ID: 1151265258

View in Genome Browser
Species Human (GRCh38)
Location 17:72950336-72950358
Sequence GCCCTGCAGTATCACGGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151265252_1151265258 17 Left 1151265252 17:72950296-72950318 CCCTTTGGGTATCCACCTCTTCT 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1151265258 17:72950336-72950358 GCCCTGCAGTATCACGGTTAAGG 0: 1
1: 0
2: 0
3: 4
4: 41
1151265256_1151265258 2 Left 1151265256 17:72950311-72950333 CCTCTTCTGTCACATAAAGGCAG 0: 1
1: 0
2: 1
3: 24
4: 214
Right 1151265258 17:72950336-72950358 GCCCTGCAGTATCACGGTTAAGG 0: 1
1: 0
2: 0
3: 4
4: 41
1151265253_1151265258 16 Left 1151265253 17:72950297-72950319 CCTTTGGGTATCCACCTCTTCTG 0: 1
1: 0
2: 1
3: 18
4: 128
Right 1151265258 17:72950336-72950358 GCCCTGCAGTATCACGGTTAAGG 0: 1
1: 0
2: 0
3: 4
4: 41
1151265251_1151265258 18 Left 1151265251 17:72950295-72950317 CCCCTTTGGGTATCCACCTCTTC 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1151265258 17:72950336-72950358 GCCCTGCAGTATCACGGTTAAGG 0: 1
1: 0
2: 0
3: 4
4: 41
1151265254_1151265258 5 Left 1151265254 17:72950308-72950330 CCACCTCTTCTGTCACATAAAGG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1151265258 17:72950336-72950358 GCCCTGCAGTATCACGGTTAAGG 0: 1
1: 0
2: 0
3: 4
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151265258 Original CRISPR GCCCTGCAGTATCACGGTTA AGG Intronic
902955622 1:19922668-19922690 GCCCTGCAGTACAACGACTATGG - Exonic
916028241 1:160854034-160854056 ACCCAGCAGTAGCATGGTTAAGG + Intronic
920007301 1:202842808-202842830 GCCCTGCAGGATAAGGGCTAAGG + Intergenic
924451831 1:244185401-244185423 ACACTGCAGTATCAGGGTTTGGG + Intergenic
1065121825 10:22537979-22538001 CCCCTGCAGAAGCACGGTGAGGG + Intronic
1070582569 10:77733442-77733464 GCCCTGCAGTCTCACATTCAAGG + Intergenic
1072324653 10:94285956-94285978 GCCAGGCAGTATAACGGGTAAGG - Intronic
1079610854 11:22431175-22431197 GCCCTGCAGTATCACACTCAAGG - Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1113231248 13:108215676-108215698 GACCTGCAGGATCCTGGTTAGGG + Intronic
1114063555 14:19040231-19040253 GCCCTGCAGTCTCACAGTGGAGG - Intergenic
1114098701 14:19359765-19359787 GCCCTGCAGTCTCACAGTGGAGG + Intergenic
1117326197 14:54671243-54671265 GCCCAGCAGCATCACTGTTAGGG + Intronic
1129874730 15:78966285-78966307 GCCCTGCAGTGGCACGATCATGG + Intronic
1131372943 15:91898641-91898663 GCTCTGGAGTCTCACAGTTAAGG - Intronic
1131427890 15:92361852-92361874 GCCCTGCAGCTTCAGGGTTCTGG - Intergenic
1134906492 16:17983989-17984011 GCCCTGCAGTGACACGGGTGAGG - Intergenic
1135769906 16:25209837-25209859 CCCCTGCAGTGTCAAGGTCAAGG - Intergenic
1140964960 16:79956917-79956939 GTCCTGCAGTATCCAGGTTGAGG - Intergenic
1151265258 17:72950336-72950358 GCCCTGCAGTATCACGGTTAAGG + Intronic
1157514936 18:48304113-48304135 GCCATGGAGTATGATGGTTAAGG - Intronic
1157825797 18:50811062-50811084 CCCATGCAGTATCATGGTGATGG + Intronic
1165228388 19:34370214-34370236 CCCCTGCAGAATCACCGCTAGGG - Intronic
925936410 2:8766049-8766071 GCCCTGAAGCATCAGGGTAATGG + Intronic
932236873 2:70127636-70127658 ACATTGCAGTATCACTGTTAGGG + Intergenic
939243101 2:139587674-139587696 GCCCTTAAGGATCACAGTTAAGG - Intergenic
944746394 2:202660955-202660977 GCCCTGCAGGATGAAGGCTATGG - Intronic
1176011957 20:62902172-62902194 ACCGTGCAGGGTCACGGTTACGG + Intronic
1176278255 20:64286687-64286709 GCCCTGAATAATCAGGGTTAGGG + Intronic
1180482049 22:15762865-15762887 GCCCTGCAGTCTCACAGTGGAGG - Intergenic
1181858039 22:25796840-25796862 GCCCTTTAGTATCATGGTTGAGG + Intronic
959262471 3:104099146-104099168 TTCCTGCAGGACCACGGTTAGGG - Intergenic
965299146 3:166988534-166988556 GCCCTGCAGTAGGACAGTAAAGG + Intergenic
987309159 5:16666345-16666367 TCCCTTCAGTAGCACAGTTACGG + Exonic
990082974 5:51939791-51939813 ACTCTGAAGTTTCACGGTTAGGG - Intergenic
999073532 5:148773058-148773080 GCCCAGCAGTATCACGTTCTGGG + Intergenic
999662300 5:153878218-153878240 GCCCTGCACTCTCACGGGTCTGG + Intergenic
1002754664 6:147977-147999 GCCCTGAATAATCAGGGTTAGGG - Intergenic
1010273046 6:73936778-73936800 GCTCTCCAGTATCACAGTCAAGG - Intergenic
1039633263 8:39135274-39135296 GCCCTGCTGTTTCAGGGTTAGGG + Intronic
1041964712 8:63662709-63662731 GGCCTCCAGTATAATGGTTAAGG + Intergenic
1052026473 9:23578301-23578323 GCCCTGCATTACCACCATTAGGG - Intergenic
1052564573 9:30131892-30131914 GCCCTGAAGTTTCTCAGTTAAGG - Intergenic
1053260896 9:36662834-36662856 GTTCTGCAGTTTCACTGTTAGGG + Intronic
1061891763 9:133625406-133625428 GCCCTGCAGAATCACAGGGATGG - Intergenic
1196633567 X:117973192-117973214 GTGCTGCAGTATCCCTGTTAAGG - Intronic