ID: 1151262859

View in Genome Browser
Species Human (GRCh38)
Location 17:72930341-72930363
Sequence GAGCCTGTCTTTGCTAGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2130
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 2120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151262859_1151262861 0 Left 1151262859 17:72930341-72930363 CCATAACTAGCAAAGACAGGCTC 0: 1
1: 0
2: 1
3: 8
4: 2120
Right 1151262861 17:72930364-72930386 TGAAGTCTTGGTCAGATCATAGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151262859 Original CRISPR GAGCCTGTCTTTGCTAGTTA TGG (reversed) Intronic
Too many off-targets to display for this crispr