ID: 1151270022

View in Genome Browser
Species Human (GRCh38)
Location 17:72986826-72986848
Sequence GACCAGCCTCGCCAACATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5071
Summary {0: 2, 1: 70, 2: 982, 3: 1827, 4: 2190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151270016_1151270022 30 Left 1151270016 17:72986773-72986795 CCAAGCACTTTGGGAGGCTGAGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
Right 1151270022 17:72986826-72986848 GACCAGCCTCGCCAACATGAGGG 0: 2
1: 70
2: 982
3: 1827
4: 2190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151270022 Original CRISPR GACCAGCCTCGCCAACATGA GGG Intronic