ID: 1151264714

View in Genome Browser
Species Human (GRCh38)
Location 17:72945848-72945870
Sequence AACATTGGCAAGCCCTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151264714_1151264717 -3 Left 1151264714 17:72945848-72945870 CCATCCAAGGGCTTGCCAATGTT 0: 1
1: 1
2: 3
3: 16
4: 155
Right 1151264717 17:72945868-72945890 GTTTACCTTTTTTGACTGACAGG 0: 1
1: 0
2: 1
3: 16
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151264714 Original CRISPR AACATTGGCAAGCCCTTGGA TGG (reversed) Intronic
901900655 1:12358952-12358974 AAAATTTGCAAGCCCTAAGAGGG + Intronic
903849055 1:26295445-26295467 AAAAATGGGAAGCCATTGGAAGG - Intronic
906485436 1:46231037-46231059 CACTTTGGCAAGACATTGGAAGG + Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
909376020 1:74943272-74943294 AACAATGGAAAGCCTTTGAAGGG - Intergenic
909877473 1:80826836-80826858 AACATTAGCAGACTCTTGGAGGG - Intergenic
909939826 1:81598257-81598279 AATATTGGCAAGACCATGAAGGG + Intronic
915083312 1:153366858-153366880 CACATTGGAGAGCCTTTGGAGGG + Intergenic
916853279 1:168725560-168725582 AACCTAGGCATGCCCTGGGATGG + Intronic
920669025 1:207988872-207988894 AGCAATGGCAAGCCCTTGCAGGG - Intergenic
922887773 1:229033101-229033123 AACCTTGGCAAGCCCTACCAAGG + Intergenic
1063906440 10:10784580-10784602 AACATTGACAAGACTTTGGTTGG - Intergenic
1066031863 10:31435761-31435783 AACAATGGAAAGCCATTGAAAGG + Intronic
1067896786 10:50190540-50190562 GACATTGGGAAGGCCTTAGATGG + Intronic
1067952185 10:50751493-50751515 GACATTGGGAAGGCCTTAGATGG - Intronic
1068544635 10:58331964-58331986 AACATTGATAAGCTTTTGGAGGG - Intergenic
1069128263 10:64665718-64665740 AAAATTGACAAGCCTTTAGATGG - Intergenic
1069679471 10:70273769-70273791 AACACTGGGAATCCATTGGAAGG - Intronic
1070127185 10:73631949-73631971 GATATTGGCATCCCCTTGGATGG - Exonic
1070364385 10:75722176-75722198 CATATTGGCAGGCCCTAGGATGG - Intronic
1070404513 10:76083122-76083144 AGAATTGGCTAGCCCTGGGAAGG - Intronic
1070514250 10:77189038-77189060 AACTTTGGCATGCAGTTGGAGGG + Intronic
1070585128 10:77759129-77759151 AAAATTGACAAGCCTTTAGATGG + Intergenic
1073972476 10:109060674-109060696 AACCTTGGGAAGACCTTGGCTGG + Intergenic
1074412827 10:113242932-113242954 AGCAATGGGAAGCCATTGGAAGG + Intergenic
1075638920 10:124050447-124050469 AGCATGGGCCAGCCCTAGGACGG - Intronic
1078179115 11:8995725-8995747 AACAATGGGAAGCCATTGAAGGG - Intronic
1078385875 11:10892136-10892158 AACTTTGGAATGCCCTTGGTTGG + Intergenic
1085312267 11:75523878-75523900 CACCTTGGAAAGCCCCTGGAAGG - Intronic
1087389563 11:97516069-97516091 AACACTGGCAAGCCCTTATATGG - Intergenic
1089794674 11:120970631-120970653 CCCATTGGCAAGCTCTGGGAAGG + Intronic
1093980095 12:25466813-25466835 AAAATTGGGAAGGCCTTGAATGG + Intronic
1095263155 12:40121781-40121803 AACATTAACAAGACTTTGGATGG - Intergenic
1101180720 12:102214224-102214246 ATCATTGGCAAGACCTTGGCTGG - Intergenic
1102722913 12:115033420-115033442 AACGTTGGATAGCCCTTGAAAGG - Intergenic
1103020190 12:117527648-117527670 AACAGTGTTAGGCCCTTGGAGGG + Intronic
1105928148 13:25026737-25026759 AACATTGGCCTTCCCTTGGAGGG + Intergenic
1105942746 13:25164348-25164370 AACATTGGCCTTCCCTTGGAGGG - Intronic
1106605835 13:31228025-31228047 GCCATTGGCAAGCCCTCTGATGG + Intronic
1107537170 13:41346775-41346797 AGAATTGGCTAGACCTTGGAGGG + Intronic
1108841632 13:54624665-54624687 AAAATTGGAAAGCCATTGTATGG - Intergenic
1109523567 13:63545028-63545050 AACAATGGCAAGCCTTTAGCTGG + Intergenic
1110789182 13:79568603-79568625 AACATAAGCAAGCTATTGGAAGG + Intergenic
1110790805 13:79584694-79584716 AACATTGACAAGCACTGTGAAGG + Intergenic
1119948095 14:78715896-78715918 AAGCTTGGGAGGCCCTTGGAAGG + Intronic
1120640615 14:87007271-87007293 AAAATTGACAAGCCTTTGCATGG - Intergenic
1121621529 14:95352937-95352959 AACATTGCCAAGCCGTTAAAGGG - Intergenic
1122205075 14:100144373-100144395 AACATTCCCAAGCCCCGGGAAGG + Exonic
1128744079 15:70101467-70101489 ATAATTGTCAAGCCTTTGGACGG - Intergenic
1129776355 15:78239211-78239233 AACAATGGCAAGCCTTTAGCCGG + Intronic
1129909872 15:79218017-79218039 AATGTTGGAAAGCACTTGGATGG - Intergenic
1131738081 15:95356136-95356158 AGAATTGGCTAGCCCCTGGAGGG - Intergenic
1133434177 16:5765116-5765138 ATTATTGGGAAGCCCTTGGGTGG + Intergenic
1133518579 16:6533761-6533783 AACACTCGAAAGCCCCTGGAAGG + Intronic
1134023713 16:10939381-10939403 AGCAGTGGAAAGCCATTGGAAGG - Intronic
1137611820 16:49823154-49823176 AACCTGAGCCAGCCCTTGGATGG + Intronic
1140144276 16:72290294-72290316 TGCAATGGGAAGCCCTTGGAGGG - Intergenic
1141937732 16:87252939-87252961 ATCAGTGGCCAGCCCTGGGAAGG - Intronic
1148972131 17:51492699-51492721 AAGATGGGCAATCCATTGGAGGG + Intergenic
1151264714 17:72945848-72945870 AACATTGGCAAGCCCTTGGATGG - Intronic
1154257515 18:12796661-12796683 AATATTGGCAAGCGTTTGCATGG - Intronic
1154304505 18:13220332-13220354 AACAATGGCAAGCCCTTCCAAGG - Intronic
1154407552 18:14108025-14108047 AACGCTGGCAAGCCCTTTGTAGG + Intronic
1157315197 18:46581032-46581054 TACAGTGGAAAGCCATTGGAGGG + Intronic
1158594818 18:58806950-58806972 AAAATTGGCTAACCCTGGGAAGG - Intergenic
1161738133 19:6004253-6004275 AACTTTGCCAAGAGCTTGGAAGG - Exonic
1164522467 19:28989686-28989708 AACATAGGCAGGCTCCTGGAGGG + Intergenic
1165382462 19:35490716-35490738 ACCACTGCCAATCCCTTGGAGGG - Intronic
1167051970 19:47084926-47084948 AACACTGGCCAGCCCTTTGGGGG + Intronic
925799199 2:7581068-7581090 AGTAATGGCAAGCCCTAGGAAGG + Intergenic
927234017 2:20853296-20853318 AGCACTGGAAGGCCCTTGGAAGG - Intergenic
930088294 2:47513976-47513998 GACACTGGCAAGCCAGTGGAGGG - Intronic
931103508 2:59029414-59029436 AACCTTGCCAAGCCTTTGTATGG - Intergenic
931104161 2:59035921-59035943 AGCATTGGCAAAGCCTTGAAAGG - Intergenic
935618106 2:105106361-105106383 GACATTGGCCAGCCCTGGGAGGG - Intergenic
935632627 2:105224466-105224488 AGAATTGGCTAGCCCTGGGAAGG + Intergenic
936926797 2:117745322-117745344 TACATGTGCAAGCCCTTGGAGGG - Intergenic
938278022 2:130044798-130044820 CACATTGGCAGGCCATTGGTAGG - Intergenic
938437358 2:131292586-131292608 CACATTGGCAGGCCATTGGTAGG + Intronic
939159636 2:138571906-138571928 AACATTGGCAAGCCATATTATGG - Exonic
939234004 2:139467984-139468006 AACATTGCCAAGCCTTTTGTTGG - Intergenic
939603352 2:144221715-144221737 AACACTTGCAAGCTCCTGGAAGG - Intronic
941289632 2:163659494-163659516 TACATTTCCAAGCCCTTCGAGGG - Intronic
944518679 2:200540763-200540785 AAAATTGGCTAGCCCTGAGAAGG - Intronic
947169844 2:227299975-227299997 AACATTGGCAGGCATTTGGGGGG - Intronic
1169547580 20:6666277-6666299 AACAATGTCAAGCCCTTACAAGG - Intergenic
1170636148 20:18106276-18106298 GAAATTGGCTAGCCCTAGGAGGG + Intergenic
1173618179 20:44416276-44416298 AAAATTGGGAAGCCCTTTGGAGG - Intronic
1175142668 20:56872491-56872513 CACATTGGCCAGCCTTTGTAGGG - Intergenic
1175299044 20:57929875-57929897 GACAATGGTAAGCTCTTGGAAGG + Intergenic
1176951298 21:15050243-15050265 AACATTGGAAACACATTGGAAGG - Intronic
1177532705 21:22383048-22383070 AAGATTAGCCAGCCCTTAGATGG + Intergenic
1181946514 22:26521818-26521840 AAAATTGCCAAGCCCTTTGGAGG + Intergenic
1182265726 22:29113741-29113763 AACATTATCAAGTCCTAGGAAGG + Intronic
1182395013 22:30028986-30029008 AACACTGGCATGGCCTAGGAAGG + Intronic
1182982962 22:34688982-34689004 ACAATTGGCCAGCCCTGGGATGG - Intergenic
949917198 3:8974319-8974341 AACAATGAGAAGCCCTTGGAAGG - Intergenic
950982241 3:17319547-17319569 AACATTGGCTACCCTTGGGAAGG - Intronic
955374608 3:58384698-58384720 AACATTAGCAAGCACTCGCAGGG - Intronic
961359012 3:126356118-126356140 CCCAATGGCAAGCCCTTGGCCGG - Intronic
961609550 3:128125699-128125721 AACAGAGGCCAGGCCTTGGAAGG + Intronic
964012164 3:151904244-151904266 GCCATTGGCAGGCACTTGGAGGG - Intergenic
968288922 3:197524278-197524300 GCCATGGGCAAGCCCTTGGCTGG - Intronic
969129649 4:4982137-4982159 TAGATTGGCCAGCCCTGGGAGGG - Intergenic
969130392 4:4986864-4986886 GAAATTGGCTAGCCCTGGGAAGG - Intergenic
972251689 4:37309071-37309093 AGCATTGGCAGGCCCTTGGTGGG + Intronic
976797614 4:88952236-88952258 AACATTGGCAAGGCCTGTCAGGG + Intronic
977007896 4:91595097-91595119 GACATTGGCAGGCCCTGGGAAGG - Intronic
978839364 4:113191609-113191631 AACATTGGCAGGGCTGTGGATGG + Intronic
980824535 4:138057619-138057641 GGCATTGGCAAGTCATTGGAAGG - Intergenic
981085145 4:140675940-140675962 GAAATTGGCTAGCCCTGGGAAGG - Intronic
982109353 4:152039706-152039728 AACTGTGAGAAGCCCTTGGAAGG - Intergenic
982374364 4:154673284-154673306 CACAATGGTAAGGCCTTGGAAGG - Intronic
984591005 4:181617628-181617650 TACAATGGGAGGCCCTTGGAAGG + Intergenic
986575200 5:9205163-9205185 AACAATGGTAAGCTCTTGGCTGG + Intronic
987224869 5:15830148-15830170 TACATTTCCAAGACCTTGGAAGG - Intronic
987502683 5:18733451-18733473 AACAATGGCAAGCCTTTAGTCGG + Intergenic
988623402 5:32846421-32846443 AACAAAGGCAATCCCTTGAAGGG - Intergenic
989793453 5:45436684-45436706 AACACTGACAAGGCCTTTGAAGG + Intronic
990508080 5:56464459-56464481 AGGATTGGCCAGCCCTGGGAGGG + Intronic
990871788 5:60439893-60439915 AACAATGGAAAGCCTTTGAAGGG - Intronic
993709389 5:91209180-91209202 AACATTTGGAAGCCATTGTAGGG + Intergenic
994908945 5:105876499-105876521 AACATTTGCAAACCACTGGATGG + Intergenic
995046439 5:107653866-107653888 AACATTGGCAAGCTCTTGAGTGG - Intronic
995785057 5:115818973-115818995 AACAATGGCAAGCCTTTAGCCGG + Intergenic
998999949 5:147909568-147909590 TACGTTGGGAAGGCCTTGGAAGG - Intergenic
999291658 5:150429897-150429919 AACAATGGGAAGCCCTCAGAGGG + Intergenic
1000608568 5:163350656-163350678 AGCAATGGAAAGCCTTTGGAGGG - Intergenic
1001539512 5:172527514-172527536 AAAACTGGCTAGCCCTGGGAAGG + Intergenic
1003401489 6:5794680-5794702 AGAAATGGGAAGCCCTTGGAAGG + Intergenic
1004789824 6:19012456-19012478 AATATTGGTAAGCTTTTGGAAGG + Intergenic
1008488969 6:52065542-52065564 AACCTTGGCAAACCCTTTTATGG - Intronic
1010897567 6:81383163-81383185 AACATTTGTGAGCCCTTGGGAGG - Intergenic
1011869407 6:91873656-91873678 AAAATTGACAAGGCTTTGGACGG + Intergenic
1012260388 6:97081439-97081461 AGAATTGGCTAGCCCTGGGAGGG + Intronic
1012266488 6:97150642-97150664 AAAATTGTGAAGCCCTAGGAGGG - Intronic
1013558067 6:111277220-111277242 AAAATTGGCAGGTCCTGGGATGG + Intergenic
1014887796 6:126803026-126803048 CACATTGGCAGACCCTTGTAGGG - Intergenic
1018963996 6:168469224-168469246 AGCAGTGGCAAGGCCCTGGAAGG - Intronic
1024160957 7:46675318-46675340 CACACTGCCAAGGCCTTGGAAGG - Intronic
1024254814 7:47532372-47532394 AACATGGAAAAGCCCTTGGAGGG - Intronic
1024888305 7:54170092-54170114 ACCATTGTAAAGCTCTTGGAAGG - Intergenic
1027329830 7:77080169-77080191 AGCATTGGGAAGCCCTTGGAAGG - Intergenic
1029785932 7:102791170-102791192 AGCATTGGGAAGCCCTTGGAAGG + Intronic
1030322799 7:108187205-108187227 AAGATGGGAAAGCCCTTGGAGGG - Intronic
1034959990 7:155359117-155359139 AGAATTGGCCAGCCCCTGGAGGG - Intronic
1037648667 8:20816948-20816970 AACAATGGCAAGCCTTTAGCCGG + Intergenic
1038216379 8:25565329-25565351 TACATTAGCAAGCACTTGGATGG - Intergenic
1040935202 8:52775202-52775224 AGAATTGGCCAGCCCTGGGAGGG - Intergenic
1041638683 8:60173647-60173669 AGCATTGCCCCGCCCTTGGATGG + Intergenic
1042392061 8:68247425-68247447 AAAATTGGCAAGCCATAGGTAGG - Intergenic
1044588162 8:93887189-93887211 AACATTTGCAAGTCCTTGAGAGG + Intronic
1047667280 8:127105815-127105837 AATACTGCAAAGCCCTTGGAAGG + Intergenic
1048035353 8:130672644-130672666 AATAATGGGAAGCCCTAGGAGGG + Intergenic
1049525037 8:143120781-143120803 AACACTGGGAGGCCCGTGGATGG - Intergenic
1051572291 9:18572969-18572991 AATATTGCCTATCCCTTGGAAGG - Intronic
1055300015 9:74872973-74872995 AATAATGACGAGCCCTTGGAAGG - Intronic
1058826106 9:108777375-108777397 AACAAAAGCAAGCACTTGGAAGG - Intergenic
1059584249 9:115589073-115589095 AGCTTTGCCAAGCCCTTGCAGGG - Intergenic
1059971793 9:119675940-119675962 AATATTGCCATGCCCATGGATGG - Intergenic
1060948871 9:127587988-127588010 AGCAGTGGAAAGCCATTGGAGGG - Intergenic
1062308805 9:135924801-135924823 AACACTGTCATGCCCTGGGAAGG + Intergenic
1185794720 X:2955116-2955138 AGAATTGGCTAGCCCTGGGAGGG + Intronic
1186410514 X:9341916-9341938 AACATAGGCAAGCTCTTGGAAGG - Intergenic
1186556790 X:10568554-10568576 AACAGTGACAAGCCCGTGGTGGG - Intronic
1187204833 X:17171899-17171921 AATATTGGCCACCCCTAGGATGG + Intergenic
1189127564 X:38464065-38464087 AACACTGGCAGCCCATTGGATGG + Intronic
1191232092 X:58103999-58104021 ATCATTGGCATGCCAGTGGAAGG - Intergenic
1191865424 X:65699779-65699801 ATAATAGGCAAGCCTTTGGAAGG + Intronic
1192148924 X:68699886-68699908 ACGATTGGAGAGCCCTTGGAAGG + Intronic
1195593660 X:106662491-106662513 AACATTGGCAAGTCCTTGGAAGG + Intronic
1195994520 X:110718398-110718420 TACATTGGGAAGCTATTGGAAGG - Intronic
1198611424 X:138405434-138405456 AACATAGGCAATCACTTGGTGGG - Intergenic
1199668038 X:150117605-150117627 CACATTGGGAAGCCATTAGAGGG - Intergenic
1200037932 X:153345435-153345457 AACATAGGCAAGGCCTTTGAAGG - Intronic
1200236852 X:154471969-154471991 CACATTTGCAAGCCTGTGGATGG + Intronic