species Human (GRCh38)
Location 17:72886830-72886852
Sequence ACCCGGATGCTCCTTCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151257162_1151257166 0 Left 1151257162 17:72886807-72886829 CCTTCTCACGAATGCTCCCTGTG 0: 1
1: 0
2: 0
3: 10
4: 116
Right 1151257166 17:72886830-72886852 ACCCGGATGCTCCTTCTGACTGG 0: 1
1: 0
2: 0
3: 8
4: 73
1151257161_1151257166 6 Left 1151257161 17:72886801-72886823 CCAGGGCCTTCTCACGAATGCTC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1151257166 17:72886830-72886852 ACCCGGATGCTCCTTCTGACTGG 0: 1
1: 0
2: 0
3: 8
4: 73
1151257160_1151257166 16 Left 1151257160 17:72886791-72886813 CCTACAAGCTCCAGGGCCTTCTC 0: 1
1: 0
2: 3
3: 27
4: 256
Right 1151257166 17:72886830-72886852 ACCCGGATGCTCCTTCTGACTGG 0: 1
1: 0
2: 0
3: 8
4: 73
1151257158_1151257166 23 Left 1151257158 17:72886784-72886806 CCAAGCACCTACAAGCTCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 206
Right 1151257166 17:72886830-72886852 ACCCGGATGCTCCTTCTGACTGG 0: 1
1: 0
2: 0
3: 8
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151257166 Original CRISPR ACCCGGATGCTCCTTCTGAC TGG Intronic
900086354 1:899640-899662 ACCAGGATGCTGATTCTGAAAGG + Intergenic
904434548 1:30485746-30485768 ACCCTGATGCTTCCTCTGCCTGG - Intergenic
906727614 1:48055361-48055383 TACCAGATGCTGCTTCTGACTGG - Intergenic
915913623 1:159928877-159928899 ACCCGGATCCTCCATCTAGCCGG - Exonic
917923204 1:179767713-179767735 ACCAGGATTCTCCTTCTGTGGGG - Intronic
921249968 1:213288271-213288293 ACCCAGATGCTCAGGCTGACTGG - Intergenic
922480428 1:225936896-225936918 ACCTGGATTCTGGTTCTGACAGG - Exonic
922723945 1:227914020-227914042 ACCCAGGCCCTCCTTCTGACAGG + Intergenic
924404602 1:243730060-243730082 ACCTGGCTGCTCCTTCTAGCTGG + Intronic
1062926399 10:1318728-1318750 TCCCCGATATTCCTTCTGACAGG - Intronic
1067492460 10:46724112-46724134 ACCCAAATGCTGCTTCTGTCGGG - Intergenic
1067602207 10:47616283-47616305 ACCCAAATGCTGCTTCTGTCGGG + Intergenic
1068250865 10:54438328-54438350 ACCCAAATGCTTCTTCTGTCGGG + Intronic
1071488020 10:86115760-86115782 ACCAGCAGGCTCCTTCTGCCAGG - Intronic
1075845924 10:125544946-125544968 ACCCGGCTGCTCCGTCTCACAGG + Intergenic
1077083006 11:733805-733827 GCCCTGAAGCTCCTTCTGATAGG + Intergenic
1083921610 11:65784109-65784131 CTCCCGATGCTCCTTCTGCCTGG - Intergenic
1085762342 11:79252807-79252829 ACCCGGATCCACCTGCTGATTGG + Intronic
1090596150 11:128323169-128323191 AACTGGATGATCCTTCTGCCTGG + Intergenic
1090659853 11:128874163-128874185 AATCAGATGCTCCTTCTGAATGG - Intergenic
1090841044 11:130487655-130487677 AGCCGCAGGCTCCTTCTGGCTGG + Intergenic
1091034150 11:132218105-132218127 CCCCGGATGCTGGTGCTGACAGG - Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1097694714 12:62764992-62765014 ACCTGCAAGGTCCTTCTGACTGG - Intronic
1109985091 13:69970515-69970537 ACCCAGATGCTCCTTTTTTCAGG + Intronic
1109985475 13:69978309-69978331 ACCCTGATGCTTCTTCTGCTTGG + Intronic
1128511068 15:68314167-68314189 ACCCAGATGCCCCGTCTGTCAGG + Intronic
1132153108 15:99476067-99476089 ACCCAGATGCTCCTGCTTATAGG - Intergenic
1132209146 15:100007666-100007688 CCCCGGGTGCTCCTTCTCAGTGG - Intronic
1134561338 16:15212659-15212681 ATCAGGATGATCCTTATGACGGG + Intergenic
1134921876 16:18124279-18124301 ATCAGGATGATCCTTATGACGGG + Intergenic
1139356617 16:66370780-66370802 CCCAGGCTGTTCCTTCTGACTGG - Intronic
1142333592 16:89472069-89472091 ATCCTGATGCTCTTTCTGCCCGG - Intronic
1146811433 17:35906984-35907006 ACCTGGCTGCTCCTGCTCACTGG + Intergenic
1146811485 17:35907350-35907372 AGCTGGCTGCTCCTGCTGACTGG + Intergenic
1147922345 17:43925705-43925727 AGCCGGCTGCTCCTGCTCACTGG + Intergenic
1148716134 17:49717550-49717572 ACCCCGATGTTCCTCATGACTGG + Exonic
1150923069 17:69504057-69504079 ACCTGGATTCTGATTCTGACTGG + Intronic
1151257166 17:72886830-72886852 ACCCGGATGCTCCTTCTGACTGG + Intronic
1156153766 18:34276478-34276500 TTCCGGATGCTCCTTCTCACTGG - Intergenic
1162031978 19:7921469-7921491 ACCCGGATGCACTTTCTGAATGG - Exonic
1168676870 19:58284962-58284984 TCCCTGCTGCTCCTTCAGACAGG + Intronic
925805987 2:7648696-7648718 ACATGGGTGCTCCTTCTGATCGG - Intergenic
927595909 2:24397133-24397155 AACCGGATGTTCCTACTTACAGG + Intergenic
930218541 2:48722168-48722190 CCCAGGATGCTGCTTCTGAATGG + Intronic
932266206 2:70369026-70369048 ACCCGGATCCTGTCTCTGACAGG + Intergenic
938794598 2:134707012-134707034 ACCCGGAGGCTGCTTCTGAGAGG - Intronic
1175453128 20:59088003-59088025 CCCCTGGTGGTCCTTCTGACCGG - Intergenic
1176071252 20:63227488-63227510 ACCCAGATGCTCCTTCCTATTGG - Intergenic
1180952844 22:19728495-19728517 GCCTGCATGTTCCTTCTGACTGG + Intergenic
1180997881 22:19974462-19974484 TCCTGGATGCTCCTGCTGCCAGG - Intronic
1183002743 22:34875193-34875215 ATCTGGATGCTCCTTCTGGATGG + Intergenic
1184308397 22:43624723-43624745 ACCCAGATGCTCCTTTTGAGGGG - Intronic
955085280 3:55696781-55696803 AGCTGGATGCCCCTTTTGACTGG - Intronic
955877748 3:63511187-63511209 ATCCTGATGCTCCTGCTCACGGG + Intronic
960616767 3:119602936-119602958 GCCCGGCTGTTCCTTCTGCCTGG - Intronic
981773981 4:148343477-148343499 CCCAGGATGCCCATTCTGACTGG + Intronic
986575503 5:9208617-9208639 CCCAGGCTGCTCCTTCTGGCAGG - Intronic
987115387 5:14722567-14722589 ATTCGGAAGCTCCTTCTGCCTGG - Intronic
987430581 5:17827980-17828002 GCCTGAGTGCTCCTTCTGACTGG - Intergenic
990952078 5:61308438-61308460 ACCCTGAAGCTCCTTCTGTGAGG + Intergenic
999727121 5:154446325-154446347 ACCCGGAGGAGCCTTCTGCCGGG - Exonic
1002182561 5:177438525-177438547 ACCCGGCTGTTTCTTCTGCCTGG - Intronic
1008639361 6:53445770-53445792 ACCCTGGTTCTCCTTCTGTCTGG - Intergenic
1012868175 6:104642750-104642772 ACCTGGATCCTCCTTCTCACAGG + Intergenic
1013044968 6:106476315-106476337 CTCGGGATGATCCTTCTGACTGG + Intergenic
1013470518 6:110460173-110460195 ATCCTGATGCTCCCTCTCACTGG + Intronic
1021689785 7:23220897-23220919 AGCAGGTTGCTCCTTCTCACAGG + Intergenic
1023663303 7:42493437-42493459 ATCCGGCTGCTCCTGCTGTCAGG - Intergenic
1024312672 7:47983756-47983778 ACCCACATGCTCCTGCTGACTGG + Intergenic
1026824055 7:73570398-73570420 ACCAGGAGACTCCTTCTGAAAGG + Exonic
1030641546 7:112011857-112011879 TCTAGGATGCTCCTTTTGACTGG - Intronic
1038735933 8:30169567-30169589 ACCCTGGCGCTCCTTCTGGCGGG - Intronic
1043536383 8:81209570-81209592 ATCATGATGCTCCTTCTGCCTGG + Intergenic
1052353228 9:27478289-27478311 ACGTGGCTTCTCCTTCTGACTGG - Intronic
1054703366 9:68436474-68436496 ACCCAGATACTCCTTCTCTCTGG - Intronic
1056402565 9:86242179-86242201 CCCCGGCTGGTCCTTCTGCCTGG - Intronic
1059450470 9:114368394-114368416 AGCTGGAGGCTCCTTCTGCCTGG - Intronic
1061681348 9:132243891-132243913 ACCCGGAAGTGCCTTCCGACAGG + Exonic
1062331475 9:136046728-136046750 ACGTGGCGGCTCCTTCTGACGGG + Intronic
1198443623 X:136689363-136689385 TCCCAGATGCTCCTGCTGCCTGG - Intronic
1201406661 Y:13657020-13657042 AGCCGGTTGCTGCTGCTGACTGG + Intergenic