ID: 1151265014

View in Genome Browser
Species Human (GRCh38)
Location 17:72948054-72948076
Sequence TTCCAGGTATAGGACTTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151265003_1151265014 29 Left 1151265003 17:72948002-72948024 CCGGCCAACCCAGTTGCCAGGCC 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1151265014 17:72948054-72948076 TTCCAGGTATAGGACTTTAGTGG 0: 1
1: 0
2: 1
3: 6
4: 108
1151265006_1151265014 21 Left 1151265006 17:72948010-72948032 CCCAGTTGCCAGGCCATGCTGGG 0: 1
1: 1
2: 3
3: 16
4: 220
Right 1151265014 17:72948054-72948076 TTCCAGGTATAGGACTTTAGTGG 0: 1
1: 0
2: 1
3: 6
4: 108
1151265011_1151265014 8 Left 1151265011 17:72948023-72948045 CCATGCTGGGTCTTCAGGAAGAT 0: 1
1: 0
2: 2
3: 26
4: 250
Right 1151265014 17:72948054-72948076 TTCCAGGTATAGGACTTTAGTGG 0: 1
1: 0
2: 1
3: 6
4: 108
1151265009_1151265014 13 Left 1151265009 17:72948018-72948040 CCAGGCCATGCTGGGTCTTCAGG 0: 1
1: 0
2: 4
3: 27
4: 293
Right 1151265014 17:72948054-72948076 TTCCAGGTATAGGACTTTAGTGG 0: 1
1: 0
2: 1
3: 6
4: 108
1151265004_1151265014 25 Left 1151265004 17:72948006-72948028 CCAACCCAGTTGCCAGGCCATGC 0: 1
1: 0
2: 4
3: 15
4: 148
Right 1151265014 17:72948054-72948076 TTCCAGGTATAGGACTTTAGTGG 0: 1
1: 0
2: 1
3: 6
4: 108
1151265008_1151265014 20 Left 1151265008 17:72948011-72948033 CCAGTTGCCAGGCCATGCTGGGT 0: 1
1: 0
2: 2
3: 21
4: 199
Right 1151265014 17:72948054-72948076 TTCCAGGTATAGGACTTTAGTGG 0: 1
1: 0
2: 1
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151265014 Original CRISPR TTCCAGGTATAGGACTTTAG TGG Intronic
901693709 1:10990950-10990972 TTCCAGGCATGGGGCTGTAGGGG + Intergenic
913174178 1:116258855-116258877 TTCCTGGTACAGGGCTTCAGTGG + Intergenic
916386087 1:164272232-164272254 TTATAGGTATAGGACTAAAGTGG + Intergenic
917074830 1:171193518-171193540 TTCCAGGTATTGTATTTTTGGGG + Exonic
917455984 1:175186447-175186469 TTCCAGGAATAAGATTTTGGTGG - Intronic
917968667 1:180193985-180194007 ATCCAGGTTTAGGAGTTTTGGGG + Intronic
919374204 1:196771766-196771788 TTCCAGGTATACCAATTTATTGG + Intergenic
919655570 1:200194074-200194096 TTCCATGTGTTGGACCTTAGTGG - Intergenic
920221765 1:204409360-204409382 ATCCAAGTATATGAATTTAGAGG + Intronic
920937884 1:210452777-210452799 ATCCAGGTATATGAGTTTATGGG + Intronic
921890780 1:220351773-220351795 TTTCAGCTAAAGGGCTTTAGAGG - Intergenic
922021656 1:221711060-221711082 TTCCACATATAGTTCTTTAGGGG - Intronic
1072069003 10:91898571-91898593 TTCCATGTGTAGGACTTGAAAGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1091224374 11:133948873-133948895 TTCCAGGTGGAGGGCTCTAGCGG + Intronic
1093564972 12:20591128-20591150 TTACTGTTTTAGGACTTTAGGGG - Intronic
1102609024 12:114094985-114095007 TTCCCAGTATAGAACTTTAGAGG + Intergenic
1103890697 12:124236973-124236995 TTCAGGGCATAGGACTTTTGGGG - Intronic
1104258827 12:127164193-127164215 TTCCAGGTGTAAGATATTAGAGG + Intergenic
1111255193 13:85658640-85658662 TTTCAGGTATAGGACTTATTTGG - Intergenic
1112290234 13:98139927-98139949 TTCCAGGTTCAGGATTTTCGAGG + Intergenic
1112689134 13:101870113-101870135 TTTCTGCTATAGGATTTTAGGGG + Intronic
1115027918 14:28765292-28765314 TCCCAGGGATTGGAATTTAGTGG - Intergenic
1117410158 14:55443147-55443169 TACTAGGGATAGGAATTTAGGGG - Intronic
1119573119 14:75693974-75693996 TTTCAAGTATATGACTCTAGAGG - Intronic
1119816220 14:77570792-77570814 TTCCAGGTCTAGGCCTTAGGAGG + Intronic
1120262075 14:82198663-82198685 TTCCAGGTCCTGGACTTTAGAGG + Intergenic
1122421889 14:101583003-101583025 TACAAGGTCTAGGAATTTAGGGG + Intergenic
1125350756 15:38765043-38765065 TGCCATGTATAGTACTTTAATGG - Intergenic
1127721657 15:61707647-61707669 GTCCAGGTAAAGGACACTAGGGG + Intergenic
1130399716 15:83538460-83538482 TTCAAGATATAGAACATTAGTGG + Intronic
1138334492 16:56241952-56241974 TTCCAGGTACAGGGCTTCTGAGG - Intronic
1139144813 16:64310394-64310416 TTCAAGGTATAGAGCTTTGGAGG + Intergenic
1143621034 17:8080352-8080374 TTCCAGGAAGAGGCCTTCAGAGG + Exonic
1150966231 17:69972354-69972376 TTCCAGGCCTAGGCCTTAAGTGG - Intergenic
1151265014 17:72948054-72948076 TTCCAGGTATAGGACTTTAGTGG + Intronic
1155366559 18:25055027-25055049 TTCCAGTGATAGGACCTTAGGGG - Intergenic
1157806528 18:50662317-50662339 TTACAGGTATAGGAACTAAGTGG - Intronic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1165637800 19:37357780-37357802 TTCTAGGTATAGGATTTTCTAGG + Intronic
1166413209 19:42570971-42570993 TTCCAGAAAAAGGACATTAGAGG + Intergenic
925304825 2:2840697-2840719 TTCCAGGTATTGGAATGTGGAGG + Intergenic
929272676 2:39990091-39990113 TTGCATGCATAGGACTGTAGGGG + Intergenic
930126265 2:47799720-47799742 TTCGAGATTTAGGACTCTAGTGG + Exonic
931694643 2:64862544-64862566 TTCCAAATCTAGGTCTTTAGAGG + Intergenic
931899027 2:66767378-66767400 TCCCAGGAATAGGGATTTAGAGG - Intergenic
933143346 2:78821029-78821051 TTCATGGTAAAGGAATTTAGAGG + Intergenic
934000258 2:87703744-87703766 TTCCAGGTCTTGGAATTTACTGG - Intergenic
936503460 2:113085169-113085191 ATCCAGGTAAAGGATTTCAGTGG + Intergenic
938933647 2:136109528-136109550 TCCCAGGAATAGGAATTTATGGG + Intergenic
939578915 2:143925429-143925451 TTCCAGTTATAGGACTATAGTGG - Intergenic
940274579 2:151925728-151925750 TTCCAGGGAAAGGGCCTTAGAGG + Intronic
941176149 2:162199584-162199606 TTCCATGTGGAGGAGTTTAGAGG + Intronic
943940343 2:193986310-193986332 TTCCAGATCTAGTCCTTTAGAGG - Intergenic
946061828 2:216949228-216949250 TTACAGGTATTGGAATTTGGAGG - Intergenic
947478257 2:230471859-230471881 TTCCAGGTAGGGGAATTTTGTGG + Intronic
1172480015 20:35265744-35265766 TTTCAGTTATAGTTCTTTAGTGG + Intronic
1172493574 20:35361240-35361262 TTCCAGGTAGAGGGATCTAGTGG - Intronic
1172836137 20:37874374-37874396 TTCCAGGTAGAGGAGCTCAGCGG - Intergenic
1173128817 20:40367222-40367244 TTACAGGTAAGGGACTTTGGCGG + Intergenic
1174858413 20:54068144-54068166 TTCCTGGTATGGGACTTTGTGGG + Intronic
1175075946 20:56373391-56373413 TTCCAGGTATGTAACTTTAGAGG - Exonic
1178687707 21:34724248-34724270 TTCCAGGAACAGGACTTAAAGGG + Intergenic
1184986175 22:48136918-48136940 CTCCAGGTATTAGACTTCAGAGG + Intergenic
949593032 3:5513401-5513423 TTTCAGCTTTAGGACTTTTGGGG - Intergenic
950925950 3:16742172-16742194 TTCCAGGCCTAGGCCTTAAGAGG - Intergenic
951095157 3:18620662-18620684 TCCCAGGTACAGGTCATTAGAGG - Intergenic
953066353 3:39475001-39475023 TGACAGAAATAGGACTTTAGTGG - Intronic
954640834 3:52096895-52096917 TTCCAGGCAGAGGCCTTAAGTGG + Intronic
956976435 3:74586349-74586371 GTCCAGGTATAGAAGTTTATAGG - Intergenic
959137892 3:102447844-102447866 TTCTAGGAATAGAACTTTATAGG + Intronic
962253674 3:133855656-133855678 CTCCAGGTGTCGGACTTTTGAGG + Intronic
966054615 3:175669504-175669526 TACCAGGTATAAGAATTTTGGGG - Intronic
970328403 4:14953268-14953290 TTCCTGTTATAGAACTTAAGGGG + Intergenic
971407193 4:26332983-26333005 TTCCTGGTATAAGACTATAGTGG - Intronic
971608471 4:28689026-28689048 TTTCAGGTATACGCCTATAGAGG + Intergenic
972170948 4:36344575-36344597 CTCCAGGTAGCAGACTTTAGAGG + Exonic
973093256 4:46164613-46164635 ATCCAAGTATAGGAGTTTTGTGG + Intergenic
976070951 4:81239143-81239165 TGCCAGTTATAAGACTTAAGAGG + Intergenic
979444488 4:120795080-120795102 TTCCAGGGATGAAACTTTAGAGG - Intronic
981773285 4:148335019-148335041 TTCCAGTTATATTACATTAGGGG + Intronic
982361238 4:154521663-154521685 TTCCAGGGATTGGACTTGATTGG - Intergenic
992752025 5:79870631-79870653 GTCCAGGTCTAGGTCTTCAGGGG + Intergenic
993083297 5:83329876-83329898 TTTGAGGTAAAGGACATTAGTGG + Intronic
994574616 5:101561994-101562016 ATCTAAGTATATGACTTTAGTGG + Intergenic
995970028 5:117957260-117957282 TTCCAGAGATTTGACTTTAGAGG + Intergenic
997178501 5:131803666-131803688 TTCCAGGGGTAGGCCTTTAATGG - Intergenic
1002850893 6:995540-995562 TTTCAGGTATAGGACTGGTGAGG + Intergenic
1008136979 6:47788280-47788302 TACCAGGTAGAGCACCTTAGGGG - Intronic
1010005614 6:70992065-70992087 TGCCAGGTTTTGGACTTGAGTGG + Intergenic
1011304598 6:85912134-85912156 TCCCAGGTATAGTAATTAAGAGG - Intergenic
1012165838 6:95950658-95950680 TTACAAGTATATGATTTTAGTGG + Intergenic
1014519121 6:122417612-122417634 GTCCAGTTATAGGACTTAACAGG + Intronic
1015912825 6:138185658-138185680 TACAAGGTATGGGACCTTAGAGG + Intronic
1017697351 6:157030310-157030332 TTCCAAGTCTAGGACTCAAGAGG - Intronic
1022778775 7:33556688-33556710 TGCCAGGAAAATGACTTTAGAGG + Intronic
1023427498 7:40054068-40054090 TTCCAGGTAGAGAACTCTAGGGG + Intronic
1027489907 7:78810193-78810215 TTCCAAGTATTGGTGTTTAGAGG + Intronic
1028927435 7:96373894-96373916 TTCCAGGTAGAAGCCTTTACAGG - Intergenic
1033775398 7:144604183-144604205 TTTCAGGTATTCAACTTTAGCGG - Intronic
1034424657 7:151008119-151008141 TTTTGGGAATAGGACTTTAGAGG + Intronic
1036091322 8:5668799-5668821 TTCCAAGCAAAGCACTTTAGTGG + Intergenic
1037044374 8:14278993-14279015 TTCCTGGTCTAGGAATTTAATGG + Intronic
1037725636 8:21480519-21480541 TGCCAGGTAGAGGTCATTAGGGG + Intergenic
1039210346 8:35206048-35206070 TTCCAGGTACAAGATTTCAGAGG - Intergenic
1049687713 8:143945602-143945624 TTCATGGTATAGGACTTCATGGG - Intronic
1055249290 9:74282813-74282835 TTGCAGATATAAGACATTAGAGG - Intergenic
1056619353 9:88198028-88198050 TCCCAGGTTTAGCACTTTTGAGG + Intergenic
1057049736 9:91914634-91914656 TTCCAGGCAGAGGAGTTTTGGGG - Intronic
1186691030 X:11975811-11975833 TTTCAGGGATAGCACTTAAGAGG - Intergenic
1188793267 X:34431334-34431356 TTCCAGGTAGGGGATTTTATTGG + Intergenic
1189609239 X:42714359-42714381 TTCCAGGAAGAGGAATTTACAGG + Intergenic
1191961824 X:66711954-66711976 TTCCAGTTCTAGTACTTTAATGG + Intergenic
1194425118 X:93727565-93727587 TTCCAGGTATTGAACTATAAGGG - Intergenic
1197195089 X:123691732-123691754 TTCCTGGTTTTGGATTTTAGTGG - Intronic
1197411542 X:126121940-126121962 TTCTATATATATGACTTTAGAGG + Intergenic