ID: 1151266977

View in Genome Browser
Species Human (GRCh38)
Location 17:72964029-72964051
Sequence TAGGACCCCCAAAAGTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151266975_1151266977 -4 Left 1151266975 17:72964010-72964032 CCAGAAAGGCAAAAGCTGCTAGG 0: 1
1: 0
2: 2
3: 27
4: 204
Right 1151266977 17:72964029-72964051 TAGGACCCCCAAAAGTACAAAGG 0: 1
1: 0
2: 2
3: 4
4: 94
1151266974_1151266977 -3 Left 1151266974 17:72964009-72964031 CCCAGAAAGGCAAAAGCTGCTAG 0: 1
1: 0
2: 2
3: 33
4: 260
Right 1151266977 17:72964029-72964051 TAGGACCCCCAAAAGTACAAAGG 0: 1
1: 0
2: 2
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151266977 Original CRISPR TAGGACCCCCAAAAGTACAA AGG Intronic
902551098 1:17220077-17220099 GAGGACCCCCAAAAGTGCTGTGG + Intronic
906279234 1:44542410-44542432 TAGGACATCCTAAAGTACAGGGG - Intronic
908185489 1:61648917-61648939 TAGAAGCCCCAGAAGTACCATGG - Intergenic
908820970 1:68086232-68086254 GAGGACCCTCCCAAGTACAATGG - Intergenic
911222419 1:95263062-95263084 AGGGACCCCCAAAAGCACAGTGG - Intergenic
911222996 1:95270698-95270720 GAGGTCCCCCAAAAGAACTAAGG - Intergenic
915866255 1:159502682-159502704 AAAGACCACCAAAAGAACAAGGG + Intergenic
916709546 1:167391496-167391518 TAGCATCCCCAAATGTACTATGG + Intronic
917375074 1:174343210-174343232 TAGGACCCTCAAAAGAGAAATGG - Intronic
920702475 1:208228341-208228363 TAGGGTTCCCAAAAGTTCAAAGG + Intronic
920881444 1:209884229-209884251 TAGGATAACCAAAAGCACAAAGG - Intergenic
922965369 1:229686495-229686517 TAGGACACTCAAAAGTAAATGGG - Intergenic
923493480 1:234505020-234505042 TTGGACCCCCAAAATCACTAAGG - Intergenic
1063005021 10:1961918-1961940 CAGAACCCCCAAAAGGACAGGGG - Intergenic
1063235902 10:4116025-4116047 TAGAAACCCAAAAAGTAGAAAGG - Intergenic
1073187441 10:101625151-101625173 TAGGAATCCCAAGAGCACAATGG + Intronic
1073984502 10:109193066-109193088 TAGGAGCCTCAAGAGAACAAAGG + Intergenic
1078250854 11:9615160-9615182 AAGGCCCCCCAAAACTCCAAGGG + Intergenic
1083067210 11:59937240-59937262 TAGGACACACAAAAATACAGAGG + Intergenic
1087566598 11:99867657-99867679 AAGGGCCCTCAAAAGTAGAAGGG - Intronic
1088477485 11:110258599-110258621 TAGGAACCCAAACAGTTCAAAGG + Intronic
1088628738 11:111753343-111753365 TAGAACCCCCAAAAAGAAAATGG - Intronic
1093393317 12:18650146-18650168 CAGTATCCCCAAAAGTACACAGG + Intergenic
1097432621 12:59528718-59528740 TAGGACTCCCAATAGCACAGTGG + Intergenic
1099138015 12:78932982-78933004 TAAGACGTCCAAAAGTATAAAGG + Intronic
1100839489 12:98597856-98597878 GTGGACCCCCAAAAGTACAAGGG + Exonic
1101717923 12:107327079-107327101 TTGGGCCCCCAAAGGTTCAAGGG - Intronic
1102164489 12:110795491-110795513 CAGGAACCCCAAGGGTACAAGGG - Intergenic
1102326874 12:111993270-111993292 GTGGACCCCCAAAAGTAGAAGGG + Intronic
1108750736 13:53445831-53445853 CATGACCCTCAAAAGTACAAGGG + Intergenic
1110560501 13:76906647-76906669 TAGCACACCCAGAAGTAGAAGGG - Intergenic
1114998687 14:28393409-28393431 TAAAACTCGCAAAAGTACAAAGG + Intergenic
1116148950 14:41112981-41113003 AAGACCCCCCAAAAATACAAGGG + Intergenic
1117235967 14:53774957-53774979 TAAGACCCCCCAAAATACAATGG - Intergenic
1118977921 14:70693318-70693340 TAGGCACCCCAAAACTAAAAAGG + Intergenic
1120445614 14:84591562-84591584 TAAGACACCCAGAAGTAAAAAGG - Intergenic
1121878463 14:97477061-97477083 TGTGGCCCCCAAAAGTACTATGG - Intergenic
1122381065 14:101307553-101307575 TAGGACCTCTAAAAGTATTAAGG + Intergenic
1126545764 15:49872271-49872293 TAGGGGCCCCAAAGGTATAAGGG - Intronic
1132312395 15:100866660-100866682 TCAGGCCCCCAAAAGTACAGAGG + Intergenic
1151266977 17:72964029-72964051 TAGGACCCCCAAAAGTACAAAGG + Intronic
1153417385 18:4862473-4862495 AAGGATCACCAAAAGTATAAGGG - Intergenic
1156869313 18:41927257-41927279 TATGTCCCCCAAAACTACCAAGG + Intergenic
1164042370 19:21505079-21505101 TTGGGCCCCCAAAATTACTAAGG - Intronic
1165710805 19:38009522-38009544 AAGGACCCTCAAAAGCACACTGG - Intronic
1166442307 19:42825519-42825541 TGGGACTTCCAAAGGTACAAGGG - Intronic
1166461755 19:42993828-42993850 TGGGACTTCCAAAGGTACAAGGG - Intronic
1166501704 19:43346126-43346148 TGGGACTTCCAAAGGTACAAGGG - Intergenic
1166508411 19:43387332-43387354 TGGGACTTCCAAAGGTACAAGGG + Intergenic
926158511 2:10471721-10471743 AAGGCCCTGCAAAAGTACAAAGG + Intergenic
931880529 2:66565046-66565068 TCTGTCCCCCAAAAGTACATAGG - Intronic
937949434 2:127372339-127372361 CAGGAGCCACAAAAGTACACTGG + Intronic
941154444 2:161959032-161959054 TAGGAACCACAAAAGTAACATGG + Intronic
941735663 2:168972932-168972954 AATGACCCCCAAAGGTACATAGG - Intronic
943118012 2:183697587-183697609 TAGGATGAACAAAAGTACAAAGG - Intergenic
1177350749 21:19938271-19938293 TTGGACCCCCAAAATTATACTGG - Intergenic
952956029 3:38557777-38557799 AAGAACCCCCTTAAGTACAAGGG - Intronic
954756817 3:52845064-52845086 GAGCCCCCCCAAAAGTCCAAAGG + Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
958677884 3:97290743-97290765 AAGGACCCCAAAAACTAGAATGG - Intronic
959168367 3:102811261-102811283 TAGGACCCTGAAAAGTGTAATGG - Intergenic
959629235 3:108489824-108489846 AATGTCCCCCAAAAGGACAATGG + Intronic
966706260 3:182918356-182918378 TAGGAGTCCCATAAGCACAAGGG - Exonic
971755549 4:30703176-30703198 AAGGATGCCAAAAAGTACAAAGG + Intergenic
973887206 4:55335703-55335725 TGGGACCCTCAAAAGTTCACAGG - Intergenic
974543674 4:63272459-63272481 CAGGTCCCACAGAAGTACAAAGG - Intergenic
981292285 4:143090167-143090189 TTGGACCCCCAAAATCACTAAGG + Intergenic
983122098 4:163899023-163899045 TAGGAACTCCAAAAGTGGAAGGG + Intronic
985056205 4:186037656-186037678 TAGGACCCCAAAAAGAACAAAGG + Intergenic
986502184 5:8412587-8412609 TTGGACCCCCAAAATCACTAAGG + Intergenic
990822642 5:59859884-59859906 TTGGTCCTCTAAAAGTACAATGG + Intronic
992663383 5:78983616-78983638 CAGAACCGCCAAAAGTACTAAGG + Intronic
993567302 5:89491063-89491085 TAGGAACTCCAAAATTACAAGGG + Intergenic
1000805831 5:165790522-165790544 GAGGACACACAAAAGTAGAAGGG - Intergenic
1001094132 5:168762946-168762968 TGTGACCCCCAAAAGCATAAGGG - Intronic
1003287462 6:4746891-4746913 CAGGACCCCCAAGAGTAGATGGG - Intronic
1005947017 6:30602432-30602454 GAGGACCCCCAAATGGACGAGGG - Exonic
1012219078 6:96626272-96626294 TACGACCTCCAAAATTAGAAAGG + Intergenic
1013478270 6:110529675-110529697 CAGGCACCCCCAAAGTACAAGGG - Intergenic
1016937378 6:149457203-149457225 TGGAACCCTCAAAAGGACAAGGG - Intronic
1020322104 7:6946861-6946883 TTGGACCTCCCAAATTACAAGGG - Intergenic
1020945481 7:14600595-14600617 TAGGTCCTTCCAAAGTACAATGG + Intronic
1022060262 7:26786083-26786105 TAGGGCCCTCCAAAGTACAGGGG + Intronic
1022273710 7:28835638-28835660 GAGGACCCACAGAAGGACAAAGG + Intergenic
1022665103 7:32403365-32403387 TAGGACTCAGAAAAGGACAAAGG - Intergenic
1024946862 7:54817166-54817188 TCGGACCCCCAAAATCACTAAGG + Intergenic
1026457471 7:70585192-70585214 CAGGACCCCCAAAAGTTGACTGG - Intronic
1026631614 7:72042751-72042773 TAAGACTCCCAAAAGGAAAAAGG + Intronic
1031819263 7:126478806-126478828 TAGGAACCCCAATAGTAGAGAGG - Intronic
1032729956 7:134630731-134630753 TTGGATCCCCAAAAGTGCATAGG - Intergenic
1036583495 8:10100402-10100424 CAGGACCTCCACAAGCACAATGG - Intronic
1037550769 8:19969199-19969221 TAGGGCCCACACAAGTTCAAAGG - Intergenic
1042207082 8:66340152-66340174 TAGGACCTCCAAAAGGCAAACGG + Intergenic
1043109065 8:76154427-76154449 TAATACCCCCATAAATACAAAGG - Intergenic
1044769261 8:95612500-95612522 TATGAGACCCAAAAGTTCAATGG - Intergenic
1045820385 8:106329821-106329843 TAAGACCCAGAAAAGTACACTGG - Intronic
1186535240 X:10340545-10340567 TAGGAGCCACACTAGTACAATGG + Intergenic
1187487916 X:19722021-19722043 AAGGAAACCCAAAGGTACAAGGG + Intronic
1188090291 X:25955581-25955603 TATGCCCCCAAAAAGTATAAAGG - Intergenic
1192265754 X:69536842-69536864 TAAGAACCCCAAAAGGAAAAGGG - Intergenic
1200056966 X:153466647-153466669 TAGGACCCTCAAAAGGCCTAAGG + Intronic