ID: 1151269723

View in Genome Browser
Species Human (GRCh38)
Location 17:72984818-72984840
Sequence TGTTAAATGAATAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 407}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151269720_1151269723 -7 Left 1151269720 17:72984802-72984824 CCTTCTGGAAGCAGAATGTTAAA 0: 1
1: 1
2: 1
3: 23
4: 221
Right 1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151269723 Original CRISPR TGTTAAATGAATAAGGAGGA AGG Intronic
901144970 1:7058579-7058601 TGTTTAATGAGTAGGGAGGAGGG + Intronic
902869307 1:19304064-19304086 TGTAAAGTGAATAGGGAGCAAGG + Exonic
903790371 1:25888831-25888853 TGTTCCAGGAAAAAGGAGGATGG + Intronic
906096753 1:43229169-43229191 TGTCAAATGAGGAAGGAGAAAGG - Intronic
906201423 1:43962934-43962956 TGTTAAATAAAGGAGGGGGAGGG + Intronic
906381987 1:45338658-45338680 TGTTAAATGAATTAATGGGATGG + Intronic
909117115 1:71551297-71551319 TGTTAAATAAATAATGAGACAGG + Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909320305 1:74277270-74277292 TGATAAATAAATAAGCTGGATGG + Intronic
909404067 1:75266695-75266717 TGTTAAATGAATGAGAAAAAAGG - Intronic
909723650 1:78808313-78808335 ATTTAAATGAAAAAGAAGGAAGG + Intergenic
909733641 1:78929174-78929196 TTTTAGAAGAGTAAGGAGGAAGG - Intronic
910852200 1:91659527-91659549 TGGGAAATGGATAAGGAAGAAGG - Intergenic
911653165 1:100412491-100412513 AGGAAAATGAAGAAGGAGGAAGG - Intronic
911836911 1:102631039-102631061 TTTTAAATGAATAATGACTAGGG + Intergenic
913336271 1:117711324-117711346 TGTTCAATTCATAAGGAAGAAGG + Intergenic
913446090 1:118952096-118952118 TGTGAAAACAATAAGGATGAAGG + Intronic
915541240 1:156567702-156567724 TCTTAAAGGAGTCAGGAGGATGG - Intronic
915552180 1:156641758-156641780 TGTTCAAAGAAGAAGGAGGAGGG - Intronic
916235075 1:162578753-162578775 TGTTAAATGAATAAACAAAATGG - Intronic
916340288 1:163726190-163726212 TATTAAATGTAGATGGAGGATGG - Intergenic
917307195 1:173638707-173638729 TTTTAAATCAAAAAGCAGGAAGG + Intronic
917713246 1:177708845-177708867 TTTTAAATGATTGAGAAGGAAGG + Intergenic
917751384 1:178056661-178056683 TGGTAAATGGAGATGGAGGAAGG - Intergenic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918464453 1:184807234-184807256 TCCTAAATGAATAAGGGGTACGG - Intronic
918783025 1:188728326-188728348 TCTTAAATGAATAGAGAGAAAGG - Intergenic
918977284 1:191506179-191506201 TGTAAAATGAATTAGGAAAAAGG + Intergenic
919331944 1:196183103-196183125 TGTTACACAAATAAGCAGGAAGG - Intergenic
920359058 1:205399817-205399839 TATTGAATGAATAGGGAGAAAGG + Intronic
922074780 1:222232748-222232770 TGTGAAATAAATAATGAAGATGG + Intergenic
923598043 1:235376232-235376254 TGTTAGATTAATAATGAGAATGG + Intronic
923729768 1:236538986-236539008 TGATAAATGAAAAATGGGGACGG + Exonic
924450118 1:244170935-244170957 TAATAAATGAATCAGGAAGAGGG + Intergenic
924856989 1:247883712-247883734 TGTTAAATGAATAAGTCATAGGG + Intergenic
1062970665 10:1645851-1645873 TGATAAATGAAGAAGAATGACGG - Intronic
1064366534 10:14713579-14713601 TGTTAAGTGAATTGAGAGGAAGG + Intronic
1064594583 10:16930696-16930718 TATAAAATGAATAAGCAGGTGGG + Intronic
1065141933 10:22726445-22726467 TGCTAAATGAATGAGTAGAAAGG - Intergenic
1065262897 10:23944126-23944148 TAATAAATGAATAAGTAGGCCGG + Intronic
1065371598 10:24992330-24992352 TTTTAGATAAATAAGGAGGTCGG + Intronic
1068227415 10:54123872-54123894 TGTTAATTCAATTAGGATGATGG - Intronic
1069341767 10:67417969-67417991 TGGTAAATGGATAAGCAGCATGG + Intronic
1070249715 10:74763440-74763462 TGTTGAATGAATAAATAGGGTGG - Intergenic
1071409751 10:85377496-85377518 TGTCAAATGAAAAATGAGGGCGG + Intergenic
1073706172 10:105986932-105986954 TCTTAAATGATGAAGGAGGGAGG + Intergenic
1074358067 10:112803362-112803384 TCTAAAATGAAGAAGGAGGCTGG - Intronic
1074744150 10:116514889-116514911 TTTTAAATGAAGAATGAAGAAGG + Intergenic
1074919417 10:117992360-117992382 TGTAAAATGAAGAAGTAGGTTGG - Intergenic
1076116049 10:127901603-127901625 TGTCAAATGCATAAGGATGAGGG - Intergenic
1077163503 11:1124504-1124526 GGATAAGTGAATAAGGATGAGGG + Intergenic
1077262604 11:1630748-1630770 TCTTAAATGAGTGAGGAGCAGGG - Intergenic
1077592641 11:3504597-3504619 GGTTAAATGAATAATGGGGCTGG - Intergenic
1078539889 11:12204871-12204893 TGCTAAAGGAATTTGGAGGAAGG + Intronic
1078654195 11:13222964-13222986 TGTTAAATTCACAAGGAGAAAGG + Intergenic
1079821412 11:25135460-25135482 AGTTAATTGAATAATGGGGAAGG + Intergenic
1080521063 11:33068217-33068239 TTTTAAAAGAATAAAGAGGCCGG - Intronic
1080689276 11:34542538-34542560 TGTTAAATGAATGAAGAAGATGG + Intergenic
1080846222 11:36029364-36029386 TGTTAAAGGGAGCAGGAGGAGGG + Intronic
1081083639 11:38773396-38773418 TTTTAAATAATTGAGGAGGAAGG + Intergenic
1082732990 11:56823218-56823240 TGTAAAATGAAAAAAGAGAAAGG - Intergenic
1083375766 11:62219263-62219285 TTTTAAATCAAAAAGCAGGAAGG + Intergenic
1083422224 11:62560475-62560497 GGGTCAATCAATAAGGAGGAAGG + Intronic
1084439216 11:69161706-69161728 GGATAAATGAATAATGATGATGG + Intergenic
1084824347 11:71718159-71718181 GGTTAAATGAATAATGGGGCCGG + Intergenic
1085792768 11:79510308-79510330 TGTTAAATGAATGATGAGCAAGG + Intergenic
1086360532 11:86054373-86054395 TCTAAAATGAAGACGGAGGATGG + Intronic
1086515024 11:87601833-87601855 GGTTAAATGGAGAAGGACGAGGG - Intergenic
1086555446 11:88105176-88105198 TGTTAAATTACTATAGAGGAAGG - Intergenic
1086947844 11:92860903-92860925 AGTTGAATGAATAAGGAGAGTGG - Intronic
1087419444 11:97902407-97902429 TTTTAAATGAACATGTAGGAAGG + Intergenic
1087607907 11:100399450-100399472 TGCTAAGTCAATAAAGAGGATGG + Intergenic
1088994988 11:114988344-114988366 TGTTAAATGAATAATGAATGAGG + Intergenic
1089036536 11:115399680-115399702 TGTTAAAAAAAGAATGAGGATGG - Intronic
1089182976 11:116595637-116595659 TGGGAAATCAATAAGGAGGCGGG + Intergenic
1089501086 11:118931585-118931607 TGTTGGATGAATAAGTAGGTGGG - Intronic
1089577592 11:119457568-119457590 TGTTAAATGACAAAGTAGGCCGG + Intergenic
1090534852 11:127629610-127629632 TGTTAAAAAAATAAGAAAGATGG + Intergenic
1090609783 11:128460557-128460579 AGTTGAAAGGATAAGGAGGAGGG - Exonic
1090937518 11:131357250-131357272 AATTAAATGAATAAGATGGATGG - Intergenic
1092519551 12:9253850-9253872 TGTAAGATGAATAAAGAGAAAGG - Intergenic
1092629911 12:10365980-10366002 TGTCAAAAGAATAAGGAGAATGG + Intergenic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093221003 12:16420662-16420684 TGTTAGATGAATAGGAAGAAAGG - Intronic
1095690985 12:45088186-45088208 TGTTTATTCACTAAGGAGGAAGG + Intergenic
1096173276 12:49491779-49491801 TTTTAAGTAAATAAGGAGAAAGG - Intronic
1097303530 12:58043651-58043673 TGTTATATGAATAGGGACCATGG + Intergenic
1097345726 12:58489682-58489704 TGTTATCTGAGTAAGCAGGAAGG + Intergenic
1097999462 12:65924342-65924364 TGTAAAATGAATATGGAAGAGGG + Intronic
1098293632 12:68982241-68982263 TAAAAAATAAATAAGGAGGAAGG - Intergenic
1098725008 12:73952737-73952759 TGTTAAATGCAAAAGGAAAAAGG - Intergenic
1100011621 12:89960783-89960805 TGTTTAATGAATAAGGAATTAGG + Intergenic
1100171883 12:91984398-91984420 TGTTAAATGAATTAGTGAGAGGG - Intergenic
1100811320 12:98341303-98341325 ATTTAAAGGGATAAGGAGGAAGG + Intergenic
1100938928 12:99703553-99703575 TGACACATGAATAAGGAGGGAGG - Intronic
1101205252 12:102480894-102480916 TATTAAAGGAATATGGGGGATGG + Intergenic
1101403621 12:104409689-104409711 TGTTAGCAGAAAAAGGAGGAAGG - Intergenic
1102083978 12:110121107-110121129 TGTTAAATGAATCAGGCGGCTGG + Intergenic
1104193689 12:126509507-126509529 TATAAAATTAATAAGGTGGAAGG + Intergenic
1104472094 12:129037371-129037393 TGTTGAATGAGTAAGCAAGATGG + Intergenic
1108056844 13:46493773-46493795 TGTTAAAGGAATAAACAGGCTGG - Intergenic
1108078358 13:46706095-46706117 TGTTAAAGAAATAAGGAAAAGGG + Intronic
1109380709 13:61556325-61556347 AGTCAAATGAATAAAGAGAATGG + Intergenic
1109411636 13:61977870-61977892 TGTAAAATGTAAAAGGAAGATGG + Intergenic
1110108526 13:71711670-71711692 TGTTAAAAGAATAAGCAATATGG + Intronic
1110153071 13:72278384-72278406 TGTTAAATACATAAAGAGAAAGG + Intergenic
1110578531 13:77090495-77090517 TTTTAAATGAAAAAGAAGAAAGG + Intronic
1110927167 13:81168320-81168342 TGTTAAAAAAAAAAGAAGGAAGG - Intergenic
1111454003 13:88455583-88455605 TGTTAAATAAATAAGGTGAAAGG + Intergenic
1111684921 13:91489952-91489974 TATTAAAAGAAAAAGGCGGAGGG + Intronic
1114447820 14:22802960-22802982 TGTTGAATGAAGAAGGGGGCAGG - Intronic
1116024463 14:39498116-39498138 AGGTAAATGAATAATGGGGATGG - Intergenic
1117055317 14:51906222-51906244 AGTTAAATAAAGAAGGAGGCAGG - Intronic
1117279221 14:54220848-54220870 TGTTCAATGAACAAGGAGCTAGG + Intergenic
1117480585 14:56140290-56140312 TTTTAAATGAATAAGTACAATGG - Intronic
1119153979 14:72391566-72391588 TGTTAAATGGATAAAGGAGATGG - Intronic
1120764802 14:88319121-88319143 TGTTCCATGAATATGAAGGAAGG + Intronic
1120765039 14:88321228-88321250 AGTTAATTGTCTAAGGAGGAGGG - Intronic
1120974021 14:90233255-90233277 TGATAAAGGAAAAAGGAGGTAGG - Intergenic
1121006072 14:90491475-90491497 CGTTAAAAGAAGAAGAAGGAGGG + Intergenic
1121144603 14:91573594-91573616 TCTTAGATGAAAAGGGAGGAGGG + Intergenic
1121367026 14:93322414-93322436 TTTTAAATAAATAAGCAGGCTGG - Intronic
1121562488 14:94885610-94885632 TGTTAGATGAATCAGAAGCAGGG + Intergenic
1121843176 14:97151406-97151428 TCTTTAAAGAATAAGGAGGCTGG - Intergenic
1122169283 14:99858479-99858501 TGTAAAAGGAATGAGGAGGCTGG - Intronic
1123927622 15:25133850-25133872 TTTTACATGGACAAGGAGGAGGG - Intergenic
1124049342 15:26180439-26180461 TGATAAAGGAAGAAGGATGAGGG + Intergenic
1125146871 15:36480706-36480728 TGTTAAATAAATGAGAAGCAAGG - Intergenic
1126593804 15:50366121-50366143 TGTAAAATGAATAAGAAGTTTGG - Intergenic
1127254153 15:57274338-57274360 TATTTAATGAATAAGAATGAGGG + Intronic
1127917719 15:63468942-63468964 GGATAAATGAATAAAAAGGAAGG + Intergenic
1127975539 15:63994400-63994422 TGTTAAAAGAAAAGGAAGGAAGG + Intronic
1128616264 15:69112798-69112820 TGTCAGGGGAATAAGGAGGAAGG - Intergenic
1128706941 15:69843386-69843408 AGTCAAGTGAATCAGGAGGAGGG + Intergenic
1129143568 15:73625768-73625790 TTTTAAATTAATAAGTAGCAAGG + Intronic
1129670098 15:77602926-77602948 TGTTCAATGAATAAGTGGGAAGG + Intergenic
1129759064 15:78118120-78118142 TGTTAAATGAAAAAAGCAGAAGG + Intronic
1130778857 15:87013571-87013593 GGTTGAATAAATAAGTAGGAAGG + Intronic
1131020134 15:89090487-89090509 TGTTAAATGAATTTGGGGGTGGG - Intronic
1131915012 15:97255449-97255471 TGTTAAGTAAATAAGAAGGTAGG - Intergenic
1132050770 15:98606070-98606092 GAATAAATGAATGAGGAGGAAGG - Intergenic
1132110472 15:99099061-99099083 TATTATATGGATAAGGAGGTGGG + Intronic
1133471577 16:6081071-6081093 TTTTAAATGAATGTGGAGCATGG + Intronic
1135243441 16:20831900-20831922 TGTTACATGAATATGGGGAAGGG - Intronic
1135559533 16:23465295-23465317 TGTTAAGTGAATGAAGAGGTAGG + Exonic
1135718637 16:24795114-24795136 TGACAGGTGAATAAGGAGGATGG - Intronic
1137309063 16:47235293-47235315 TGGTAACTAAATAAGGAGGTGGG + Intronic
1137714529 16:50590489-50590511 TGTTAAATAAATAAAAATGAAGG - Intronic
1138747671 16:59382408-59382430 TTTTAAATGAGTACAGAGGAAGG - Intergenic
1140117110 16:72051448-72051470 TTTTAAAATATTAAGGAGGAGGG - Intronic
1140119209 16:72068809-72068831 TTTTAAATAAAAAAGCAGGAAGG + Intronic
1141219272 16:82054171-82054193 GGTTAAGTGATTAAGGAGAAAGG - Intronic
1141258465 16:82427209-82427231 TGTCAAATAAAAAAGAAGGATGG + Intergenic
1141609718 16:85174531-85174553 TGTTGAATGAATGGGAAGGAGGG - Intronic
1141857658 16:86694838-86694860 TGTAAAATGATTAAGGATCATGG - Intergenic
1146479251 17:33191515-33191537 TGTTAAAAGAAGAAGAAGAAGGG + Intronic
1146527506 17:33579449-33579471 TGTTGAATGAATAAACTGGATGG - Intronic
1147303208 17:39546095-39546117 TGTTCCATAAAAAAGGAGGAAGG - Intronic
1150463751 17:65374263-65374285 TGTTAAATGAATAAACAAAAAGG + Intergenic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1152508207 17:80767075-80767097 TGTTAAAAGAATAAGGGGCCAGG + Intronic
1155192206 18:23439990-23440012 TGATATGTGAATACGGAGGAAGG - Intergenic
1157123705 18:44935782-44935804 AGTTAAATGAATGAGGAGAGAGG - Intronic
1157466856 18:47954723-47954745 TGTTAAATGAAGATGAAGCAAGG - Intergenic
1157765369 18:50292621-50292643 GGTGAATTGAATAAGGAGCAGGG + Intergenic
1160142775 18:76340069-76340091 TGTAAAATGAAAATGGAGGGAGG - Intergenic
1160979047 19:1808030-1808052 TGTTGAATGACAAAGGTGGATGG - Intronic
1161904353 19:7144393-7144415 AAATAAATAAATAAGGAGGATGG - Intronic
1163284263 19:16336608-16336630 TGTTTAAAGAAAAAGGAGGGGGG - Intergenic
1164053810 19:21605476-21605498 CGTCAAAAGAATAAGGAGAATGG + Intergenic
1167823162 19:51948484-51948506 TGTTAAATAACTAAAGAGGCCGG - Intronic
925671266 2:6311998-6312020 TGTTGAATGAGTGGGGAGGAGGG - Intergenic
925989892 2:9246187-9246209 TTTTAAATGTCTAAGGAGTACGG - Intronic
925998050 2:9307831-9307853 TGTTTAATTAAAAAGGAGAAGGG - Intronic
926243789 2:11107204-11107226 TTTGAAATGATTAAGGAGGTGGG + Intergenic
927824771 2:26300620-26300642 TGTCAAAAGAATAAGGAAAATGG + Intergenic
928085416 2:28343351-28343373 TGTGAAATAAAAAAAGAGGAAGG - Intergenic
928667218 2:33561526-33561548 TGTTTAGGGAATAAGGAAGAAGG + Intronic
929388884 2:41444639-41444661 TGTTATATGCATAAATAGGATGG + Intergenic
930247370 2:48998259-48998281 TGGTATATTAATGAGGAGGAAGG + Intronic
930321395 2:49858751-49858773 TGTTATTTGATTAAGGAGTATGG - Intergenic
930389337 2:50740759-50740781 AGTTAAAAGGACAAGGAGGAAGG + Intronic
930398944 2:50858723-50858745 TTTTAAATGAAAAATCAGGAGGG + Intronic
931356841 2:61544670-61544692 TATTAAATAAATAAGTAGTAGGG - Intergenic
931801299 2:65760653-65760675 TGTTGAATAATTAAGGAGGGGGG - Intergenic
931924659 2:67058148-67058170 TGTTAAATAGATAAGGAGACAGG + Intergenic
932275469 2:70448771-70448793 TGTTACAGGCATAAGGATGAGGG + Exonic
932308875 2:70724138-70724160 TGTTAAATGAAAAAGGTGTTGGG + Intronic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
934079921 2:88458981-88459003 AGTCTAATGAAGAAGGAGGAGGG - Intergenic
935403233 2:102682150-102682172 TGTAGAATGAAACAGGAGGATGG - Intronic
936401944 2:112171316-112171338 AGTCAAATGGAGAAGGAGGAGGG + Intronic
936635802 2:114256144-114256166 TGTTAAATTATTTAGGAGGTTGG - Intergenic
937122484 2:119450586-119450608 TGCTCAAAGAAGAAGGAGGAAGG + Intronic
937641703 2:124219489-124219511 TGTTACCTGAAATAGGAGGATGG + Intronic
937669931 2:124527751-124527773 AGTTAAAGCAAAAAGGAGGAAGG + Intronic
938579770 2:132635521-132635543 TGTGAGAGGAATAGGGAGGAAGG + Intronic
938581506 2:132650697-132650719 TTTTAAAGGAAGGAGGAGGAAGG - Intronic
938953847 2:136281060-136281082 TGGTAAAGGAATTAGGAGCATGG + Intergenic
938964572 2:136376908-136376930 TATTAACTGAAAGAGGAGGAAGG - Intergenic
938990814 2:136627721-136627743 TGTTAAAGGAACTAAGAGGAAGG - Intergenic
939108270 2:137975368-137975390 TGTTATATGTAAAAGGAGGGGGG + Intronic
939609137 2:144288888-144288910 TGTTGAATGAATTAGAGGGAGGG + Intronic
940728672 2:157364266-157364288 TGATAACTGAATAAGGAAAATGG + Intergenic
941027438 2:160473488-160473510 TGTGCTATGATTAAGGAGGAAGG + Intronic
941467223 2:165842165-165842187 TGTTAAGTGAATAAAAAGTATGG + Intergenic
942668003 2:178342708-178342730 TTTTAAATGAAGTAAGAGGAAGG + Intronic
942957412 2:181789341-181789363 TGTAAAATGACTAAGGAAAATGG - Intergenic
943618370 2:190119431-190119453 TGTTAAAAGACTAAGGTGGGAGG - Intronic
943823241 2:192354740-192354762 TTTTCAATGAATAAGAGGGAGGG + Intergenic
944105231 2:196072483-196072505 TGTAAAAGGAAGAAGAAGGAAGG + Intergenic
944212158 2:197217779-197217801 CGTTAAATGAATGAGTTGGAAGG + Intronic
944214812 2:197244349-197244371 TGCTAAATTAATAAGAAGGTGGG - Intronic
945407877 2:209471656-209471678 TAATAAAAGAATAAAGAGGAAGG + Intronic
945871247 2:215228708-215228730 TGTTAAAGGAAAAAGTAGCATGG - Intergenic
945898383 2:215510844-215510866 TTTTAAATGAATACAGAGGCTGG - Intergenic
946087697 2:217190796-217190818 GGTTACATGAATACAGAGGAGGG + Intergenic
946419453 2:219556802-219556824 TGTTAAATGACTGGGGACGAGGG - Intronic
947483218 2:230522356-230522378 TGTTAAATGAGAAAGTGGGATGG + Intronic
948164152 2:235848366-235848388 AGGTAAATGAATAAGGAACAAGG + Intronic
948384684 2:237574213-237574235 TGTTAAGTAAATAAGGAAGCAGG - Intergenic
1171099100 20:22365619-22365641 TGTTAAAACAATCAGGATGAGGG + Intergenic
1171108342 20:22457450-22457472 TGTTAAAGCAAAAGGGAGGAAGG + Intergenic
1173737304 20:45371334-45371356 TGTAAAATGGATAGGGGGGACGG - Intronic
1174888392 20:54361640-54361662 TGGTGAATGGATAAAGAGGAAGG - Intergenic
1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG + Intergenic
1179317555 21:40257897-40257919 TGTGAAAAGAATAAGGAGAAAGG - Intronic
1179863621 21:44204368-44204390 TGGCAGATGAATGAGGAGGAGGG - Intergenic
1180550602 22:16533642-16533664 TATTAAATAAATAAATAGGATGG + Intergenic
1180758335 22:18178948-18178970 TGTGAAATCACTAAGGCGGACGG + Intergenic
1181367042 22:22385813-22385835 TGTTATATGATAAAGGAGAAAGG + Intergenic
1181381619 22:22508904-22508926 GGTTAAATTGAGAAGGAGGAGGG + Exonic
1181974041 22:26715422-26715444 TGTTAAATAAATAAAGAAAAGGG - Intergenic
1184064634 22:42110825-42110847 TTTTAAATAAAAAAGCAGGAAGG - Intergenic
1184303817 22:43580705-43580727 TGTTGAATGAATAAGCAGTAGGG - Intronic
949246235 3:1927872-1927894 TGTCACATGAAAAAGGAGAAAGG + Intergenic
949254849 3:2033787-2033809 TGTTAAAAGAAAAAAGAGGTTGG + Intergenic
949333034 3:2943479-2943501 TGTTAAATCAAGAACGAAGATGG - Intronic
951897862 3:27627539-27627561 TATTAAAAGAAAAAGGAGGCCGG + Intergenic
952401576 3:32968316-32968338 TGTCAAAAGAATAAGGAGAATGG + Intergenic
954193184 3:48979215-48979237 TGTTAGATTAATAAGGCGCATGG + Intronic
954225731 3:49179839-49179861 TGTTAAATCAATAAACAGGCTGG + Intronic
954646477 3:52134833-52134855 TGTCCTATGGATAAGGAGGATGG - Intronic
955087232 3:55715073-55715095 TTTTAAAAGATTAAGGTGGAAGG - Intronic
955531525 3:59877934-59877956 TGTTAAAAGATTTAGTAGGATGG + Intronic
956117722 3:65935301-65935323 TGTGGAATGAATAAGAAGAATGG + Intronic
957183564 3:76913096-76913118 TTTTAAATTAATAAGGTGGGAGG + Intronic
957889038 3:86331019-86331041 TGGTTAATAGATAAGGAGGATGG + Intergenic
959403811 3:105936299-105936321 AGGTAACTGAATCAGGAGGATGG - Intergenic
959611331 3:108298194-108298216 TGACAGAAGAATAAGGAGGAAGG - Intronic
959675132 3:109026219-109026241 TGCAAAAGGAAAAAGGAGGATGG + Intronic
959961625 3:112304542-112304564 TGTCAAAAGAATAAGGAAAATGG + Intergenic
960110621 3:113841227-113841249 TGTTAAATGGAGAAGCAGTAGGG + Intronic
960245109 3:115391715-115391737 TGTTAAAGGAAGAAGAAGGAAGG - Intergenic
961896436 3:130171943-130171965 GGTTAAATGAATAATGGGGCCGG - Intergenic
962090294 3:132237366-132237388 TGTTAAGTGAATAATGAAAAGGG - Intronic
962733706 3:138305426-138305448 TGTTACTTGAAGAGGGAGGAAGG - Intronic
963421906 3:145072063-145072085 GGTAAAATGAGTAAGGAGTAGGG + Intergenic
964704779 3:159606593-159606615 AGTTCAAGGAATAAGAAGGATGG + Intronic
965070490 3:163910764-163910786 TGTGAAATGAATAATGTGGAGGG - Intergenic
965991599 3:174825659-174825681 TGTTTAAGGAATAGGGAAGAAGG - Intronic
966690839 3:182739997-182740019 AGTCAATGGAATAAGGAGGAAGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967534657 3:190588429-190588451 TGGAAAATGAATAATGAAGATGG - Intronic
967931455 3:194693374-194693396 TGTGAACTGGAGAAGGAGGAAGG - Intergenic
969006620 4:4025403-4025425 GGTTAAATGAATAATGGGGCCGG - Intergenic
969806356 4:9612005-9612027 TATTAAATGAATAATGGGGCTGG + Intergenic
970090841 4:12406128-12406150 TGTAAGATGAGTAATGAGGAGGG + Intergenic
970267775 4:14308047-14308069 TGGTAAATGAGAAAGGAAGAAGG - Intergenic
970664889 4:18325657-18325679 TATTAAAAGATTAAGAAGGATGG - Intergenic
972487828 4:39559130-39559152 TCTAAAATGATTAAGGAGCATGG - Intronic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972801435 4:42479768-42479790 AGTAAAATGAATAAGAGGGATGG + Intronic
973016195 4:45141704-45141726 TGTTTAATGAATTTGGAGGGAGG + Intergenic
973948375 4:55984670-55984692 TTTTTAATGAATAACAAGGATGG + Intronic
974543030 4:63263731-63263753 GATTAAAAGAAAAAGGAGGAGGG + Intergenic
975241955 4:72070407-72070429 TTTTAAAGGAAAAATGAGGAGGG + Intronic
977466376 4:97387043-97387065 TGATGAATGATGAAGGAGGAAGG + Intronic
978015809 4:103744656-103744678 TGTTGAATGAAAAAGCAGGTGGG + Intergenic
978066569 4:104411561-104411583 TGTTAAATGAATGGGAAGCAGGG - Intergenic
978105588 4:104898334-104898356 TATTAAATGAATGAAGATGATGG + Intergenic
978191452 4:105917407-105917429 TGTTAAAAGAATACAGAAGAAGG - Intronic
978516151 4:109570364-109570386 TGTTAAATGAATGAGGTATAAGG + Intronic
978686311 4:111448491-111448513 ATTTAAAGGAATAGGGAGGATGG + Intergenic
978758747 4:112332217-112332239 TGGTTTATCAATAAGGAGGAAGG + Intronic
978946170 4:114500229-114500251 TGTTAAATTAATAAGCAGTTTGG - Intergenic
978988530 4:115047626-115047648 TTTTAATTTAATAATGAGGATGG + Intronic
979657819 4:123217309-123217331 TGTTAAATAGAAAAGGTGGAGGG + Intronic
979925498 4:126557855-126557877 TGTTAAATGCATAACGCTGAGGG - Intergenic
980101200 4:128543063-128543085 TGTTAAATACCTAAGGAAGAAGG - Intergenic
980547741 4:134290811-134290833 TGTTAAAAAAATGTGGAGGATGG - Intergenic
980641659 4:135587742-135587764 TTTTAAATGAAAAAAAAGGAGGG - Intergenic
980831075 4:138129762-138129784 TGCTAAATGGAAAAGCAGGAGGG + Intergenic
982377400 4:154708481-154708503 GGTTTTATGAATAAGAAGGATGG - Intronic
985419318 4:189767863-189767885 TGAGAAATTTATAAGGAGGAAGG + Intergenic
988921564 5:35947088-35947110 TTTTAAATGAAAAATGAAGAGGG + Intergenic
992249531 5:74864149-74864171 GTTTAATTTAATAAGGAGGATGG + Intronic
992615536 5:78543052-78543074 TGTTAAAGGAATAGGCAGCATGG + Intronic
992870674 5:81002402-81002424 TTTTAAACGAATAATGATGAGGG + Intronic
993631516 5:90291890-90291912 TGTTACATGAATAATGTAGAAGG + Intergenic
995269997 5:110209021-110209043 TGTTAGTTTAATAAGGAGAATGG + Intergenic
995481006 5:112592643-112592665 TGTTGGATGAATAAAGAGAAGGG + Intergenic
995775997 5:115725577-115725599 TGTTACATGATAAAGGAGAAAGG + Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
996206129 5:120738493-120738515 TATTAAATGAACAAAGTGGAAGG - Intergenic
996447436 5:123571970-123571992 TTTTAAAGGAAAAATGAGGAGGG + Intronic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
998678001 5:144431206-144431228 TGTTAAATGGATATGCAGGTAGG - Intronic
999071433 5:148747763-148747785 TGCTAAAAGAATTAAGAGGAGGG + Intergenic
1000752717 5:165116737-165116759 AGATAAATGAATCATGAGGATGG + Intergenic
1000890518 5:166796243-166796265 TGCATAATGAATAAGGAGTAGGG + Intergenic
1001060153 5:168481430-168481452 TCTTAATTGAATGAGTAGGAAGG - Intergenic
1003119908 6:3310762-3310784 TGTTAAGTGAATTGGCAGGAAGG - Intronic
1003779484 6:9407478-9407500 AGTTAAATGAAAATGGAAGATGG - Intergenic
1004963712 6:20822640-20822662 AGGTAAATGAATTATGAGGATGG + Intronic
1006050168 6:31336070-31336092 TTTTAGATGACAAAGGAGGATGG + Intronic
1006205840 6:32342000-32342022 TGTGACAGGAATGAGGAGGAGGG - Intronic
1007005027 6:38353380-38353402 TGAAAAATGAATAAGGGAGAGGG + Intronic
1007465141 6:42046394-42046416 TGGTAGATGAGTAAGGAAGATGG - Intronic
1007754240 6:44088544-44088566 ATTTAAATGAAGAAGGAGGCTGG - Intergenic
1008117604 6:47570281-47570303 GATTTAATGAAGAAGGAGGAGGG + Intronic
1008246455 6:49179992-49180014 TTCTAAATGCATAGGGAGGAAGG - Intergenic
1008588751 6:52972150-52972172 TGTAAAATGATTAAGGAGGGAGG + Intergenic
1009311376 6:62157053-62157075 TCTTAAAAGAATAAGAATGAGGG + Intronic
1009420047 6:63455439-63455461 TTTTAAATGAAAAAAGAAGAGGG - Intergenic
1011069380 6:83363783-83363805 TGTCACATGATAAAGGAGGAAGG - Intronic
1012301173 6:97590270-97590292 AACTATATGAATAAGGAGGAAGG - Intergenic
1012662470 6:101919640-101919662 TGTTAAGTGATTAAGGAAGAAGG + Intronic
1013277519 6:108600020-108600042 TTTTATATGTATAAGGAGGGTGG + Intronic
1013612716 6:111810148-111810170 TGATAAATGATTAAGGATTAAGG + Intronic
1014188718 6:118466794-118466816 TGTAAAATGGATTAGGGGGAGGG + Intronic
1014512028 6:122334504-122334526 TGATAAATGAACAAGGATAATGG + Intergenic
1014674927 6:124351919-124351941 TGTTAAAATAATAAGCAGTAGGG - Intronic
1014686850 6:124512397-124512419 CATTAAATGTAAAAGGAGGAAGG + Intronic
1014905944 6:127027364-127027386 TGTTAAGTAAATAATGAGTATGG - Intergenic
1015445283 6:133296745-133296767 TGATGAATGAAAAAGGAGAAAGG - Intronic
1018422198 6:163649167-163649189 TGTTAAATTAACAAGGAGCGAGG - Intergenic
1018592003 6:165436450-165436472 GGTTAAATGAACAAGGAGGAAGG + Intronic
1018920673 6:168170353-168170375 TTTTAAAGGAAAAATGAGGATGG - Intergenic
1019642469 7:2111465-2111487 AGATCAATGAAAAAGGAGGAAGG + Intronic
1019872533 7:3778776-3778798 TGTAAACTGAATAAGGTTGAAGG + Intronic
1021132671 7:16930039-16930061 TGTTACATGTGAAAGGAGGAGGG - Intergenic
1023732047 7:43201410-43201432 TGTTAACACAAAAAGGAGGAAGG + Intronic
1024902175 7:54332464-54332486 TGTCAAATGAATGAGCTGGATGG - Intergenic
1024947789 7:54828548-54828570 TGTAAAATGCATTTGGAGGATGG - Intergenic
1027457504 7:78411835-78411857 ATTTAAATGAATAAGGAGAAAGG + Intronic
1027619316 7:80463779-80463801 TGTTAACTGAATAGAGAGGCAGG + Intronic
1027650270 7:80858163-80858185 AGTTATTTGTATAAGGAGGAAGG + Intronic
1028163294 7:87509893-87509915 TCTTAACTGAAGAAGAAGGAGGG + Intronic
1028941539 7:96527172-96527194 AGTGAAATGAGAAAGGAGGATGG + Intronic
1029236860 7:99127316-99127338 TGTTAAAAGAAAAAGAGGGAGGG + Intronic
1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG + Intergenic
1030886762 7:114948110-114948132 TATTGAATTAATAAGGGGGAGGG + Intronic
1031647662 7:124246336-124246358 TTTTAAATGAAAGAGGAAGAAGG - Intergenic
1032412637 7:131709149-131709171 TAATAAATGAAGAAGGAAGAAGG - Intergenic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1032924329 7:136585678-136585700 TAGTAAATAAAAAAGGAGGAAGG + Intergenic
1033646756 7:143310851-143310873 TGCTTAAAGAATAAGGAGGCTGG + Intergenic
1034297739 7:149989133-149989155 TTTTAAATGAACATGGAGGTTGG - Intergenic
1034384140 7:150724291-150724313 TCTTAAAGAAATAAAGAGGAGGG - Intronic
1034808283 7:154107720-154107742 TTTTAAATGAACATGGAGGTTGG + Intronic
1035979822 8:4357765-4357787 AATGAAAAGAATAAGGAGGATGG + Intronic
1036369493 8:8150506-8150528 GGTTAAATGAATAATGGGGCCGG + Intergenic
1036518260 8:9466596-9466618 TGTTAAATCAACAAGAATGAGGG + Intergenic
1036881395 8:12515139-12515161 GGTTAAATGAATAATGGGGCCGG - Intergenic
1037460987 8:19109435-19109457 TGTGGAAGGAATATGGAGGATGG - Intergenic
1037680749 8:21095568-21095590 TGTTAAGTGTATAAGCAGTATGG - Intergenic
1038663535 8:29517791-29517813 GGTAAAATGAATAAAGAAGAAGG + Intergenic
1038783167 8:30586132-30586154 TGTTAAAGGAAAAGGGAGGAAGG - Intronic
1039227960 8:35410480-35410502 ACTTAAATGAGAAAGGAGGAGGG - Intronic
1039330626 8:36533024-36533046 TGTCACATGAAAAAGGAGAAAGG - Intergenic
1039732918 8:40299352-40299374 TGTCAAATGAGTTAAGAGGAAGG - Intergenic
1040623746 8:49120078-49120100 TCTTAAAAGAATGAGGTGGAAGG - Intergenic
1042124720 8:65526795-65526817 TGTTAAATGGACAAGGATGAGGG - Intergenic
1042353197 8:67799103-67799125 GCTTAAAGGAATAAGGGGGAGGG - Intergenic
1042435675 8:68761824-68761846 TGTTAAAGAAAAAAGGAGGCAGG - Intronic
1042465280 8:69122684-69122706 TGTTATGTGAAAAAGGATGATGG + Intergenic
1042846039 8:73170420-73170442 TGTGATATGAGGAAGGAGGAAGG - Intergenic
1043114194 8:76228650-76228672 TAATAAATAAATAATGAGGAAGG + Intergenic
1043408656 8:79968049-79968071 TGATAAGTAAATAAGCAGGAAGG - Intronic
1043704680 8:83333143-83333165 TATGAAATGAAGAAGGAAGAGGG + Intergenic
1044153589 8:88814781-88814803 TGTAAAATGAACAATGGGGAAGG + Intergenic
1045231817 8:100313102-100313124 TGTTAAATGAATTAGAAGAGAGG - Intronic
1045904638 8:107329741-107329763 TGCTAAATGAATAAGGAACTGGG - Intronic
1046245528 8:111555957-111555979 TGTTAAATTACTGAGGATGATGG + Intergenic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1047427101 8:124756499-124756521 TGTTTTATAAATAAGGATGAAGG + Intergenic
1047587889 8:126293981-126294003 TGTGAATTTAAGAAGGAGGAGGG + Intergenic
1047790882 8:128202466-128202488 TGTTAACACAAGAAGGAGGAAGG + Intergenic
1048114970 8:131511010-131511032 TGTTGAATGAATAAAATGGAAGG + Intergenic
1050120193 9:2299968-2299990 AGCAAAATGGATAAGGAGGATGG + Intergenic
1051741333 9:20255171-20255193 TGGTAAGTGATTAAGGATGATGG - Intergenic
1052108400 9:24548101-24548123 TGTAAAAGGAATAACAAGGAAGG + Intergenic
1052528041 9:29646670-29646692 TGTTAAATGAAAAAGTAGAATGG - Intergenic
1053649994 9:40157908-40157930 TGTTTAATGAATTTGGAGGGAGG - Intergenic
1053755746 9:41306019-41306041 TGTTTAATGAATTTGGAGGGAGG + Intergenic
1054330502 9:63749666-63749688 TGTTTAATGAATTTGGAGGGAGG - Intergenic
1054534587 9:66218295-66218317 TGTTTAATGAATTTGGAGGGAGG + Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055946506 9:81695960-81695982 TGTTATGTGAATATGTAGGAAGG - Intergenic
1055969698 9:81899615-81899637 TGAGAAATGAATATGGTGGATGG + Intergenic
1056102972 9:83317505-83317527 AGTTCAATGAATAATGAGAATGG - Intronic
1056317556 9:85405806-85405828 TGTTAATTGAATATTGAGTAAGG - Intergenic
1059624246 9:116044109-116044131 GGGTAAGTGAATAAGGTGGATGG + Intergenic
1059958229 9:119540660-119540682 TGTTAAGTGGAGAAGGAGTACGG + Intergenic
1060489501 9:124072112-124072134 GGGTAGATGAATAAGAAGGATGG + Intergenic
1202797883 9_KI270719v1_random:142584-142606 TGTTTAATGAATTTGGAGGGAGG - Intergenic
1186852515 X:13594229-13594251 TGTTCAATGAATAAAGTGGTAGG - Intronic
1187004190 X:15215766-15215788 AATTAAATGAACAAGGAGCAGGG - Intergenic
1187606407 X:20888225-20888247 AGTTAAATGAATAAGGAAAAAGG + Intergenic
1188305209 X:28553501-28553523 TAATAAAAGAATATGGAGGAGGG + Intergenic
1188408971 X:29847941-29847963 TTTTAAAAGAATAAGCAGAATGG - Intronic
1188603255 X:31995576-31995598 TGTTGAATGGAAAGGGAGGAGGG + Intronic
1188825600 X:34829756-34829778 TTTTAAATGAAAAAGAATGAAGG + Intergenic
1189450693 X:41126430-41126452 TATAAAATGAAAAAGGAAGAGGG - Intronic
1189546143 X:42044661-42044683 TGTTAAACGGATAAGTGGGAGGG - Intergenic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1189907426 X:45775899-45775921 TGTAAAATGGCTAAGGCGGAAGG + Intergenic
1190342739 X:49310499-49310521 TGTCAAAAGAGTAAGGAGAATGG + Intronic
1191205651 X:57831333-57831355 AGTTAAATGAATAAGGAAAAAGG + Intergenic
1194703922 X:97151311-97151333 TGTAATATGAATAGTGAGGATGG + Intronic
1195571248 X:106400805-106400827 TGTTAAATGGAGAAGGAGTGGGG + Intergenic
1196546863 X:116973476-116973498 AGATAAATGAATCATGAGGATGG + Intergenic
1197278097 X:124503290-124503312 TGTTAAACAAATCAGGAGAAGGG - Intronic
1197292171 X:124672147-124672169 TGTTACATGACTAAGGGGAATGG - Intronic
1197419456 X:126220389-126220411 TTTTAAATAAATCAGTAGGAAGG + Intergenic
1197976643 X:132172604-132172626 TGCTAAAACAACAAGGAGGAGGG - Intergenic
1198464417 X:136892022-136892044 TGATAAATGATTAAGCTGGAGGG + Intergenic
1198912224 X:141627497-141627519 TGTTAAATGCATAAGCAGTGAGG - Intronic
1199215892 X:145259971-145259993 TGTGAAATGCATAGGAAGGAGGG - Intergenic
1202275538 Y:23115562-23115584 TGTTAAAATTAAAAGGAGGAAGG + Intergenic
1202290490 Y:23305129-23305151 TGTTAAAATTAAAAGGAGGAAGG - Intergenic
1202428530 Y:24749281-24749303 TGTTAAAATTAAAAGGAGGAAGG + Intergenic
1202442261 Y:24920808-24920830 TGTTAAAATTAAAAGGAGGAAGG - Intergenic