ID: 1151260618

View in Genome Browser
Species Human (GRCh38)
Location 17:72913141-72913163
Sequence TAGATAGGAGGTAAGAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151260613_1151260618 10 Left 1151260613 17:72913108-72913130 CCATATTATATACTGGTGTAGAC 0: 1
1: 0
2: 1
3: 1
4: 73
Right 1151260618 17:72913141-72913163 TAGATAGGAGGTAAGAGGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 314
1151260611_1151260618 25 Left 1151260611 17:72913093-72913115 CCAGAATATAATATGCCATATTA 0: 1
1: 0
2: 3
3: 19
4: 325
Right 1151260618 17:72913141-72913163 TAGATAGGAGGTAAGAGGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151260618 Original CRISPR TAGATAGGAGGTAAGAGGGC AGG Intronic
901150009 1:7095062-7095084 AAGAAAGGAGGAAAGGGGGCTGG - Intronic
901622421 1:10599335-10599357 GAGATATGAGGTGAGGGGGCTGG - Exonic
903333898 1:22612453-22612475 CAGCTAGGAGGTAATTGGGCTGG + Intergenic
903746880 1:25593010-25593032 TAAAGAGGAGGAGAGAGGGCCGG + Intergenic
904282062 1:29427560-29427582 TAGACAGGAGGTCAGAGAGATGG - Intergenic
904317018 1:29672150-29672172 TAGATAGAAGGAAAAAGGGAAGG - Intergenic
904548846 1:31298197-31298219 TATATAGGAGGTAAAATGGGTGG + Intronic
905506859 1:38486627-38486649 TAGAAAGAAGGGAAGAAGGCAGG + Intergenic
907007156 1:50926479-50926501 TAGATAGGAGGAATGAGTTCTGG + Intronic
907112775 1:51941412-51941434 GAGATAGGAGGCAGGAAGGCTGG + Intronic
907113922 1:51951935-51951957 TAGATAGGATTACAGAGGGCAGG - Intronic
907243122 1:53091542-53091564 CAGATAGGGGGTCAGAGGGCAGG - Intronic
907564694 1:55423957-55423979 TAGATGAGAGGCAGGAGGGCAGG - Intergenic
908404270 1:63798523-63798545 TAGAGAGGAGGTAAGCAGGGTGG + Intronic
909665033 1:78122961-78122983 AAGAAAGGAGGTCAGAAGGCTGG + Intronic
911234580 1:95398135-95398157 TAGATGGCAGGAAAGAGTGCCGG + Intergenic
915518597 1:156428514-156428536 TAGATGGGTGTGAAGAGGGCTGG + Intronic
916383781 1:164244170-164244192 AAGATAGGGGGTAGGAGGGGGGG - Intergenic
916975994 1:170079222-170079244 AAGATAGGAGGCAAGAGGTGGGG - Intronic
917152607 1:171960841-171960863 TAGATTGTAGGTAAGAGAGCAGG + Intronic
918092214 1:181307373-181307395 TAGGAAGGAGGTAAGCTGGCTGG + Intergenic
918667126 1:187165252-187165274 TAGATAGGAGGAATGAGTTCTGG - Intergenic
919578985 1:199347948-199347970 TAGTGAGAAGGAAAGAGGGCAGG + Intergenic
919656625 1:200203002-200203024 AAGAAGGGAGGAAAGAGGGCTGG + Intergenic
919746648 1:201013177-201013199 CAGGTAGGAGACAAGAGGGCTGG + Intronic
920652951 1:207852362-207852384 TAGAAAGAAGGGAAGAGGGGAGG - Intergenic
922475705 1:225905709-225905731 TTGGCAGGAGGTAAGAGAGCAGG + Intronic
923927984 1:238657903-238657925 TGGATAGGAGGAAAGAGGAGGGG + Intergenic
924356507 1:243182417-243182439 TAGATCTTAGGTAAGAGGCCTGG - Intronic
924447315 1:244145382-244145404 TAGAGAGGAGGACAGAGGGAAGG - Intergenic
1063112098 10:3046480-3046502 TAGACAGCAGGTGAGAGGGCAGG - Intergenic
1063112116 10:3046556-3046578 TAGACAGCAGGTGAGAGAGCAGG - Intergenic
1063112132 10:3046632-3046654 TAGACAGCAGGTGAGAGAGCAGG - Intergenic
1063438442 10:6053173-6053195 TAGACAGGAGGAAAAAAGGCAGG + Intronic
1064134356 10:12737487-12737509 AAGCTCGGAGGAAAGAGGGCAGG - Intronic
1065980399 10:30889400-30889422 AAGAGAGGAGGGAAGAGGGGAGG - Intronic
1066428789 10:35333530-35333552 GAGATAGGAGGTAGGAGGTTGGG + Intronic
1066647573 10:37625196-37625218 TAGAGGTGAGGTAGGAGGGCAGG - Intergenic
1067519675 10:46988472-46988494 TAGATAGGAGGAATGAGCTCTGG - Intronic
1067642573 10:48063367-48063389 TAGATAGGAGGAATGAGCTCTGG + Intergenic
1068512140 10:57980022-57980044 GAGAGAGGAGTTAAGAGTGCTGG - Intergenic
1068529265 10:58166348-58166370 GGGACAGGAGGGAAGAGGGCTGG - Intergenic
1068631862 10:59306578-59306600 TAGAATGGAGGTGAGAGGCCGGG + Intronic
1070514588 10:77192508-77192530 TAGCTAGGAGGTGATAGGGCTGG - Intronic
1072224496 10:93355953-93355975 TGGACTGGAGGTAGGAGGGCTGG - Intronic
1073049981 10:100661102-100661124 TAGAGATGGGGTATGAGGGCTGG + Intergenic
1075210497 10:120486840-120486862 TAGATAAGAGGTAAAAGCCCAGG - Intronic
1075883212 10:125872807-125872829 CAGGTAGGCGGTAAGAGGCCAGG - Intronic
1076131553 10:128017309-128017331 GAAATTGGAGGTAAGAGGCCTGG + Intronic
1076296622 10:129390920-129390942 TAGAAATGTGGCAAGAGGGCCGG + Intergenic
1076512861 10:131024855-131024877 CAGATGGCAGGCAAGAGGGCAGG - Intergenic
1076716498 10:132366858-132366880 GAGAGAGGAGGCATGAGGGCAGG + Intronic
1077384628 11:2263148-2263170 CCGAAAGGAGGGAAGAGGGCTGG - Intergenic
1077507510 11:2937618-2937640 GAGACAGAAGGTAGGAGGGCAGG + Intergenic
1078215905 11:9311592-9311614 TTGATAGGTGGTGAGTGGGCAGG + Intronic
1078564418 11:12402193-12402215 TAGATAAGAAGTAAGGGGACAGG + Intronic
1078577853 11:12516875-12516897 TAGCTAGTAGGTGAGAGAGCTGG + Intronic
1078829807 11:14968643-14968665 CAGATGGGAGGAAAGAGAGCAGG - Exonic
1080629805 11:34063739-34063761 TAGAAAGGATCTAAGAGGGCAGG + Intronic
1081771260 11:45651774-45651796 GACACAGGAGGTAAGAGGGGAGG - Intronic
1082229974 11:49751829-49751851 TAGATAGGAGGAATGAGTTCTGG - Intergenic
1083190990 11:61052438-61052460 TACTTAGCAGGTACGAGGGCAGG + Intergenic
1083313962 11:61802751-61802773 TAGTAGGGAGGGAAGAGGGCAGG - Intronic
1083457743 11:62790276-62790298 TAGATAGGAGGAAGGAGTGAAGG + Exonic
1085670312 11:78458022-78458044 TAGATAGGAGGAATGAGTGCTGG + Intronic
1086407888 11:86514630-86514652 TAGCTAGGAAGTAATAGAGCTGG - Intronic
1086620086 11:88877120-88877142 TAGATAGGAGGAATGAGTTCTGG + Intronic
1087969684 11:104464359-104464381 TAGAAGGGAGGTGAGAGGGAAGG + Intergenic
1088300462 11:108352908-108352930 AAAATAGGGGGTCAGAGGGCTGG + Intronic
1089185977 11:116614982-116615004 TGCCGAGGAGGTAAGAGGGCAGG - Intergenic
1089378867 11:118013537-118013559 TGGACAGGAGGAAACAGGGCAGG + Intergenic
1089659671 11:119977771-119977793 TGGGAAGGAGGTAAGGGGGCAGG + Intergenic
1090645131 11:128761082-128761104 TAGAGAGGATGTCAGAGGGATGG - Intronic
1092907999 12:13119585-13119607 AACACAGGAGATAAGAGGGCAGG + Intronic
1092912598 12:13160626-13160648 TAGAAAGGAGATCAGTGGGCCGG - Intergenic
1095386753 12:41659791-41659813 TAGAGAGGAGGTAAGTTGGAAGG + Intergenic
1096021343 12:48328261-48328283 TAGATAAGAAGTCAGATGGCCGG + Intergenic
1096819406 12:54222036-54222058 CAAGTAGGAGGTGAGAGGGCTGG + Intergenic
1097048276 12:56204304-56204326 GAGATAGGAGGGAAGAATGCAGG + Exonic
1097201509 12:57282782-57282804 TAGAAAGGAGGTAACAGAGAAGG + Intronic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1097440254 12:59599181-59599203 TAGAAAGAAGGAAAGAGGGAGGG + Intronic
1098523580 12:71461164-71461186 GAGATATGAGGGAAGGGGGCAGG - Intronic
1099270431 12:80502178-80502200 TGGAAAGGAGGAAAGAGGGAAGG + Intronic
1099286069 12:80715731-80715753 TGGATAGAAGGCAAGAGGGGAGG - Intergenic
1099756032 12:86850088-86850110 TAGATAGGAGGAATGAGCTCTGG - Intergenic
1100175133 12:92021838-92021860 TAGTCAGGAGGTAGGGGGGCTGG - Intronic
1103209518 12:119156460-119156482 GAGAGAGGAGGGATGAGGGCCGG - Intronic
1103294301 12:119873091-119873113 TAAATAGGAGGCAACAGGCCAGG - Intronic
1103621764 12:122191308-122191330 CAGATAGAAAGCAAGAGGGCTGG - Intronic
1104133377 12:125915904-125915926 AAGAAAGGAGGTAAGAAAGCTGG + Intergenic
1107880344 13:44827041-44827063 TGGTTAGCAGGGAAGAGGGCTGG - Intergenic
1109044519 13:57392208-57392230 TAGATAGCAGGTAAGAGATTGGG - Intergenic
1111468149 13:88644299-88644321 TATAAAGGAGGGAAGAGGCCTGG - Intergenic
1111699918 13:91673833-91673855 AAGAAAGGAGGGAAGAGGGAAGG - Intronic
1112689650 13:101877544-101877566 TAGGTAGCAGTTAAGTGGGCAGG - Intronic
1113849309 13:113408976-113408998 CAGAGAGGAGGGAGGAGGGCTGG + Intergenic
1114304968 14:21414409-21414431 CAGATAGGAGCTAAGGGGGATGG + Exonic
1115260899 14:31452631-31452653 TAGATAGGAGGAATGAGTTCTGG + Intronic
1115523873 14:34259828-34259850 TAGAGAGGAGGAAGGAGGGAAGG - Intronic
1115925573 14:38429576-38429598 TAGATAAGAGGCAAGAGGCATGG + Intergenic
1116247760 14:42438100-42438122 TAGAAAGGAGATAAAAGGACAGG + Intergenic
1116581229 14:46644462-46644484 TAGATAGGTAGTAAGTAGGCAGG + Intergenic
1117198021 14:53360683-53360705 TAGTTAGAAGATAGGAGGGCTGG + Intergenic
1117460247 14:55938277-55938299 CAGACAGAAGGGAAGAGGGCTGG - Intergenic
1117818476 14:59622887-59622909 TAGTTAGGAGGTGTGAGGGAAGG - Intronic
1118235872 14:64004623-64004645 TAGAAAGGGGGGAAGAGGCCAGG - Intronic
1118464064 14:66014852-66014874 TAGAGAGGAGGGAGAAGGGCAGG + Intergenic
1119824645 14:77647367-77647389 AAGAAAGGAGACAAGAGGGCTGG + Intergenic
1120788312 14:88556661-88556683 TAGACAAGTGGAAAGAGGGCAGG - Intergenic
1123427978 15:20188230-20188252 TTAATAGGAGATAAGAGGGAGGG + Intergenic
1124101285 15:26696472-26696494 TATATGGGAGGTAAGATTGCAGG - Intronic
1125347377 15:38731987-38732009 TAGGTAGAAGGGAAGTGGGCTGG - Intergenic
1125423856 15:39530632-39530654 TAGAGAGGAGGAAAGAAGGAGGG + Intergenic
1125611850 15:40976717-40976739 TAGGAAGGAGGTAAGAGTCCAGG + Intergenic
1126338789 15:47616834-47616856 TTGGGAGAAGGTAAGAGGGCTGG - Intronic
1128398411 15:67253123-67253145 TAGATAGAAGGTGAAGGGGCCGG + Intronic
1128538408 15:68507888-68507910 AAGATAGAAGCTAAGAGGCCGGG + Intergenic
1130092770 15:80835188-80835210 AAGATAGGAAGAAGGAGGGCAGG - Intronic
1131797248 15:96031713-96031735 CAGAAAGTAGGAAAGAGGGCAGG - Intergenic
1133825047 16:9270797-9270819 TAGAGAGGAGGAATGAGGGAAGG + Intergenic
1134362914 16:13549262-13549284 TAGATAGGAGGAAAAAGTTCTGG + Intergenic
1135621251 16:23957850-23957872 GAGCTAGGAAGTCAGAGGGCTGG - Intronic
1136856331 16:33661531-33661553 TTAATAGGAGATAAGAGGGAGGG - Intergenic
1137375131 16:47945772-47945794 TAGATAGGAGGAATAAGTGCAGG + Intergenic
1138225739 16:55292764-55292786 GAGAGAGGAGGTAGGAGGCCAGG + Intergenic
1138538039 16:57670125-57670147 TGGACTGGAGGTCAGAGGGCAGG - Intronic
1138915968 16:61464957-61464979 TAGATAGATGGTTAGAGAGCTGG - Intergenic
1139693706 16:68657620-68657642 GAGCTAGGAGGTGGGAGGGCTGG + Intronic
1139795688 16:69481347-69481369 TAGGCAGGAGGGGAGAGGGCTGG + Intergenic
1140031207 16:71340691-71340713 CAGACAGGAGGTGGGAGGGCGGG - Intergenic
1140461691 16:75145385-75145407 TGGACAGGAGGCAGGAGGGCGGG + Intergenic
1203117915 16_KI270728v1_random:1510009-1510031 TTAATAGGAGATAAGAGGGAGGG - Intergenic
1142674519 17:1505492-1505514 AGGAAAGGAGGTAAGAGGCCAGG - Intronic
1144199688 17:12929050-12929072 TAGAGAGGAGCAAAGAGGGCAGG - Intronic
1146281834 17:31549848-31549870 GAGAGAGGAGGGAGGAGGGCCGG + Intergenic
1147161414 17:38571493-38571515 CAGTTAGGAGGGCAGAGGGCAGG + Intronic
1147853449 17:43460032-43460054 TAGAAAGGAGGCTAGTGGGCGGG - Intergenic
1148679550 17:49465889-49465911 TGGAAAGGGGGTAAAAGGGCTGG - Intronic
1150842359 17:68620661-68620683 TAGAAAGGATGTAAGAGGAATGG + Intergenic
1151260618 17:72913141-72913163 TAGATAGGAGGTAAGAGGGCAGG + Intronic
1151766165 17:76134471-76134493 TAAATAAGAGGTAAATGGGCTGG + Intergenic
1152358366 17:79817579-79817601 TAGTTAGGAGGCTAGATGGCTGG - Intergenic
1153981815 18:10316801-10316823 TAGATAAGAGATAACATGGCTGG - Intergenic
1154046921 18:10915009-10915031 TAGATAGGGTGGAAGAGGGAGGG - Intronic
1154174741 18:12078019-12078041 TAGATAGGGTGGAAGAGGGAGGG + Intergenic
1155483237 18:26312457-26312479 TAGATAGAAGGAAGGATGGCAGG + Intronic
1156061553 18:33083220-33083242 TAGCTAGGAAGCAAAAGGGCAGG + Intronic
1156999140 18:43503462-43503484 GACAGATGAGGTAAGAGGGCTGG + Intergenic
1158717336 18:59892346-59892368 GAGAAAGGAAGTAAGGGGGCAGG + Intergenic
1160058582 18:75509381-75509403 CAGATAGGAGATAGGAGGGCAGG + Intergenic
1160225890 18:77010128-77010150 GTGATGGGAGGTCAGAGGGCAGG + Intronic
1160295761 18:77635411-77635433 GAAAGAGGAGGTAGGAGGGCGGG + Intergenic
1160317585 18:77861869-77861891 AAGAGAGGAGGCAGGAGGGCTGG - Intergenic
1162768895 19:12937474-12937496 TAGAAAGGAGGAAGGAGAGCTGG - Intergenic
1163081876 19:14950150-14950172 CAGAGAGGAGGGAAGGGGGCTGG - Intronic
1163466138 19:17469694-17469716 TAGACAGGAGGGAAGAGGGGCGG + Intronic
1163696325 19:18765380-18765402 TAGAGAGGAAGTAGGAGGGAGGG - Intronic
1166580438 19:43893831-43893853 AAGAAAGTAGGTAAGTGGGCTGG - Intronic
1167212015 19:48139384-48139406 TAGAGAAGAGAGAAGAGGGCAGG - Intronic
1167429916 19:49448237-49448259 TGGACAGGAGATAAGAGGCCAGG - Intronic
927102289 2:19797306-19797328 TAGATAGGGGGTAAGGGTGGGGG + Intergenic
927238307 2:20898422-20898444 AAGATATGGGGTCAGAGGGCTGG - Intergenic
927856643 2:26531795-26531817 TAGATTGAAGGAAAGGGGGCTGG + Intronic
928276463 2:29905512-29905534 AAGAAAGAAGGTAAGAGGGAAGG + Intronic
929574808 2:43044613-43044635 GAGACAGGAGGAAAGAGGCCTGG + Intergenic
930382062 2:50642780-50642802 TATATAGGAGGAAATAGGGATGG + Intronic
930785623 2:55269149-55269171 TAGGTAGGAGTTAAGTGGGTAGG - Exonic
931463393 2:62467117-62467139 TAAATTGGGGGTAAGAGGGTGGG - Intergenic
932592687 2:73076514-73076536 GAGAAAGGAGGGAAGATGGCTGG - Intronic
932799075 2:74723492-74723514 TCTATAGGAGGTAAGTGGTCAGG - Intergenic
934694930 2:96392953-96392975 TGGACAGGAGGGGAGAGGGCTGG - Intergenic
936286684 2:111186690-111186712 TAGGTTGGAGGGAAAAGGGCTGG - Intergenic
937205704 2:120235878-120235900 TAGATAGCATGTGAGAGGGTGGG + Intergenic
937881919 2:126874629-126874651 TAAATAGGAGGTTCGAGAGCAGG + Intergenic
938132869 2:128732293-128732315 TGGAAAGGAGGTGAGAGGGATGG + Intergenic
940039380 2:149344177-149344199 TAGGTAAGAGGCAAGGGGGCTGG - Intronic
941344612 2:164352198-164352220 TAGATAGTAGGAGAGAGGCCTGG - Intergenic
942136703 2:172933319-172933341 TAAATACGAGGTAAGAGAGAAGG + Intronic
943230204 2:185241344-185241366 AGGTTAGGAGGTAAGTGGGCAGG + Intergenic
944058741 2:195549035-195549057 GAGACAGGAGGCAGGAGGGCAGG - Intergenic
944687638 2:202131878-202131900 TAGAAAGCAGCTAAGAGGCCTGG + Intronic
946413799 2:219529288-219529310 TACATAGCAGGGAGGAGGGCAGG + Intronic
946422600 2:219572947-219572969 GAGATAGGAGGAAAGGTGGCAGG - Intronic
948181217 2:235982424-235982446 TAGCTAGGAGGTCAGAAGGAAGG + Intronic
948514714 2:238496887-238496909 TACATAGGAGCTAAGTGAGCAGG + Intergenic
1170728214 20:18948564-18948586 GACATAGCAGGTGAGAGGGCAGG + Intergenic
1173434073 20:43016831-43016853 GAGATAGGCAGTGAGAGGGCTGG - Intronic
1173655341 20:44696625-44696647 TAGATGGGAGGAAGGAGGGAGGG - Intergenic
1174056173 20:47800106-47800128 AAGAAAGGAGGGAAGAGGGGTGG - Intergenic
1174964254 20:55193531-55193553 CAGAGAGGAGGTAAGAGTGAAGG - Intergenic
1175376503 20:58529283-58529305 TAGACAGGAGGAATGAGAGCTGG + Intergenic
1175491554 20:59383952-59383974 TAGGGAGGAGGTGAGTGGGCAGG + Intergenic
1175491639 20:59384256-59384278 GTGATAGGAGGTGAGTGGGCAGG + Intergenic
1175880211 20:62253671-62253693 AAGAGAGGAGGGAAGAGAGCGGG + Intronic
1176047265 20:63099398-63099420 TTGATAGGAGGTGAAGGGGCAGG - Intergenic
1177741602 21:25160889-25160911 TAGACAAGAGGTAAGAGACCTGG - Intergenic
1178028401 21:28495033-28495055 TAAATTGGAGTTAAGAGGCCAGG + Intergenic
1178771336 21:35507263-35507285 AATTTAGGAGGTCAGAGGGCAGG - Intronic
1182388083 22:29963680-29963702 TAGAAAGGAATTAAGTGGGCTGG - Intronic
1182438121 22:30344175-30344197 TAGCTAGGAGGTGGCAGGGCTGG - Intronic
1185360737 22:50405233-50405255 TAGACTGGAGGTGAGAGGCCTGG + Intronic
949762245 3:7483507-7483529 TGAATAGGAGGTAGGAGGACAGG + Intronic
950829433 3:15859656-15859678 AAGAAAGGAAGGAAGAGGGCGGG - Exonic
951519147 3:23594950-23594972 TAGATAGGAGGTTAGAGTTCAGG + Intergenic
952010240 3:28892470-28892492 TAGAAAGCAGGTCAGAGGCCAGG + Intergenic
953014069 3:39055606-39055628 GAGATACGAGGGAAGAGGGATGG + Intronic
953205275 3:40822289-40822311 TGGAGAGGAGATAAGAGGGTGGG + Intergenic
953630821 3:44615294-44615316 TAGATAGGAGGAAGGAGTTCTGG + Intronic
956026224 3:64985874-64985896 AAGATAGGAAGGAGGAGGGCTGG + Intergenic
959905308 3:111704789-111704811 TAGATAGGAGGAATGAAGTCTGG - Intronic
960402297 3:117216213-117216235 TAGATAGTAATTAAGAGGTCAGG + Intergenic
962039702 3:131693729-131693751 AAGAGGGGAGGTAAGAGGGGAGG - Intronic
962039706 3:131693741-131693763 AAGAGGGGAGGTAAGAGGGGAGG - Intronic
962271134 3:133978828-133978850 GAGGTGGGAGGTCAGAGGGCAGG - Intronic
962925628 3:139990424-139990446 TAAATATGAAGTAAGGGGGCGGG - Intronic
963583725 3:147158492-147158514 TAGAAAGAAGGGAAGAAGGCAGG + Intergenic
963977924 3:151503834-151503856 TAGATAGGAGATAAAATTGCAGG + Intergenic
964428283 3:156576326-156576348 TAGATGGGAAGGAAGAGGGAGGG + Intergenic
964843952 3:161026093-161026115 CAGAAAGGAGGTAAGAGGTGAGG + Intronic
970871729 4:20823977-20823999 TAGCTAGGAGGTAGCAGTGCTGG - Intronic
971953049 4:33379383-33379405 AGGAAAGGAGGTAAGAGGGAAGG - Intergenic
972923989 4:43981039-43981061 TATATAGGAGTCAAGAGGGGAGG - Intergenic
973012824 4:45097551-45097573 TAGTTAGGAGGTAAGATGAATGG + Intergenic
973669189 4:53197527-53197549 TAGGTAGGTGGTAAGAAAGCAGG - Intronic
975757095 4:77581667-77581689 CAGATAGGAGGAAAGAGAGAAGG - Intronic
976831552 4:89320597-89320619 TGGACAGGAGGTAACATGGCTGG - Intergenic
977064680 4:92299793-92299815 TAGAAGGGAGGGAAGAGGGAAGG + Intronic
977603086 4:98955216-98955238 TAGCTTGGAGATAAGAGGGTGGG - Intergenic
977810213 4:101348082-101348104 GGGATAGGAGGGAAGAGGGTGGG + Intronic
979245310 4:118497188-118497210 TAGATCTTAGGTAAGAGGCCTGG + Intergenic
979565672 4:122152221-122152243 CAGAGAGGAGGAAACAGGGCGGG + Intergenic
979809434 4:125017192-125017214 TGGATAGGAGGTAAATGGGCAGG - Intergenic
984817034 4:183848619-183848641 TAGATAGAAGCTAAGAGGGATGG + Intergenic
984914681 4:184711500-184711522 TAGATAGGAGGTATAAGTTCAGG - Intronic
984966532 4:185144702-185144724 TAGAGAGAAGGGAAGAGGACAGG - Intronic
986764799 5:10915675-10915697 CAGCTAGGAGGTAATGGGGCTGG + Intergenic
988122906 5:26991089-26991111 TAGAAAATAGGTTAGAGGGCAGG + Intronic
989203075 5:38785247-38785269 TAAATAAGAGGGCAGAGGGCTGG + Intergenic
990691465 5:58369015-58369037 TATATAGGAGGTATGAGTTCGGG - Intergenic
991045511 5:62218548-62218570 TTAATAGGAGATAAGAGGGAGGG + Intergenic
992020477 5:72619012-72619034 TAGATACAAGGAAAGAGGGCAGG + Intergenic
992133050 5:73714232-73714254 CTGATAGGAAGTATGAGGGCAGG + Intronic
994474029 5:100244530-100244552 TAGATAGGAGGGATGAGTTCTGG + Intergenic
994479691 5:100318079-100318101 TAGATAGGAGGCAAAAGTTCTGG + Intergenic
995054965 5:107748797-107748819 TAGACAGTAGGTAATAAGGCTGG - Intergenic
995212962 5:109561511-109561533 TAGATAGGAGGAAAAAGTTCTGG - Intergenic
995453005 5:112323203-112323225 TGGAAAGGAGGGAAGAGGGAAGG + Intronic
996240525 5:121194903-121194925 TAGATAAGAGGAAAGAAGGAAGG + Intergenic
997512419 5:134462857-134462879 GAGAGTGGAGGTGAGAGGGCAGG + Intergenic
998159867 5:139807279-139807301 TAGAAAGCAGGTCAGAGGACTGG + Intronic
998993914 5:147849821-147849843 TAGGAAGGAGGTAAGACAGCAGG - Intergenic
1000372268 5:160548361-160548383 TATAAAGGTGTTAAGAGGGCTGG + Intergenic
1000420880 5:161036639-161036661 TAGATATGAGGAAAGAGGGCGGG - Intergenic
1002588640 5:180270951-180270973 TAGATAGGAGGAATAAGGTCAGG + Intronic
1002819386 6:710865-710887 TAGAGAGCAGGGACGAGGGCTGG + Intergenic
1003272282 6:4617936-4617958 TAGACAGGAGCTATGAGGTCTGG + Intergenic
1004068991 6:12279388-12279410 TAGATAGCTGGTGTGAGGGCTGG + Intergenic
1005059750 6:21764608-21764630 TAGAAATGACGTAAGAGGCCAGG + Intergenic
1005132053 6:22520540-22520562 TAGAAAGAAGGAAAGAGGGAAGG + Intergenic
1005315137 6:24596855-24596877 AAGATAGGAGGAAAGACGGGTGG - Intronic
1006470929 6:34228096-34228118 TAGAAAGCAGGAAAGAGGCCAGG + Intergenic
1006767449 6:36520634-36520656 TAGATAGTATGTAAGTAGGCCGG + Intronic
1007399862 6:41597556-41597578 AAGCTAGGAGGTAGGAGGTCGGG + Intronic
1007874832 6:45084953-45084975 ACTATAGGAGGTAAGAGGGAGGG + Intronic
1012197279 6:96359129-96359151 TAGATTGGAAGTAAGAGTGTGGG + Intergenic
1012622656 6:101365246-101365268 TAGGTAGAAGGGAAAAGGGCTGG + Intergenic
1012818542 6:104055499-104055521 AAGACAGAAGGTAAGAGAGCTGG + Intergenic
1014902121 6:126979534-126979556 TAGAAAGAAGGTCAGAAGGCCGG - Intergenic
1016785439 6:148006119-148006141 TAGAAAGAAGGAAAGAAGGCCGG + Intergenic
1017606724 6:156142645-156142667 GAGATAGAAAGAAAGAGGGCAGG - Intergenic
1018075119 6:160205864-160205886 TAGAAAAGATGTAAGGGGGCTGG - Intronic
1019002119 6:168763150-168763172 GAGAATGGAGGCAAGAGGGCAGG + Intergenic
1019546097 7:1577242-1577264 GAGATAGGAGGTAGCAGGACGGG - Intergenic
1021228772 7:18060237-18060259 AAGAAAGGAGGAAAGAGGGAAGG - Intergenic
1026209130 7:68287702-68287724 AAGAAAGGATGTCAGAGGGCTGG - Intergenic
1027255113 7:76426106-76426128 TAGATAAGTGGTATGGGGGCGGG + Intronic
1027430097 7:78103044-78103066 TAGATATGAGGAAAGAGAGGAGG - Intronic
1027706086 7:81535552-81535574 TGCACAGGAGGCAAGAGGGCGGG + Intergenic
1029535855 7:101157155-101157177 AACTTAGGAGGTCAGAGGGCAGG + Intronic
1029618792 7:101677082-101677104 TAGATATGAGGTAGGAGGTGGGG + Intergenic
1030412849 7:109203514-109203536 GAGGAAGGAGGTAAGAAGGCAGG + Intergenic
1031491592 7:122396353-122396375 AAGACAGGAGATGAGAGGGCTGG - Intronic
1032845830 7:135750844-135750866 GAGCTAGAAGGTGAGAGGGCAGG + Intergenic
1032868216 7:135951042-135951064 CAAAGAGGAGGTAAAAGGGCCGG + Intronic
1032872602 7:136002312-136002334 TACATTGGATGCAAGAGGGCAGG + Intergenic
1033539715 7:142345365-142345387 TAGAAAGGATGTAAAACGGCCGG + Intergenic
1037582105 8:20251781-20251803 TAGACAGGAGAGAGGAGGGCTGG + Intronic
1037961474 8:23101692-23101714 TAGGCAGGAGGTGAGAGGACAGG - Intronic
1038791466 8:30671922-30671944 GAGAGAGGAGGTGAGAGTGCAGG + Intergenic
1038961555 8:32525725-32525747 AAGCTAGGAGGAAAGGGGGCGGG - Intronic
1039301908 8:36218445-36218467 TGGAAAGGAGGTAACAGAGCAGG - Intergenic
1039782499 8:40799028-40799050 TAGATAGAAGGATAGATGGCTGG + Intronic
1039858552 8:41437055-41437077 CAGACAGGAGGTAACTGGGCAGG - Intergenic
1040757150 8:50790498-50790520 TTGATAGGTGGTAAGAATGCAGG + Intronic
1040854299 8:51932797-51932819 TAGGGAGGAGGTAAGAGGAAAGG - Intergenic
1041952340 8:63517627-63517649 CAGGTAGGAGGTGAGAGGGCAGG + Intergenic
1042274534 8:66989927-66989949 TAGTTAAGAGGTAGCAGGGCAGG - Intronic
1044253401 8:90031071-90031093 TACATAGTAGTTAAGAGTGCAGG + Intronic
1045032201 8:98147766-98147788 AAGATAGGAGGTAAGAAAGGAGG + Intronic
1045505881 8:102778165-102778187 TAGAGTGGAGTTAAGAGGCCAGG - Intergenic
1046192990 8:110822766-110822788 TATATACAAGGCAAGAGGGCAGG - Intergenic
1046396782 8:113650829-113650851 CAGACAGGAGGTAGGAGGGCGGG + Intergenic
1047925617 8:129679694-129679716 TAGCTAGGAAGTGACAGGGCTGG - Intergenic
1049215489 8:141405971-141405993 GTGGTAGGAGGTCAGAGGGCAGG + Intronic
1050244496 9:3673613-3673635 TAGGTAGTAGGTAAGAGTGCAGG + Intergenic
1050867313 9:10518998-10519020 AAAATAGGAGATAAGAGTGCAGG - Intronic
1051080560 9:13288881-13288903 TAGAAAGGAGGGAAGTTGGCAGG - Intergenic
1051901263 9:22044068-22044090 TAAATATGAGGCAAAAGGGCAGG + Intergenic
1052206169 9:25843421-25843443 TAGATAGGAGGTATAAGTTCCGG + Intergenic
1053080582 9:35173079-35173101 TTGAGAAGAGGTTAGAGGGCAGG + Intronic
1055976248 9:81957747-81957769 AAGAGAGGAGGTAGGAGGGAGGG - Intergenic
1056255651 9:84796369-84796391 TAGCTAGAAGGTAAGGGGGAAGG - Intronic
1057964641 9:99491298-99491320 TAGCTAGGAGGTAAAAGGAGAGG - Intergenic
1059687492 9:116651468-116651490 AGGGTAGGAGGTAGGAGGGCTGG + Intronic
1060465523 9:123901377-123901399 TTAATAGGAGGGTAGAGGGCAGG - Intronic
1060686807 9:125622184-125622206 TAGATAGGAGGAATGAGCTCTGG + Intronic
1060833738 9:126739230-126739252 GAGAGAGGAAGCAAGAGGGCAGG - Intergenic
1061209728 9:129183905-129183927 GAGAAAGGAGAAAAGAGGGCAGG - Intergenic
1186315484 X:8365225-8365247 TAGAGTGCAGGTGAGAGGGCAGG - Intergenic
1188204255 X:27333196-27333218 TAGATAGGAGGTACATGTGCAGG - Intergenic
1188370003 X:29358184-29358206 GGGATAGGAGACAAGAGGGCAGG + Intronic
1188437506 X:30179341-30179363 AAGACAGGAGGCAGGAGGGCAGG + Intergenic
1190091317 X:47439791-47439813 TAGATAGGAGGGAAGGTGGATGG + Intergenic
1194270701 X:91811084-91811106 TAGATAGGAGGTTCCATGGCAGG - Intronic
1197841638 X:130753953-130753975 TAGATAGGAGGAATGAGTTCTGG + Intronic
1197857903 X:130936896-130936918 TAGATAGGAGGAATGAGTTCTGG + Intergenic
1198499842 X:137232658-137232680 AAGAGAGGAGGTAAAAGGGGAGG - Intergenic
1199595729 X:149504695-149504717 TGGATAGAAGGTAAAAGGGACGG + Intronic
1199810363 X:151343074-151343096 TGGAAACGAGGTAAGAGCGCTGG + Intergenic
1200587933 Y:5032517-5032539 TAGATAGGAGGTTCCATGGCAGG - Intronic
1201343704 Y:12960032-12960054 TAGTTAGGAGGTCTGAGGTCTGG - Intergenic