ID: 1151270991

View in Genome Browser
Species Human (GRCh38)
Location 17:72995906-72995928
Sequence CTTGGTAACCAATTGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151270991 Original CRISPR CTTGGTAACCAATTGGATGT GGG (reversed) Intronic
904894436 1:33803622-33803644 CTTGGTAGCTGATTGGATGTGGG - Intronic
906300230 1:44676137-44676159 CTTGGTTACTAATTGGGTGTGGG + Intronic
906400643 1:45501846-45501868 CTTGGTGGCTGATTGGATGTGGG - Intronic
907150642 1:52284009-52284031 TTTGGTAACTAACTGGATATAGG + Intronic
907619184 1:55958984-55959006 TTTGGTAACCTCTTGGATCTTGG - Intergenic
910791213 1:91053206-91053228 TTTGGTAACTGATTAGATGTGGG - Intergenic
913340054 1:117749753-117749775 CTTGGTAATAGATTGGATGTGGG - Intergenic
913661613 1:121010230-121010252 ATTGGTGACCAATTGGATCTTGG - Intergenic
913996291 1:143653960-143653982 ATTGGTGACCAATTGGATTTTGG - Intergenic
914012983 1:143793410-143793432 ATTGGTGACCAATTGGATCTTGG - Intergenic
914164842 1:145167775-145167797 ATTGGTGACCAATTGGATCTTGG + Intergenic
914651608 1:149702019-149702041 ATTGGTGACCAATTGGATCTTGG - Intergenic
916662062 1:166931727-166931749 CTTGGTGACCAATTGGATGAGGG + Intronic
916829026 1:168472400-168472422 CTTGGTGACATATTGGATGGTGG - Intergenic
916896860 1:169172458-169172480 CTTGGTAAGCAAGGGGATGATGG + Intronic
916897696 1:169182487-169182509 CTTGGTAACAAATTAGATGGGGG - Intronic
917631114 1:176892409-176892431 CTTGGTGATAAAATGGATGTTGG + Intronic
917753642 1:178077521-178077543 CATGGTAACCGATTAGATTTTGG + Intergenic
918357660 1:183720860-183720882 CTTGGTAATTGATTGGATGTGGG + Intronic
918763371 1:188445061-188445083 ATTGGTAATCATCTGGATGTGGG + Intergenic
919064750 1:192679888-192679910 CTTGGTTACCAACTGGTAGTGGG - Intergenic
919986521 1:202679515-202679537 CTTGCTAACCAATTATAAGTGGG - Intronic
920093244 1:203469352-203469374 CTTGGTGCACAAATGGATGTGGG + Intergenic
921774236 1:219078737-219078759 CTTTGTCACCACTTGGATCTTGG - Intergenic
923178029 1:231487073-231487095 CTTGTTTACCAATTGCATATGGG - Intergenic
1064565649 10:16636381-16636403 TTTGGCAAAGAATTGGATGTAGG - Intronic
1065114544 10:22471924-22471946 CCTGGTCACCATTTGGATGTGGG - Intergenic
1072317339 10:94215545-94215567 CTTGGAAGCTAATTGGATGTGGG + Intronic
1072474967 10:95751334-95751356 TTTGGTAAACAATAAGATGTGGG + Intronic
1074807468 10:117067815-117067837 TTTGGTAACATATTGGATATGGG + Intronic
1079251028 11:18788108-18788130 ATTGGTAACTGATTGGATGTAGG - Intronic
1079675736 11:23224159-23224181 CTTGGTAATTAACTGGATGCAGG - Intergenic
1080115510 11:28617364-28617386 CCTGGCTACCAATTGGATGGTGG - Intergenic
1080778455 11:35408150-35408172 CTTGGTGACCAAGTGCAAGTAGG - Intronic
1085118268 11:73949583-73949605 CTTGGTGACCAGTTGGATTTGGG + Intergenic
1085736385 11:79042729-79042751 TTTGGTAACTAAATAGATGTGGG - Intronic
1086140415 11:83492712-83492734 TTTATTAACCAATTGGATGTGGG - Intronic
1086308911 11:85513860-85513882 CTTGGTAACTAATCAGATTTGGG - Intronic
1087015223 11:93548251-93548273 ATTTGTAATCATTTGGATGTGGG + Intergenic
1087847788 11:102993059-102993081 CTTGGTAATCAACTGAATGTGGG - Intergenic
1088052373 11:105533228-105533250 CGTGGTTAACAAATGGATGTGGG + Intergenic
1089488655 11:118867429-118867451 GTTGGAAACCAAGTGGATGTGGG - Intergenic
1089557849 11:119324718-119324740 CTTGGCAACCTCTTGGAGGTGGG + Intergenic
1089949772 11:122514851-122514873 CTTGCTGACTACTTGGATGTGGG + Intergenic
1090857523 11:130623378-130623400 GTTGGCAACCAATTGGTTTTAGG + Intergenic
1091805427 12:3352609-3352631 CTTGGTAAAGCATTGCATGTTGG - Intergenic
1092049895 12:5461025-5461047 CTTTCTAACCACTTGGATTTGGG + Intronic
1092720974 12:11440175-11440197 CTTGGTGACTGATTAGATGTGGG + Intronic
1092945477 12:13450393-13450415 CTTGGTGACCTAGTGTATGTAGG + Intergenic
1093724139 12:22483715-22483737 CTTTGTAATAAATTTGATGTGGG + Intronic
1095109799 12:38280706-38280728 CTTGCTAACAAAATGAATGTGGG - Intergenic
1095518158 12:43029846-43029868 CTTGATAACTGATTGGATTTGGG + Intergenic
1097484752 12:60182094-60182116 CGTGGTAGCCACTTGCATGTTGG - Intergenic
1098454587 12:70657786-70657808 AGTGGTAACAGATTGGATGTGGG - Intronic
1099237763 12:80102474-80102496 CTTGGTAATCAAGTGGACATAGG - Intergenic
1099709367 12:86201682-86201704 ATTTGTAACAAATTGGTTGTTGG + Intronic
1100657457 12:96661998-96662020 CTTGGTAACCAGTTGGAAGTGGG - Intronic
1100664408 12:96735669-96735691 TTTAATAACCAAGTGGATGTGGG + Intronic
1100850640 12:98706917-98706939 ATTGGCAAGTAATTGGATGTAGG - Intronic
1101287980 12:103336009-103336031 CTCAGTACCCAATTGGATGTTGG + Intronic
1106500488 13:30323699-30323721 CTTGGCAACCAATTGAATATGGG + Intergenic
1106529537 13:30576837-30576859 GTTGGTAATCGATTTGATGTGGG - Intronic
1106639163 13:31564894-31564916 TTTGCTAATGAATTGGATGTGGG + Intergenic
1112631692 13:101168532-101168554 TTTAGTGACAAATTGGATGTAGG - Intronic
1112824037 13:103371252-103371274 CTTGGTCTCAAATTGGATGTGGG + Intergenic
1114759703 14:25299609-25299631 CTTGATAGCCAATTGGATATGGG - Intergenic
1116224675 14:42134528-42134550 CTTAGTAACTAACTGAATGTTGG - Intergenic
1117490292 14:56240358-56240380 CTGGGTAAATGATTGGATGTGGG + Intronic
1117843674 14:59888275-59888297 CTTGGTACCCAATTGAATTCAGG + Intergenic
1119576311 14:75725861-75725883 CTAGTTAACCAATTGGCTGTGGG + Intronic
1120735381 14:88046607-88046629 CTTAGTAATAAATTGGATTTGGG + Intergenic
1121391043 14:93574833-93574855 CATGGTGACCTATTGGATGCTGG + Intronic
1121659704 14:95625574-95625596 CTTGGTGACACAGTGGATGTGGG + Intergenic
1126181825 15:45792856-45792878 CTTGGTGACTATTTGGATGTAGG + Intergenic
1126684143 15:51232656-51232678 CTTGCTGACAGATTGGATGTAGG - Intronic
1126856746 15:52846578-52846600 GTTGGAAACCTATTGGATGAAGG + Intergenic
1127069122 15:55270980-55271002 CTTGGTGGCCAATTGGAAGTGGG - Intronic
1128774912 15:70312984-70313006 CTTGGTAATTAACTGGCTGTTGG + Intergenic
1129103337 15:73286788-73286810 CTTGGTAAATAAATGGATGTAGG - Intronic
1129323057 15:74785436-74785458 CTTGGCACCCAACTGAATGTGGG + Intronic
1129447636 15:75629914-75629936 CTTGGTAGACAACTGAATGTAGG + Intergenic
1130075023 15:80681197-80681219 CTTGGGAACCACTGGGTTGTGGG + Intronic
1135149909 16:19996327-19996349 CTTGGGAATCAATTGCAAGTAGG - Intergenic
1136470844 16:30478960-30478982 CTTGGTAACCAGTTGGATAGAGG + Intronic
1138641386 16:58390786-58390808 TTTGGCAACCAATTGGATATAGG - Intronic
1141141763 16:81500975-81500997 CTTGCTAACCAATTGGCAGAGGG - Intronic
1143043190 17:4054934-4054956 CTTGGTGACCGACTGGATATAGG + Intronic
1144196694 17:12901575-12901597 CTTGGTAACTGAGTGGATGTGGG + Intronic
1144994501 17:19258087-19258109 CGTGTTAACCAGTTAGATGTGGG + Intronic
1145066345 17:19763957-19763979 CTTGGAGATCAATAGGATGTGGG - Intergenic
1147650703 17:42060216-42060238 CTTGGTGGCCAATGGGATGTGGG - Intronic
1148825161 17:50387650-50387672 CTTGCTGACAGATTGGATGTGGG + Intronic
1150497331 17:65618014-65618036 CTTGGTAACCAATTAGCTTGTGG - Intronic
1150796777 17:68245016-68245038 GTTGGTAACAAATTGGAAGGTGG - Intergenic
1151257523 17:72890428-72890450 CTTGGTAACTAAGTGGATTTGGG + Intronic
1151270991 17:72995906-72995928 CTTGGTAACCAATTGGATGTGGG - Intronic
1151844054 17:76638916-76638938 CTTGGCAACAAATAGGATGGTGG - Intronic
1153798105 18:8643309-8643331 CTTGAAGACCAATCGGATGTAGG - Intergenic
1155704989 18:28798787-28798809 CTTGGTAACTGATTGGATGTAGG + Intergenic
1156068785 18:33178282-33178304 CTTAGTCACTAATTGGATGTGGG - Intronic
1158330401 18:56356286-56356308 CTTGGTGTTGAATTGGATGTTGG - Intergenic
1159912671 18:74161379-74161401 CTTTGTGACCAAGTGCATGTGGG + Intergenic
1164426421 19:28145937-28145959 CTTGCAAACTGATTGGATGTGGG - Intergenic
1167583578 19:50360453-50360475 CTTGGAAACTTCTTGGATGTTGG + Intronic
1168495358 19:56843327-56843349 CTTGCTGATAAATTGGATGTTGG - Intergenic
926012722 2:9421905-9421927 CTTGGTGCCAGATTGGATGTGGG - Intronic
927304958 2:21560293-21560315 CTTTGTAAACAGTTGGAAGTTGG - Intergenic
928151765 2:28837273-28837295 CCTGGTAACCAGTTGGATATAGG + Intronic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
928762308 2:34599126-34599148 CTTGGTAATTATTTGGAGGTGGG + Intergenic
928826295 2:35425449-35425471 CATGGTAGCCAATTGGATGGAGG + Intergenic
928977235 2:37101041-37101063 GTTGGCAACTAATTGGATGTGGG - Exonic
929035503 2:37687837-37687859 CTTGGTGACTAATGGGATCTGGG - Intronic
930152447 2:48072302-48072324 CTTGGCAATCAGTTGGATGTAGG - Intergenic
930711558 2:54555440-54555462 TTTGGTAACTAACTGTATGTGGG - Intronic
931510363 2:62985062-62985084 CTTGGAAATCAACTGGATGTTGG - Intronic
931635909 2:64340697-64340719 CTTGGACAGCAATGGGATGTGGG + Intergenic
932088674 2:68785426-68785448 TTTGCTAATGAATTGGATGTGGG + Intronic
932921349 2:75918171-75918193 CTTGCTGACAAATTGGATATAGG - Intergenic
934890678 2:98066238-98066260 CTTGCTAACCAGTGGGATTTGGG - Intergenic
935357901 2:102221576-102221598 CTTGGCAACTCATTGGGTGTTGG - Intronic
935600003 2:104913071-104913093 ATTGCAAACCACTTGGATGTGGG + Intergenic
936018240 2:108975506-108975528 CTTGGTGACCAGATGGATGCCGG + Intronic
936932273 2:117802270-117802292 CTGGGTGACCAATTGGATATGGG - Intergenic
939214331 2:139216850-139216872 CTTGGAAACTAATTGGATATGGG + Intergenic
942665057 2:178308729-178308751 CTTGTTAACCTATTGAATGTGGG - Intronic
942677224 2:178440597-178440619 CATGGTAATTGATTGGATGTGGG - Intronic
943592280 2:189813220-189813242 CTTTGGAAACCATTGGATGTTGG + Intronic
944065980 2:195619294-195619316 CTTGGAAACCAATTAGCTATAGG + Intronic
945201659 2:207288011-207288033 CTTGGTATTCCATTGTATGTAGG - Intergenic
945309642 2:208296351-208296373 TTTGCTAATCAACTGGATGTAGG + Intronic
947256494 2:228171384-228171406 AATGGGAACCCATTGGATGTGGG - Intronic
1169712574 20:8581363-8581385 CTTGGCGACCATTTGGATATAGG + Intronic
1169865098 20:10191449-10191471 CTTGGTGATAAAATGGATGTGGG - Intergenic
1170516297 20:17133871-17133893 CTTAGCACCCAATTGGATGAGGG - Intergenic
1170858338 20:20078390-20078412 CTTGGCTACCAGTTGGATGGAGG + Intronic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1172396834 20:34613073-34613095 CTTGGTAACCGTCTGTATGTGGG - Intronic
1173630627 20:44511895-44511917 CCTGTTAACCAGTTGGAGGTTGG - Intronic
1173797465 20:45872253-45872275 CTTGTTAACATATTGGATGTAGG + Intronic
1173921201 20:46746749-46746771 TTTGCTAACAGATTGGATGTGGG - Intergenic
1176016402 20:62935965-62935987 CTTGGTAACCGGTTGGCTGTTGG + Intronic
1177643485 21:23873197-23873219 CTTATAAACCAATTGGATTTGGG + Intergenic
1177921124 21:27153869-27153891 CTTTGAAACCAAGTGGATGGAGG + Intergenic
1181711409 22:24694202-24694224 CTCGGTATCCACTTGGAGGTTGG + Intergenic
1182184156 22:28384657-28384679 CTTAGTGACTAATGGGATGTGGG - Intronic
1182668417 22:31975518-31975540 CTTTATAACCATTTGGATGAAGG + Intergenic
951581569 3:24170236-24170258 CTTGCTAATGAATTGGATTTAGG - Intronic
951805806 3:26642484-26642506 CTTCATAACCCATAGGATGTGGG + Intronic
954883926 3:53855598-53855620 GTTGTTAACCAAGTGGATGGGGG - Intronic
955982228 3:64538935-64538957 CTTAGAAACAAATTAGATGTCGG - Intronic
956763602 3:72465075-72465097 CTTGGTGATGAATTGGATATTGG + Intergenic
959228434 3:103616462-103616484 CTGGATAACTCATTGGATGTTGG + Intergenic
959386300 3:105712827-105712849 CTTGGTAACCAATAAAATTTTGG + Intronic
960788865 3:121404254-121404276 TTTGTTAACAAATTGGATTTAGG - Intronic
963111219 3:141689665-141689687 CTTCCTAACGGATTGGATGTAGG + Intergenic
963173578 3:142275929-142275951 CTTGGGAACCAACTGGATTTGGG + Intergenic
963837007 3:150067958-150067980 CTTGGTGTCCAGGTGGATGTTGG + Intergenic
966008893 3:175051821-175051843 CTTTGTAGCCAAATGGACGTGGG - Intronic
966916826 3:184588981-184589003 CTTGGTGACTGATGGGATGTGGG + Intronic
969999707 4:11352678-11352700 CTTGGTAACCATTTGAACTTGGG - Intergenic
971953763 4:33388709-33388731 CTTTCTAACCAATTTTATGTTGG - Intergenic
974348047 4:60707514-60707536 CTTGGTAATGAATAGGATATTGG - Intergenic
975196222 4:71527349-71527371 TTTGCTGACCAATTAGATGTGGG + Intronic
975593186 4:76020483-76020505 CTTAGTAAGTAATTGGATGTGGG + Intronic
976895187 4:90100804-90100826 CTTGGCAATCAATTGAATATAGG + Intergenic
980163794 4:129199774-129199796 CCTGGTAACTAACTGGATGTTGG - Intergenic
980239402 4:130153894-130153916 GTTGGTAAGGAAGTGGATGTAGG - Intergenic
981601433 4:146492885-146492907 CTTTTTAATCAATTGTATGTAGG - Intronic
982569925 4:157035918-157035940 CTTGGTATCCATTTTGATATGGG + Intergenic
983153404 4:164313819-164313841 CTTGGTAATGGATTGAATGTGGG - Intronic
983550635 4:169013945-169013967 CTTTGTGACTGATTGGATGTGGG - Intergenic
983631483 4:169853702-169853724 CTTGGTTAACAATATGATGTAGG + Intergenic
983875425 4:172869545-172869567 CTTGGGAACCAGACGGATGTGGG - Intronic
985184277 4:187298390-187298412 CCTGGTAACCAAGTGGATAATGG + Intergenic
987195156 5:15518579-15518601 CTTGGTGACGAATTGGCTGAAGG + Intronic
987274949 5:16352511-16352533 GTTGTTAAACAATTGGCTGTCGG - Intergenic
989808862 5:45647843-45647865 CTTGGTGATCAATTGGATATGGG - Intronic
990338774 5:54801825-54801847 CTTGGTAAGAAAATGGATGAAGG - Intergenic
990355011 5:54958366-54958388 TTTGGTGAGCAATTGGATGTGGG - Intergenic
991273478 5:64814934-64814956 CATGGTAACAGATTGGATGTAGG + Intronic
992917967 5:81478997-81479019 TTTGAAAACCAATTTGATGTTGG - Intronic
993379246 5:87187079-87187101 CTTGGTAATTGATTTGATGTGGG - Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
993486157 5:88488531-88488553 CTTTGTAACCTATTGGATGGAGG + Intergenic
993595638 5:89851737-89851759 CTTTGTAACTAATAGGATGTGGG + Intergenic
994694835 5:103061200-103061222 TTTGCTAACATATTGGATGTAGG - Intergenic
998254524 5:140574474-140574496 CTTGCTAGCCAAATGAATGTGGG + Intronic
998614080 5:143720339-143720361 CTTGACAACTGATTGGATGTGGG + Intergenic
1000485107 5:161831609-161831631 ATTGGAAACCAATTTGTTGTTGG - Intergenic
1002516061 5:179759931-179759953 CTTGGGTACCAGTTGTATGTAGG + Intronic
1002643786 5:180643228-180643250 CTTGGTGACCGATTGGCTGTGGG - Intronic
1003350178 6:5309254-5309276 CTTAGTAATGGATTGGATGTGGG + Intronic
1003965015 6:11244465-11244487 CTTGGCAGCTGATTGGATGTGGG - Intronic
1004535123 6:16492963-16492985 CTTGGAAACCGATGGAATGTGGG - Intronic
1004567453 6:16812235-16812257 CTTGGCAGCTAATTGTATGTGGG - Intergenic
1005830441 6:29666877-29666899 CTTAGTAACAAATGGGAGGTGGG - Intronic
1006095027 6:31650819-31650841 CTTGGAGACAAATTGCATGTGGG - Intronic
1007018823 6:38498094-38498116 GTTGGGAATCACTTGGATGTTGG - Intronic
1007538508 6:42618849-42618871 CTTGCTGACGAACTGGATGTCGG + Intronic
1008012961 6:46488761-46488783 ATTGGTCACCAAGTGGATGGTGG - Intronic
1008480328 6:51979079-51979101 CTTGGTTACCTATTGGACGCTGG - Intronic
1008906318 6:56681267-56681289 CTGTGTTACCAATTGGATGTGGG - Intronic
1009052133 6:58288987-58289009 CTTGTTAATGGATTGGATGTGGG + Intergenic
1009405930 6:63312821-63312843 CTTGGTAACTAGCTGGATATAGG + Intronic
1010738981 6:79477138-79477160 CTTGGTAATCAACTGAATGTGGG - Intergenic
1012637212 6:101558985-101559007 CTTGGTAACCAAAAGGAAGGTGG - Intronic
1013673802 6:112434737-112434759 CTTTTTAACAAATTGGATGTAGG - Intergenic
1014169743 6:118265712-118265734 TTTGGTAATCAATAGGATATAGG + Intronic
1014929472 6:127317733-127317755 CTTGGTAACTAACTGAGTGTGGG - Intronic
1015733901 6:136377029-136377051 CTTTCTTACCAACTGGATGTAGG + Intronic
1015847643 6:137537517-137537539 TTTGCTAATAAATTGGATGTGGG - Intergenic
1017368492 6:153674726-153674748 CTTGGTGAAAAATTGGAAGTGGG + Intergenic
1020334729 7:7054018-7054040 CTTGGAAACCAATTGAATGTGGG + Intergenic
1023150142 7:37194378-37194400 CTTGGTAACAGATTGGATATGGG - Intronic
1023752385 7:43385140-43385162 CTTGGTGACCGATTGGAAGAGGG - Intronic
1024719304 7:52117331-52117353 CTTTGTGATCAATTTGATGTAGG - Intergenic
1026197149 7:68183069-68183091 CTTGGTAATCAAATGCAGGTAGG - Intergenic
1027581778 7:80005695-80005717 GTTAGTCAGCAATTGGATGTAGG + Intergenic
1028835945 7:95375170-95375192 CTTGGTGACAAATTGGTTATGGG - Intronic
1028965493 7:96797158-96797180 CTTGGCAACTGATTGGATGTGGG - Intergenic
1030742986 7:113131689-113131711 CTTGGCAACTCATTGGAGGTGGG + Intergenic
1031590921 7:123591412-123591434 CTTAGTAACATATTGGCTGTGGG + Intronic
1032143139 7:129352618-129352640 CTTGCTAACGGATTGGACGTAGG - Intronic
1032434413 7:131888376-131888398 CTTGGTGACTAATTTGATGTGGG + Intergenic
1032552416 7:132796898-132796920 CTTTGTGACCAAGTGGATATGGG - Intronic
1033351709 7:140567520-140567542 TTTGGTAGCCAACTGAATGTTGG - Intronic
1041211121 8:55552074-55552096 TTTGGTAATTGATTGGATGTTGG - Intergenic
1041556776 8:59165943-59165965 CTTTGTGACCAGTTGGATGAAGG + Intergenic
1041618253 8:59933487-59933509 CTTGTTAGCCAATTGGATGTAGG + Intergenic
1042157087 8:65855964-65855986 CTTTGTAACTGATTGGATGTGGG - Intergenic
1042172469 8:66005441-66005463 CTTGAGAGCCAATTAGATGTAGG - Intergenic
1042413218 8:68488569-68488591 CTTGCTAATGGATTGGATGTGGG + Intronic
1042736158 8:71991935-71991957 ATTTGTGACCAGTTGGATGTGGG - Intronic
1042927293 8:73978858-73978880 TTTGGTAAGTAATTGGAGGTGGG + Exonic
1043268972 8:78304733-78304755 CTTCGAAACCATTTCGATGTCGG + Intergenic
1043504068 8:80885714-80885736 CCTGGTGACCAACAGGATGTGGG + Intergenic
1044710290 8:95050859-95050881 CTTGATAACTAATTGGATTGTGG + Intronic
1044780549 8:95739382-95739404 CTAACTAATCAATTGGATGTAGG + Intergenic
1046661659 8:116954088-116954110 TTTGGTAAGTAATTGGATGTGGG + Intronic
1048778342 8:137972721-137972743 CTTGGTGATGGATTGGATGTAGG - Intergenic
1050346391 9:4692834-4692856 CTTGGTGGTCAATTTGATGTGGG + Intronic
1051339085 9:16094495-16094517 CCTGATGACCAATTTGATGTGGG + Intergenic
1055174983 9:73306592-73306614 CTTAGTATCCTATTAGATGTAGG - Intergenic
1055261845 9:74446297-74446319 CTTTTTAACCATTTGGGTGTAGG - Intergenic
1055398571 9:75899104-75899126 CTTGGTAACTAAATGGAAGTAGG + Intronic
1055441694 9:76342881-76342903 TTTGGGAACAAATTGAATGTGGG - Intronic
1056515527 9:87345734-87345756 CTTGGTGACTGATAGGATGTAGG - Intergenic
1056592188 9:87972749-87972771 ATTGCTGACCAACTGGATGTAGG + Intronic
1058057559 9:100464415-100464437 CTTGGTAACTGACTAGATGTGGG - Intronic
1058344961 9:103950263-103950285 CTTGATAAACAATTGGTTATGGG - Intergenic
1058594462 9:106600794-106600816 GTTGCTAAACAATTGGATGAAGG - Intergenic
1058750972 9:108037846-108037868 CTTGGGGATCACTTGGATGTGGG + Intergenic
1058871060 9:109202074-109202096 CTTGGTGACCAATTAGATGAGGG + Intronic
1060269203 9:122129030-122129052 CTTAGTAAACAATAGGATGAAGG + Intergenic
1060293815 9:122329629-122329651 CTTGGTGACTTATTGGATGAGGG - Intergenic
1186654479 X:11598118-11598140 CTTGATAACTGATTGGATGTAGG + Intronic
1192084240 X:68079869-68079891 CTTGGTGACTAAATGGATGTGGG - Intronic
1192326547 X:70137187-70137209 CCTGGTGATCAATTGGTTGTGGG + Intronic
1192608228 X:72542065-72542087 CATGGTGATCAATTGGCTGTTGG - Intronic
1193654483 X:84183266-84183288 TTTGGTAACTGATTAGATGTTGG - Intronic
1194161417 X:90457568-90457590 CCTGGTAACAGATTGGATGGTGG + Intergenic
1194640929 X:96403381-96403403 CTTGGTAACTCATATGATGTTGG + Intergenic
1195050313 X:101090804-101090826 CTTGGTGTCTCATTGGATGTGGG - Intronic
1195700878 X:107704718-107704740 CTGGGTAATGGATTGGATGTAGG + Intergenic
1196978681 X:121187723-121187745 TTTGTTAACCAAATGGATGTTGG + Intergenic
1197170692 X:123430536-123430558 CTTGGAGACCAATTGGCTGCCGG - Intronic
1197863977 X:130998727-130998749 CTTGGTGGTCAATTGAATGTGGG - Intergenic
1200275612 X:154729558-154729580 CTGGGTCACCAAATGCATGTGGG + Intronic
1200507706 Y:4035297-4035319 CCTGGTAACAGATTGGATGGTGG + Intergenic
1201337239 Y:12894091-12894113 CTTGGTAACCAACTGGCTGCTGG - Intergenic