ID: 1151262861

View in Genome Browser
Species Human (GRCh38)
Location 17:72930364-72930386
Sequence TGAAGTCTTGGTCAGATCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151262859_1151262861 0 Left 1151262859 17:72930341-72930363 CCATAACTAGCAAAGACAGGCTC 0: 1
1: 0
2: 1
3: 8
4: 2120
Right 1151262861 17:72930364-72930386 TGAAGTCTTGGTCAGATCATAGG 0: 1
1: 0
2: 0
3: 10
4: 94
1151262858_1151262861 1 Left 1151262858 17:72930340-72930362 CCCATAACTAGCAAAGACAGGCT 0: 1
1: 1
2: 2
3: 29
4: 312
Right 1151262861 17:72930364-72930386 TGAAGTCTTGGTCAGATCATAGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151262861 Original CRISPR TGAAGTCTTGGTCAGATCAT AGG Intronic
901956775 1:12791873-12791895 TGCAGTTTTGCTCAGATCATGGG + Intronic
901980160 1:13028020-13028042 TGCAGTTTTGCTCAGATCATGGG + Intronic
902001926 1:13200911-13200933 TGCAGTTTTGCTCAGATCATGGG - Intergenic
902021148 1:13346636-13346658 TGCAGTTTTGCTCAGATCATGGG - Intronic
907423013 1:54359896-54359918 TGAAGAAATGTTCAGATCATGGG + Intronic
910025609 1:82647457-82647479 TGAAATCTTGGTGAGAACAGTGG + Intergenic
915728570 1:158036676-158036698 TGCAGTCTCGGTCAGCTCACTGG + Intronic
917450306 1:175142502-175142524 TGTAGCCTGCGTCAGATCATCGG + Intronic
921899170 1:220432210-220432232 TGAGGTCTTGGTCAAATTCTTGG - Intergenic
923345901 1:233052513-233052535 TGGAGTCTGGGTCAGCTCAATGG - Intronic
1069254353 10:66313347-66313369 TGAAGAGTTGGTAAGTTCATTGG - Intronic
1072593566 10:96849823-96849845 AGAGGTCTTGGTCCCATCATGGG - Intronic
1076260457 10:129060872-129060894 AGAACTCTTGCTCAGATCAAGGG - Intergenic
1080044342 11:27793149-27793171 AGAAGACTTGGTCAAAGCATTGG + Intergenic
1080129560 11:28778422-28778444 TGAAGTTTTGGTGACATAATCGG + Intergenic
1081297523 11:41410229-41410251 AGAATTCTTGTTCAGATCACAGG + Intronic
1087915058 11:103800441-103800463 TGAAGTCCTGGTCAGCTCTCTGG - Intergenic
1095072309 12:37868191-37868213 TGAGCTCTTTGTCAGATGATAGG - Intergenic
1097943693 12:65342477-65342499 TTAAGTATTGGTCAGAGTATAGG + Intronic
1100723728 12:97386501-97386523 TGGTGTCTTGGACAGAGCATTGG + Intergenic
1101569681 12:105941640-105941662 TGAAGCTTTGGTGAGATCAAGGG - Intergenic
1102821914 12:115915779-115915801 TGATGTCCTGGTCCGATCACAGG + Intergenic
1103028186 12:117591207-117591229 TGAAATCTGGGTCAACTCATGGG + Intronic
1107472646 13:40704709-40704731 TGAGTTCTTGCTCAGTTCATGGG + Intergenic
1107906677 13:45067661-45067683 TGCATTCTTCGCCAGATCATAGG + Intergenic
1108092042 13:46859203-46859225 TGAAGGCTTGGGCAAATTATAGG - Intronic
1108716356 13:53081955-53081977 TCAAGTCCTGGTCAGATGTTAGG + Intergenic
1111640530 13:90963928-90963950 TGAATTCTTGGAGACATCATAGG - Intergenic
1112545585 13:100366241-100366263 TGAAGTCTTAGTGAGATGATAGG + Intronic
1112775702 13:102842116-102842138 TGATTTCTTGGTCAGCTCTTAGG + Intronic
1117740396 14:58812881-58812903 TGAAGTGTTGGTCACATTAAAGG + Intergenic
1119215544 14:72866512-72866534 TGGAGTCTTGGGCAAATCTTGGG + Intronic
1124085464 15:26545989-26546011 TCAAGTAGTGGTCAGCTCATGGG + Exonic
1130888334 15:88112242-88112264 TGAAGGCTTGGGCTGCTCATTGG - Intronic
1135655989 16:24250017-24250039 GGTAGTCTTGGCCTGATCATCGG + Intergenic
1139854749 16:69971398-69971420 TGAGGCCCTGGTCAGAACATGGG + Intergenic
1139883737 16:70194304-70194326 TGAGGCCCTGGTCAGAACATGGG + Intergenic
1140368776 16:74401209-74401231 TGAGGCCCTGGTCAGAACATGGG - Intergenic
1142753488 17:2002023-2002045 GGAAGACTTGGTCTGATCAGAGG + Intronic
1142866889 17:2796621-2796643 TGAAGTCTTGTTAAGTGCATTGG + Intronic
1143261891 17:5605688-5605710 TGCATTTTTGGTCAGCTCATAGG + Intronic
1145110661 17:20158517-20158539 TGAAGTCTTGGCCACTTGATGGG + Intronic
1148470843 17:47892266-47892288 TGAAGTCTGGGTCCCATCCTAGG - Intergenic
1151262861 17:72930364-72930386 TGAAGTCTTGGTCAGATCATAGG + Intronic
1156496514 18:37529347-37529369 TGCAGTCTGGGTCAGAGCACTGG - Intronic
1157488413 18:48106007-48106029 TGTAGTCTGGTTCAGGTCATAGG - Intronic
1163604240 19:18265428-18265450 TGGGGTCTTGGTCAGCTCAGTGG + Exonic
1168153073 19:54459422-54459444 TGAGGTCATGGTCACAGCATGGG + Intronic
925353949 2:3224073-3224095 TAAAGTCATGGCCAGATCTTAGG - Intronic
925676880 2:6372029-6372051 TGAAGTCTTGGACTACTCATTGG + Intergenic
927136570 2:20100981-20101003 TTAACTCTAAGTCAGATCATGGG + Intergenic
931259721 2:60606773-60606795 TGAATTCAGGGTCAGATTATCGG + Intergenic
931480145 2:62631389-62631411 AGAAGTCTTGGTAAGCTCGTGGG - Intergenic
935809201 2:106780116-106780138 TGCAGTCTTCTTCAGGTCATGGG + Intergenic
937144844 2:119635778-119635800 TGAAGTCTTGGGCTGATCTCTGG + Intronic
938268156 2:129944300-129944322 GGAAATTTTGGTCAGATTATGGG + Intergenic
940600250 2:155849416-155849438 TGGAGTCTTTGTGAGATGATTGG - Intergenic
941594888 2:167463945-167463967 TTAGCTCTTGCTCAGATCATTGG - Intergenic
941702831 2:168623155-168623177 TGAAGTCTTGGTTAACTGATTGG - Intronic
1182960497 22:34467777-34467799 TGAAGTCATGGCGAGAACATGGG - Intergenic
953071543 3:39525660-39525682 TGAAGTCTTGTTCAGGGTATGGG + Intronic
956473266 3:69592135-69592157 TAAAGTATTGGTCACATCTTGGG - Intergenic
960714729 3:120563678-120563700 TGTAGCCTTGGTCAGTGCATTGG + Intergenic
960781733 3:121327066-121327088 ATAAGTCTCAGTCAGATCATTGG - Intronic
966055529 3:175683944-175683966 TGCAGTCTGGGTAATATCATAGG + Intronic
973153975 4:46925054-46925076 GGAAGTATTGGCCAGCTCATGGG + Exonic
976116841 4:81736774-81736796 TGGAGTCTTGGACAGGTCTTGGG - Intronic
984576587 4:181455566-181455588 TGAAGTTTTGCTCACATGATTGG - Intergenic
984685758 4:182666529-182666551 TGATGACTTGATCAGATGATCGG + Intronic
987815649 5:22898167-22898189 TGACCTCTTGGTCAAAACATGGG - Intergenic
988563866 5:32304898-32304920 AGAAGCTTTGGACAGATCATCGG + Intronic
988960501 5:36366155-36366177 TGAAGTCATTGTCAGGTCATTGG - Intergenic
989999744 5:50879240-50879262 TGAACTCATGTTCAGTTCATTGG + Intergenic
994620072 5:102152216-102152238 TGACATCTAGGTCAGTTCATGGG - Intergenic
996844345 5:127882910-127882932 AGAACTCTTGGTCAAATAATTGG - Intergenic
999176386 5:149634734-149634756 GGAAGTCTTGTTCAGTTCATAGG - Exonic
999714507 5:154349332-154349354 TGGAATCTTTGTCAGATTATGGG - Intronic
1000947760 5:167442517-167442539 TCAAGTGTTGGTAAGATCATGGG - Intronic
1005005566 6:21283896-21283918 TGCAATCTTGGTGAGATCACAGG - Intergenic
1007851060 6:44803171-44803193 TGATGTCTTGGTCATGTCTTAGG + Intergenic
1008160709 6:48071849-48071871 AGAAGTATTGGTCAGATATTTGG + Intergenic
1010623183 6:78102178-78102200 TGAAGTCTTGCTCTTGTCATTGG - Intergenic
1016058756 6:139606124-139606146 TAAAGTCTTGGTCAAATACTTGG + Intergenic
1017452953 6:154571472-154571494 TGAAATCTTGTTCAAATCAAAGG - Intergenic
1023709591 7:42977521-42977543 TGCAGAGTTGCTCAGATCATTGG + Intergenic
1023719315 7:43076896-43076918 AGAAGTCTTCTTCAGATCAAAGG - Intergenic
1024811198 7:53214291-53214313 TGAACACATGGGCAGATCATAGG + Intergenic
1024949332 7:54842415-54842437 TGAAGTTTTAGCCAGCTCATAGG + Intergenic
1027799271 7:82731975-82731997 TGAACTTTTGGTGACATCATTGG + Intergenic
1033828314 7:145219646-145219668 TGAGTTCTTGCTCAGTTCATGGG + Intergenic
1034754353 7:153601049-153601071 GGAAATATTTGTCAGATCATTGG + Intergenic
1034905094 7:154937176-154937198 GCAAGTCTTGCTCAGAGCATGGG + Intronic
1040032401 8:42837531-42837553 AGAAGTATGGGTCAGATCATGGG - Exonic
1042565037 8:70102427-70102449 AGAAGTCTTGGTAAGCTCGTGGG - Intergenic
1043374051 8:79627654-79627676 TGAAGCATTTGTCACATCATAGG + Intronic
1045923655 8:107562926-107562948 TGATCTCTTGTTCAGATCACAGG - Intergenic
1051091817 9:13418677-13418699 TAAAGTCTTGATCAGTTCAGGGG - Intergenic
1054952418 9:70867370-70867392 GGAAGTTTTAGTCAGATGATGGG + Intronic
1054982352 9:71221700-71221722 TCAAGTCTTGGCCAGGTCACGGG + Intronic
1057085928 9:92209970-92209992 TGAAGTCTTGGTCAGGCCAATGG - Intergenic
1062305217 9:135902281-135902303 TGATGACTTGTTCAGATTATTGG - Intronic
1190412196 X:50147873-50147895 TGAAGTCTTGATTAGAACAGTGG + Intergenic
1192561281 X:72129732-72129754 TGAAGTCCTGGTCAGCAAATGGG + Exonic
1195918655 X:109960373-109960395 AGAAGGCTTGGTCACATCACTGG + Intergenic
1201891527 Y:18948228-18948250 TGAAGTCTGGGCCAGAACAGTGG + Intergenic