ID: 1151274662

View in Genome Browser
Species Human (GRCh38)
Location 17:73025001-73025023
Sequence CTACCGCGCCTGGCCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1334
Summary {0: 1, 1: 1, 2: 35, 3: 237, 4: 1060}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151274656_1151274662 14 Left 1151274656 17:73024964-73024986 CCTCGGCCTCCCAAAATGCTGAG 0: 271
1: 11389
2: 148935
3: 285332
4: 216067
Right 1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG 0: 1
1: 1
2: 35
3: 237
4: 1060
1151274659_1151274662 5 Left 1151274659 17:73024973-73024995 CCCAAAATGCTGAGATTATAGGC 0: 121
1: 3549
2: 48716
3: 284460
4: 280432
Right 1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG 0: 1
1: 1
2: 35
3: 237
4: 1060
1151274653_1151274662 21 Left 1151274653 17:73024957-73024979 CCACCCACCTCGGCCTCCCAAAA 0: 1307
1: 33571
2: 122165
3: 174786
4: 181177
Right 1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG 0: 1
1: 1
2: 35
3: 237
4: 1060
1151274654_1151274662 18 Left 1151274654 17:73024960-73024982 CCCACCTCGGCCTCCCAAAATGC 0: 1616
1: 45615
2: 197574
3: 273535
4: 199244
Right 1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG 0: 1
1: 1
2: 35
3: 237
4: 1060
1151274655_1151274662 17 Left 1151274655 17:73024961-73024983 CCACCTCGGCCTCCCAAAATGCT 0: 3308
1: 98747
2: 190507
3: 136049
4: 84666
Right 1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG 0: 1
1: 1
2: 35
3: 237
4: 1060
1151274660_1151274662 4 Left 1151274660 17:73024974-73024996 CCAAAATGCTGAGATTATAGGCA 0: 85
1: 2170
2: 26686
3: 143898
4: 274389
Right 1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG 0: 1
1: 1
2: 35
3: 237
4: 1060
1151274657_1151274662 8 Left 1151274657 17:73024970-73024992 CCTCCCAAAATGCTGAGATTATA 0: 146
1: 4826
2: 64511
3: 359843
4: 253525
Right 1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG 0: 1
1: 1
2: 35
3: 237
4: 1060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151274662 Original CRISPR CTACCGCGCCTGGCCAAAAC TGG Intronic
900271451 1:1791460-1791482 CCACCGCGCCCGGCCATACCTGG + Intronic
900807897 1:4779855-4779877 CCACCGTGCCTGGCCTAAAACGG - Intronic
901230476 1:7639264-7639286 CCACCACGCCCGGCCCAAACTGG + Intronic
901406613 1:9051996-9052018 CCACCGCGCCTGGCCCAGATTGG - Intronic
901555236 1:10026555-10026577 CCACCGCGCCCGGCCAGAAACGG + Intergenic
901856713 1:12049117-12049139 CCACCGCGCCTGGCCAAGACAGG + Intergenic
902066971 1:13696477-13696499 CCACTGCGCCTGGCCAAGGCAGG + Intergenic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902312264 1:15590214-15590236 CCACCACGCCTGGCCCAATCTGG - Intronic
902345479 1:15813857-15813879 CCACCGCGCCTGGCCACACCTGG - Intergenic
902678539 1:18026775-18026797 CCACCGCACCTGGCCCCAACTGG + Intergenic
902815079 1:18911824-18911846 CCACTGCGCCTGGCCCAAAGGGG + Intronic
902868407 1:19296517-19296539 CCACCGCACCTGGCCACAAATGG + Intergenic
902874207 1:19331295-19331317 CCACCGCGCCCGGCCAAGATGGG + Intergenic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
902900860 1:19514984-19515006 CCACTGCGCCCGGCCAAAAGTGG - Intergenic
902915494 1:19636610-19636632 CCACTGCGCCTGGCCAAGAGTGG - Intronic
902985449 1:20151786-20151808 CCACCGCGCCTGGCCCAGAGCGG + Intergenic
903062714 1:20681477-20681499 CCACCGCGCCCAGCCAAAAGAGG + Intronic
903252893 1:22069461-22069483 CCACCACGCTTGGCCGAAACAGG + Intronic
903418776 1:23203184-23203206 CCACCGCGCCCGGCCAAATCTGG + Intergenic
903488426 1:23708904-23708926 CCACTGCGCCCGGCCAAGACAGG - Intergenic
903497974 1:23783740-23783762 CCACCACGCCTGGCCCATACTGG + Intronic
903563085 1:24243686-24243708 CCACCGCGCCTGGCCAAACTGGG - Intergenic
903640502 1:24856723-24856745 CCACCGTGCCCGGCCCAAACTGG + Intergenic
903941503 1:26934942-26934964 CCACCGCGCCCGGCCAGGACAGG + Intronic
903944679 1:26954509-26954531 CCACTGCGCCTGGCCAAATGTGG + Intronic
903961887 1:27063132-27063154 CCACCGCACCTGGCCAAGAAAGG - Intergenic
904112249 1:28135255-28135277 CCACCGTGCCTGGCCAGAAAAGG - Intergenic
904124713 1:28229958-28229980 CTACTCCGCCTGGCCAAGTCAGG - Intronic
904168810 1:28576602-28576624 CCACCGCGCCCGGCCGAGACGGG + Intronic
904467627 1:30717938-30717960 CCACCGCGCCCGGCCATAAAAGG + Intronic
904536974 1:31205944-31205966 CCACTGCACCTGGCCTAAACCGG - Intronic
904544634 1:31259394-31259416 CCACCGCGTCTGGCAAAACCAGG + Intergenic
904672373 1:32175495-32175517 CCACCGCGCCTGGCCAGATGTGG - Exonic
905041532 1:34964009-34964031 CCACCACGCCTGGCCAAGAGTGG - Intergenic
905136688 1:35805945-35805967 CCACCGCGCCCGGCCGGAACTGG - Intergenic
905825864 1:41025620-41025642 CCACCGCACCCGGCCAACACTGG - Intergenic
905960978 1:42041870-42041892 CCACTGCGCCTGGCCTAAAGAGG - Intergenic
906092316 1:43191298-43191320 CCACCACGCCCGGCCAAAAGAGG - Intronic
906111828 1:43329089-43329111 CCACCGCGCCTGGCCAAGCCGGG + Intergenic
906151365 1:43589567-43589589 CCACCGTGCCTGGCCAGAATCGG - Intronic
906173346 1:43747051-43747073 CCACTGCGCCTGGCCTAAAATGG + Intronic
906210356 1:44009508-44009530 CCACCGCGCCCGGCCAAGATGGG + Intronic
906224197 1:44107390-44107412 CCACCGCGCCTGGCTGAGACTGG + Intergenic
906233130 1:44182768-44182790 CCACCGCGCCTGGCCCAGAGAGG + Intergenic
906323461 1:44830390-44830412 CCACTGCGCCTGGCCAAGGCTGG - Intronic
906783097 1:48590115-48590137 CCACCGCGCCTGGCCGCTACTGG - Intronic
906998836 1:50828554-50828576 CCACCGCGCCCGGCCAAGAAGGG + Intronic
907028813 1:51150478-51150500 CCACCACGCCTGGCCATAAATGG + Intergenic
907162613 1:52382264-52382286 CAACCACGCCCGGCCTAAACTGG + Intronic
907174535 1:52506103-52506125 CTACTGCGCCTGGCCAATGAGGG + Intronic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907212655 1:52836971-52836993 CTACTGCGCCTGGCCTTAAATGG - Intergenic
907361275 1:53917536-53917558 CCACTGCGCCTGACCAAAAAAGG - Intronic
907895888 1:58690990-58691012 CCACCGCGCCTGGCCTCATCAGG - Intronic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908221330 1:62009795-62009817 CCACCAGGCCTGGCCAAAAGTGG - Intronic
908261629 1:62343691-62343713 CCACCACGCCCGGCCAAGACAGG + Intergenic
908391978 1:63691552-63691574 CCACCGCGCCTGGCTAAGAGAGG - Intergenic
908554113 1:65239944-65239966 CCACCGCGCCCGGCCTAAAATGG + Intergenic
908662896 1:66456116-66456138 CCACTGCGCCCGGCCAAAAATGG + Intergenic
908698311 1:66870154-66870176 CCACCGCGCCTGGCCATGGCCGG - Intronic
908731738 1:67233059-67233081 GCACCGCACCTGGACAAAACTGG - Intronic
908754354 1:67454465-67454487 CCACCACGCCTGGCCAAGAAGGG + Intergenic
909053893 1:70800148-70800170 CCACCGTGCCTGGCCAACATTGG + Intergenic
909613417 1:77577904-77577926 CCACCGTGCCCGGCCGAAACTGG + Intronic
909739356 1:79008503-79008525 CCACCGCTCCTGGCCACAAATGG + Intergenic
909739629 1:79011849-79011871 CCACCGCTCCTGGCCACAAATGG - Intergenic
909768670 1:79391360-79391382 CCACCGCGCCCGGCCAGAAAGGG - Intergenic
910596335 1:88984495-88984517 CTACCACGGCTGGCCTTAACTGG + Intronic
910779537 1:90913844-90913866 CCACTGCGCCTGGCCCAGACTGG + Intergenic
910887327 1:91978711-91978733 CCACCGCGCCGGGCCAGCACAGG - Intronic
910956616 1:92713486-92713508 CCACTGCGCCTGGCCAGAAAGGG - Intronic
910986226 1:93007598-93007620 CCACCGTGCCTGGCCAAGAGAGG - Intergenic
911125531 1:94337812-94337834 CCAACGCGCCCGGCCAAAAATGG - Intergenic
911128227 1:94361535-94361557 CCACCACACCTGGCCAAAACTGG + Intergenic
911345139 1:96688032-96688054 CCACTGCGCCTGGCCTAAAGTGG - Intergenic
911628525 1:100155898-100155920 CCACCACACCTGGCCAAAAGTGG - Intronic
911952899 1:104198805-104198827 CCACCGCGCCTGGCCTACAGTGG - Intergenic
912360167 1:109088694-109088716 CAACCGCGCCCGGCCAAAGGGGG + Intergenic
912464640 1:109863290-109863312 ACACCGCGCCTGGCCACAAGTGG + Intergenic
913283154 1:117204577-117204599 CCACCGCAACTGGCCAAAACAGG - Intronic
913970417 1:143411109-143411131 CCACCGCACCTGGCCAAGAAAGG - Intergenic
914064792 1:144236723-144236745 CCACCGCACCTGGCCAAGAAAGG - Intergenic
914114359 1:144729631-144729653 CCACCGCACCTGGCCAAGAAAGG + Intergenic
914421311 1:147530890-147530912 CCACCACGCCTGGCCAATATGGG - Intergenic
914424877 1:147566466-147566488 CCACCGCGCCTGGCCATGGCCGG - Intronic
914734524 1:150402677-150402699 CCACCGCGCCCGGCTGAAACGGG - Intronic
914780959 1:150784644-150784666 CCACTGCACCTGGTCAAAACAGG - Intergenic
915062867 1:153200991-153201013 CCACCGCGCCTAGCAAAAGCAGG + Intergenic
915310978 1:155005675-155005697 CTCCCGCCCTAGGCCAAAACAGG - Intronic
915459398 1:156060874-156060896 CCACCGCGCCTGGCCTCAAGTGG + Intergenic
915591393 1:156872962-156872984 CCACCGCGCCTGGCCCAGATTGG + Intronic
915705313 1:157838061-157838083 CCACCACGCCTGGCCTAATCTGG + Intronic
916202085 1:162281831-162281853 CCACCGCGCCCGGCCTAAAATGG - Intronic
916483104 1:165233165-165233187 CCGCCGTGCCCGGCCAAAACTGG - Intronic
916907808 1:169307730-169307752 CCACCGCGCCTGGCTTAAAATGG - Intronic
916943461 1:169700422-169700444 CCACCACACCTGGCCAAAACAGG + Intronic
916998145 1:170324019-170324041 CTACCACGCCCAGCGAAAACGGG - Intergenic
917035595 1:170744261-170744283 CCACCGCGCCTGGCCAAGACTGG + Intergenic
917084479 1:171292089-171292111 CCACCGCGCCCGGCCCAAAAAGG - Intergenic
917902241 1:179554199-179554221 CCACTGCGCCTGGCCTAAAATGG + Intronic
919070622 1:192751091-192751113 CCACCGCGCTTGGCCAATAAAGG + Intergenic
919614449 1:199787861-199787883 CCACCGCGCCCGGCCACAAATGG + Intergenic
919646500 1:200099877-200099899 CCACCGCGCCTGGCCACACCTGG + Intronic
919772978 1:201174562-201174584 CCACCGCGCCTGGCCCCCACAGG + Intergenic
919852817 1:201684987-201685009 CCACCGCGCCCGGCCAGAACTGG - Intronic
920332858 1:205223680-205223702 CCACGGCGCCTGGCCCAAACTGG - Intergenic
920512696 1:206562643-206562665 CCACCACGCCCGGCCAATACTGG - Intronic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
920914587 1:210249927-210249949 CCATCGTGCCTGGCCTAAACAGG - Intergenic
921118280 1:212114841-212114863 CCACCGCGCCCGGCCGATACAGG + Intergenic
921229988 1:213059956-213059978 CCACTGCGCCTGGCCACACCCGG + Intronic
921620714 1:217323487-217323509 CCACCGTGCCTGGCCAAGTCAGG - Intergenic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922010521 1:221579829-221579851 CCACCGCGCCCGGCCGGAACTGG + Intergenic
922296645 1:224255477-224255499 CCACCGCGCCTGGCCTAAAATGG + Intronic
922417485 1:225434753-225434775 CCACCGCACCTGGCCAGAATGGG - Intergenic
922513923 1:226192357-226192379 CCACCGCGCCCAGCCAAAAAAGG + Intergenic
922641193 1:227233644-227233666 CCACCGTGCCTGGCCCAAAATGG - Intronic
922773606 1:228204504-228204526 CTACTGTGCCTGGCCAGAAATGG - Intronic
922886852 1:229027094-229027116 CCACTGCGCCTGGCCAAGACGGG + Intergenic
923090206 1:230734999-230735021 CCATCGCGCCCGGCCATAACTGG + Intergenic
923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG + Intronic
924523138 1:244822731-244822753 CCACCGCGCCTGGCCCTAAGTGG - Intergenic
924536431 1:244939736-244939758 CCACCGCACCTGGCCTAAAGCGG + Intergenic
924687318 1:246307704-246307726 CCACCGCGCCCGGCCAAATTAGG + Intronic
924696539 1:246406209-246406231 CCACCGCGCCCAGCCAAAATGGG + Intronic
924725969 1:246670947-246670969 CCACTGCGCCTGGCCAGAAAGGG + Intergenic
924758077 1:246959711-246959733 CCACCGTGCCTGGCCCAAAATGG + Intronic
924852737 1:247846895-247846917 CTACCACGCCTGGCTAAATTTGG - Intergenic
1062785853 10:264105-264127 CCACCACGCCTGGCCACAAGTGG + Intergenic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1063976663 10:11423223-11423245 CTACCGCGCCTGGCCCCAACAGG + Intergenic
1064050131 10:12052784-12052806 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1064212331 10:13370514-13370536 CTACTGTGCCTGGCCTAAAATGG + Intergenic
1064260798 10:13784699-13784721 CCACCGCGCCTGGCCAATTATGG - Intronic
1064372937 10:14769671-14769693 CCACCGCGCCCGGCCACAATTGG + Intronic
1064525053 10:16246432-16246454 CAACCGTGCCTGGCCAAAATAGG + Intergenic
1064741905 10:18442435-18442457 CCACCACGCCTGGCCGAATCTGG + Intronic
1064751647 10:18536547-18536569 CTGCCATGCCTGGCCAGAACTGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065006279 10:21383209-21383231 CCACCGCGCCTGGCCAAAAGAGG + Intergenic
1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG + Intronic
1065278671 10:24112871-24112893 CCACCACGCCTGGCCATGACTGG + Intronic
1065731508 10:28713538-28713560 CCACCGCGCCTGGCCATAATGGG - Intergenic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066395315 10:35014999-35015021 CCACTGTGCCTGGCCAAAATAGG - Intronic
1066466467 10:35654540-35654562 CCACTGCGCCTGGCCAAGATAGG + Intergenic
1066559794 10:36657541-36657563 CCACTGCGCCTGGCCTAAATGGG + Intergenic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067411596 10:46069467-46069489 CCACTGCGCCCGGCCAAAAGTGG - Intergenic
1067499131 10:46786370-46786392 CCACCGCTTCTGGCCAAAAGAGG + Intergenic
1067595510 10:47553982-47554004 CCACCGCTTCTGGCCAAAAGAGG - Intergenic
1069333163 10:67317709-67317731 CCACCGCGCCTGGCCATCATCGG + Intronic
1069583528 10:69581265-69581287 CCACTGCGCCTGGCCAGAAAGGG + Intergenic
1070026816 10:72639816-72639838 CAACCACGCCTGGCCGAAAGGGG - Intergenic
1070121251 10:73579465-73579487 CCACTGCGCCTGGCCAAAATTGG - Intronic
1070978280 10:80623200-80623222 CCGCCGTGCCTGGCCGAAACTGG + Intronic
1071475577 10:86022628-86022650 CCACTGCACCTGGCCAAAAAAGG - Intronic
1071917587 10:90312619-90312641 CCACCGCGCCTGGCCATTTCTGG + Intergenic
1072593132 10:96845752-96845774 CCACCGCACCCGGCCAAAATGGG + Intronic
1072897758 10:99381452-99381474 CCACCGCGCCTGGCCTAAAGAGG - Intronic
1073003409 10:100302407-100302429 TTACTGCACCTGGCCAAACCTGG - Intronic
1073086859 10:100896600-100896622 CCACCGCACCTGGCCAAAGCTGG + Intergenic
1073246974 10:102097930-102097952 CCACCGCGCCTGGCCCAATGTGG + Intergenic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1073773847 10:106764734-106764756 CCACCGCGCCCGGCCAAGAATGG - Intronic
1074095555 10:110308837-110308859 CCACCGGGCCTGGCCAGAAATGG + Intergenic
1074144006 10:110700726-110700748 CCACCGTGCCTGGCCCAAAGAGG - Intronic
1074517157 10:114180749-114180771 CCACAGCGCCCAGCCAAAACCGG + Intronic
1074556641 10:114497390-114497412 CCACCGCGCCCGGCCAGAAATGG - Intronic
1074788892 10:116866534-116866556 CTACCACACTTGGCCAAGACAGG - Intronic
1075702570 10:124478760-124478782 CCACCGCGCCTGGCCCAAACTGG - Intronic
1075761004 10:124856562-124856584 CCACCGTGCCTGGCCAACTCTGG + Intergenic
1076774493 10:132687229-132687251 CCACCAAGCCTGGCCAACACTGG + Intronic
1077608456 11:3627985-3628007 CCACCGTGCCTGGCCAAATTTGG - Intergenic
1077630365 11:3807593-3807615 CTACCGCGCCTGGCCCTCACAGG + Intronic
1077813996 11:5667484-5667506 CCACCACACCTGGCCAAATCTGG + Intronic
1078208762 11:9253138-9253160 CTACCATACCTGGCCACAACAGG + Intronic
1078308049 11:10210723-10210745 CCACCGCGCCTGGCCACAAGAGG - Intronic
1078353580 11:10616016-10616038 CCACCGCGCCCAGCCAAAAGTGG - Intronic
1079072339 11:17357988-17358010 CTACCATGCCTGGCCAACAGTGG + Intronic
1079369233 11:19836268-19836290 CCACCGCGCCTGGCCCAGATCGG - Intronic
1079606460 11:22375083-22375105 CCACCGTGCCTGGCCACAAATGG - Intronic
1080104913 11:28501810-28501832 CCACCGCGCCTGGCCGAGCCAGG - Intergenic
1080519629 11:33056396-33056418 CCACCACACCTGGCCAATACTGG + Intronic
1080835513 11:35936970-35936992 CCACCACGCCTGGCCACAAATGG - Intergenic
1081112678 11:39156118-39156140 CCACCGTGCCCGGCCAACACAGG + Intergenic
1081125875 11:39320417-39320439 CCAACGCACCTGGCCAGAACTGG + Intergenic
1081932991 11:46885484-46885506 CCACCGCGCCTAGCCAAATCAGG - Intronic
1082023699 11:47555718-47555740 CTACCGCGCCTGGCCGACATTGG - Intronic
1082070221 11:47933606-47933628 CTACTGCACCTGGCCAAATCTGG - Intergenic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082916422 11:58443311-58443333 CCACCGCGCCTGGCCAAACTTGG - Intergenic
1083103122 11:60330624-60330646 CCACCGCGCCTGGCCAATTTTGG + Intergenic
1083371819 11:62188564-62188586 CCACTGCGCCTGGCCAGACCTGG + Intergenic
1083417475 11:62535045-62535067 CTCCCGAGCCTGGCCAGACCTGG - Exonic
1083554684 11:63616694-63616716 CCACCGCGCCCGGCCTATACTGG - Intronic
1083641142 11:64146055-64146077 CCACCGTGCCTGGCCAAGAATGG + Intronic
1083643505 11:64158528-64158550 CCACCACGCCTGGCCCAAAGTGG + Intronic
1083797939 11:65028804-65028826 CCACCGCGCCCGGCCACCACTGG - Intronic
1083822220 11:65179549-65179571 CCACCGCGCCTGTCAAAAAATGG - Intronic
1083937081 11:65875208-65875230 CCACCGCGCCCGGCCAATATAGG + Intergenic
1083951340 11:65958230-65958252 CCACCACGCCTGGCCAAATTGGG + Intronic
1083991436 11:66248330-66248352 CCACCGTGCCCGGCCAAAATAGG - Intergenic
1084050740 11:66597961-66597983 CCACTGCGCCTGGCCTAAATGGG - Intronic
1084053295 11:66615212-66615234 CCACCGGGCCTGGCCCATACTGG + Intergenic
1084378032 11:68791822-68791844 CCACCGCGCCTGGCCAGAATGGG + Intronic
1084960461 11:72713558-72713580 CCACCGCGCCTGGCCAGAGGTGG - Intronic
1084985829 11:72870611-72870633 CCACCGCACCTGGCCCAAAGGGG - Intronic
1085043689 11:73341597-73341619 CTACCGCGCCCGCCCGAAACTGG + Intronic
1085232767 11:74987524-74987546 CCACCGCGCCTGGCAATAATGGG - Intergenic
1085543635 11:77296770-77296792 CCACCGCACCCGGCCAAAAAAGG - Intronic
1085629940 11:78106482-78106504 CTACCGCGCCCGGCCAGCCCAGG + Intronic
1086091524 11:83009351-83009373 CCACCGCGCCCGGCCAAAAACGG + Intronic
1086204617 11:84242691-84242713 CCACCGCACCTGGCCAAAATAGG + Intronic
1086448198 11:86889979-86890001 CCACCGCACCTGGCCTCAACTGG - Intronic
1087236057 11:95719908-95719930 CCACCGCGCCTGGCCGGCACTGG - Intergenic
1088252366 11:107872096-107872118 CCACCGCGCCAAGCCAGAACTGG - Intronic
1088479791 11:110284808-110284830 CCACCACGCCCGGCCAACACAGG + Intronic
1088610034 11:111568096-111568118 CCACCACGCCTGGCCAAAATTGG - Intergenic
1088660531 11:112041593-112041615 CCATTGCGCCTGGCCAACACTGG - Intronic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1089486232 11:118848282-118848304 CCACCGCGCCCGGCAACAACTGG + Intergenic
1089590186 11:119535113-119535135 CCACCGCGCCTGGCCCAGACTGG + Intergenic
1089843668 11:121441234-121441256 CCACAGCGCCTGGCCAATAGAGG - Intergenic
1090582239 11:128173070-128173092 CCACCGCGCCCGGCCACAATGGG - Intergenic
1090772289 11:129931853-129931875 CCACTGCGCCTGGCCAAGTCCGG + Intronic
1090796629 11:130141191-130141213 CCACCGCGCCTGGTGTAAACGGG + Intronic
1091087428 11:132735768-132735790 CCACCGCACCTGGCCACAAAAGG + Intronic
1091432490 12:448330-448352 CCACCGCGCCCGGCCAAAGAGGG + Intergenic
1091491957 12:940309-940331 CCACCGCGCCCGGCCAACAGAGG - Intronic
1091497459 12:984950-984972 CCACCGCGCCTGTCCACACCAGG + Intronic
1091568882 12:1667381-1667403 CCACCACGCCTGGCCCACACTGG - Intergenic
1092139899 12:6176476-6176498 CCACCGCGCCCGGCCACACCTGG - Intergenic
1092200183 12:6577087-6577109 CCACCGCACCTGGCCCACACAGG + Intronic
1092338850 12:7658349-7658371 CCACCGTGCCCGGCCAAAATTGG + Intronic
1092685125 12:11034625-11034647 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092689816 12:11095541-11095563 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092787861 12:12045710-12045732 CCACCGCGCCCGGCCAAGATTGG - Intergenic
1093318736 12:17685379-17685401 CCATGGCGCCTGGCCAAAAAGGG - Intergenic
1093454598 12:19352701-19352723 CCACAGCACCTGGCCAAAAGAGG + Intronic
1093466229 12:19452278-19452300 CAACTGCTCCTGGCCAAAAGTGG + Intronic
1093499730 12:19798315-19798337 CCACCGCGCCCGGCCAAGAAGGG - Intergenic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1093916560 12:24808721-24808743 CCACTGCGCCTGGCCAAGATTGG + Intergenic
1094096239 12:26707815-26707837 CCACCGCGCCTGGCCAACCTGGG + Intronic
1094578032 12:31706023-31706045 CCACCGCGCCCGGCCAAGAAAGG - Intronic
1095994312 12:48066797-48066819 CCACCGCGCCCAGCCTAAACAGG + Intronic
1096003127 12:48145839-48145861 CTCCAGCTCCTGGCCAGAACTGG - Exonic
1096387213 12:51202616-51202638 CCACCGCGCCTGGCCTCAAAGGG + Intronic
1096479712 12:51930979-51931001 CCACCGTGCCTGGCCAGAAGAGG - Intergenic
1096643938 12:53017876-53017898 CCACTGCACCCGGCCAAAACAGG + Intronic
1097115976 12:56697612-56697634 CCACCGCGCCTGGCCACCTCAGG + Intergenic
1097712569 12:62932920-62932942 CCACCGCGCCCGGCCTAAATGGG + Intronic
1098434396 12:70453324-70453346 CCACCGTGCCTGGCCAAATTAGG - Intergenic
1098754869 12:74348583-74348605 CCACCGCGCCCGGCCAATATAGG + Intergenic
1098902335 12:76125510-76125532 CCACCACGCCTAGCCAATACTGG - Intergenic
1099202857 12:79695101-79695123 CCACCGCACCTGGCCTAATCTGG + Intergenic
1099225244 12:79961217-79961239 CCACTGCGCCCGGCCAAAACCGG + Intergenic
1099329479 12:81265003-81265025 CCACCACGCCCAGCCAAAACTGG - Intronic
1099460775 12:82918194-82918216 CCACTGCGCCTGGCCAAAATTGG + Intronic
1099856673 12:88177036-88177058 CTACTGTGTCTGGCCCAAACTGG - Intronic
1099961079 12:89397489-89397511 CCACCGTGCCTGGCCAGAAGAGG + Intergenic
1100385902 12:94104482-94104504 CCACCGCACCTGGCCAAAACTGG - Intergenic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1100514612 12:95314982-95315004 CCACCGCGCCTGGCCGAACTTGG - Intergenic
1100790610 12:98126137-98126159 CCACCGCGCCCGGCCATGACTGG - Intergenic
1101106172 12:101442867-101442889 CCATTGCGCCTGGCCAATACGGG - Intergenic
1102091407 12:110191881-110191903 CCACCGTGCCTGGCCTGAACAGG - Intronic
1102103289 12:110298430-110298452 CCACCACGCCTGGCCAAAACAGG - Intronic
1102302066 12:111778255-111778277 CCACCGCGCCTGGCCGAATATGG - Intronic
1102333865 12:112060094-112060116 CCATCGCACCTGGCCAAGACAGG + Intronic
1102342804 12:112136878-112136900 CTATGGCATCTGGCCAAAACTGG + Intronic
1102359011 12:112267475-112267497 CTACTGCACCTGGCCTAAAAAGG + Intronic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1102665664 12:114570644-114570666 CTGCCACACCTGGCCAACACTGG - Intergenic
1102779580 12:115552626-115552648 CCACCGCACCTGGCCAACCCAGG - Intergenic
1102867490 12:116385708-116385730 GGACTGCGCCTGGCCAACACTGG + Intergenic
1102874253 12:116437382-116437404 CCACCGCACCTGGCCAACAACGG - Intergenic
1102881189 12:116486375-116486397 CCACCGCGCCTGGCCAGGAATGG - Intergenic
1103030757 12:117610450-117610472 CCACCGTGCCTGGTCATAACTGG - Intronic
1103071210 12:117944087-117944109 CCACCGCTCCGGGCCAAGACTGG - Intronic
1103086808 12:118067747-118067769 CCACCGCACCTGGCCTGAACTGG + Intronic
1103395237 12:120602016-120602038 CCACCACGCCTGGCCAAATAGGG + Intergenic
1103497741 12:121375839-121375861 CCCCCGCGCCTAGCCCAAACTGG + Intronic
1103580376 12:121910472-121910494 CCACCGCGCCCGGCCTAAAATGG - Intronic
1103627894 12:122234577-122234599 CCACCGCGCCTGGCCATGGCTGG + Intronic
1103711083 12:122913197-122913219 CCACCGCGCCTGGCCGAAGAAGG + Intergenic
1103811791 12:123620329-123620351 CCACCGCACCCGGCCAAGACTGG - Exonic
1103866331 12:124054846-124054868 CCACCGCGCCTGGCCGGAAGTGG - Intronic
1104471838 12:129035661-129035683 CCACCGTGCCTGGCCAGCACTGG + Intergenic
1104753769 12:131256207-131256229 CCACCGCGCCCGGCCAGAACTGG + Intergenic
1104787918 12:131461676-131461698 CTACCACGCCTGGCCAAACCAGG - Intergenic
1104849508 12:131864894-131864916 CCACCACGCCTGGCTAATACGGG - Intergenic
1105395591 13:20030819-20030841 CCACTGCGCCTGGCCAACATAGG + Intronic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1106456089 13:29928626-29928648 CCACTGCGCCTGGCCTAAAATGG - Intergenic
1106580455 13:31013613-31013635 CCACCGCGCCCAGCCAAGACAGG + Intergenic
1106642909 13:31604682-31604704 CCACCGCGCCTGGCCAAGGCTGG - Intergenic
1107704853 13:43091373-43091395 CCACTGCGCCTGGCCAATTCAGG + Intronic
1108087517 13:46809662-46809684 CCACCGTGCCTGGCCAGATCTGG - Intergenic
1108286630 13:48915447-48915469 CCACTGCGCCTGGCCAAGCCTGG + Intergenic
1108364559 13:49696920-49696942 CCACAGCGCCTGGCCTAAATTGG - Intergenic
1108827725 13:54435124-54435146 CCACCACGCCTGGCCAAAGATGG + Intergenic
1109043691 13:57378532-57378554 CTACTGCGCCAGGCCAAGACTGG - Intergenic
1109347145 13:61127359-61127381 CCACCATGCCTGGCCAAATCAGG + Intergenic
1109420401 13:62104333-62104355 CCACTGCGCCTGGCCAACAAAGG + Intergenic
1110215009 13:73015277-73015299 CCACCGCGCCCAGCCAAAATAGG + Intronic
1110982003 13:81911993-81912015 CCACCGCGCCCGGCCAACATTGG - Intergenic
1111110894 13:83707686-83707708 CCACCGCGCCCGGCCAAGATAGG + Intergenic
1111483457 13:88863963-88863985 CCACCGCGCCTGGCCTAAATGGG - Intergenic
1111797916 13:92946701-92946723 CCACCGCGCCCGGCCAATAGTGG + Intergenic
1112006008 13:95254183-95254205 CCACTGCGCCTGGCCTAAAGGGG + Intronic
1112040242 13:95540010-95540032 CCACCGCGCCTGGCCACGTCAGG - Intronic
1112226077 13:97541758-97541780 CTACTGCTCCTGGCCAGCACAGG + Intergenic
1112497164 13:99914481-99914503 CCACTGTGCCCGGCCAAAACTGG - Intergenic
1112510026 13:100000613-100000635 CTACTGCGCCTGGCCATCTCAGG + Intergenic
1112657659 13:101469392-101469414 CCACAGCGCCTGGCAACAACTGG - Intronic
1112747296 13:102541148-102541170 CTACCGCGCCCGGCCACAGCAGG - Intergenic
1113196902 13:107818583-107818605 CCACCGCGCCCGGCCTCAACTGG - Intronic
1114209878 14:20605449-20605471 CTACCGTGCCCAGCCAATACAGG - Intronic
1114214976 14:20650464-20650486 CCACCGTGCCTGGCCACCACTGG - Intergenic
1114640653 14:24217575-24217597 CCACTGCGCCCGGCCAGAACAGG + Intronic
1114716126 14:24826910-24826932 CCACCACACCTGGCCAAAATAGG - Intronic
1115234946 14:31200356-31200378 CCACCGTGCCTGGCCAAGAAAGG - Intronic
1115308339 14:31954857-31954879 CTACCACGCCTAGCCAAGAGTGG + Intergenic
1115402011 14:32972223-32972245 CCACCGCGCCTGGCCATCAGTGG + Intronic
1115491249 14:33960324-33960346 CCACCGCGCCCGGCCGAGACAGG - Intronic
1115965238 14:38880179-38880201 CCACTGCACCTGGCCAAAACAGG + Intergenic
1116443930 14:44986717-44986739 CCACCGCGCCCAGCCAACACAGG - Intronic
1116446448 14:45017594-45017616 CCACCACGCCTGGCCAAGAATGG - Intronic
1116449673 14:45050538-45050560 CCACTGCGCCTGGTCAAGACGGG + Intronic
1116461980 14:45188049-45188071 CCACCGCACATGGCCAAAAAGGG - Intronic
1116876295 14:50115436-50115458 CCACCGCGCCCGGCCCAAACTGG + Intronic
1116937769 14:50759774-50759796 CCACCGCGCCCAGCCACAACTGG + Intronic
1117147506 14:52849837-52849859 CCACCGCACCTGGCCAAACCAGG + Intergenic
1117319896 14:54611587-54611609 CCACTGCGCCTGGCCCCAACTGG - Intronic
1117682882 14:58223423-58223445 CCACTGCACCTGGCCAAAACAGG + Intronic
1118030868 14:61816722-61816744 CCACCGCGCCCGGCCAAGAGTGG - Intergenic
1118200574 14:63668001-63668023 CCACCGCGCCTGGCCGAAGATGG + Intergenic
1118648597 14:67865823-67865845 CCACTGCGCCTGGCCTAAATTGG + Intronic
1119012438 14:71008367-71008389 CCACTGCGCCCGGCCAAAACAGG - Intronic
1119283791 14:73433800-73433822 CCACCGCGCCTGGCCTAAATCGG - Intronic
1119707605 14:76794382-76794404 CCACTGCGCCTGGCCTAAAGGGG - Intronic
1120321571 14:82968574-82968596 CCACTGCACCTGGTCAAAACTGG - Intergenic
1120687482 14:87554894-87554916 CCACCACGCCTGGCCAGAAAAGG - Intergenic
1120979277 14:90276504-90276526 CCACCGCGCCTGGCCTCAAATGG + Exonic
1121154532 14:91670714-91670736 CCACTGCGCCTGGCCAAAAGTGG - Intronic
1121355871 14:93214212-93214234 CCACCACGCCCAGCCAAAACTGG + Intronic
1122493561 14:102136279-102136301 CCACCGCGCCCGGCCCAAACCGG - Intronic
1122493616 14:102136598-102136620 CCACCGCGCCCGGCCCAAACCGG - Intronic
1122545394 14:102518998-102519020 CCACCGCGCCTGGCCACGCCCGG - Intergenic
1124404414 15:29381167-29381189 CCACTGCGCCTGGCCAACAAGGG - Intronic
1124437481 15:29662998-29663020 CCACCGCGCCTGGCCAGGACTGG + Intergenic
1124473464 15:30009611-30009633 CCACCGCGTCTGGCCAAGGCTGG + Intergenic
1124566158 15:30816185-30816207 CCACCGCGACTGGCCAACATTGG + Intergenic
1124930668 15:34116193-34116215 CCACCACACCTGGCCCAAACAGG + Intergenic
1125069415 15:35534088-35534110 CCACCGCTCCTGGCCAATATTGG - Intronic
1125487051 15:40118758-40118780 CCACTGAGCCTGGCCAACACTGG - Intergenic
1125583307 15:40802813-40802835 CTACCACGCCTGGCCAGAGGAGG - Intronic
1125706399 15:41741059-41741081 CCACCGCGCCCGGCCAAAATAGG - Intronic
1125782437 15:42281897-42281919 CCACTGCACCTGGCCTAAACAGG - Intronic
1125846749 15:42862599-42862621 CCACCGCGCCTGGCCATAGATGG - Intronic
1125857322 15:42962775-42962797 CCACCACGCCTGGCCAACACTGG + Intronic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1125971137 15:43912728-43912750 CCACCGCGCCCGGCCCAAAGGGG - Intronic
1126043133 15:44612094-44612116 CCACTGCGCCTGGCCTAAAATGG + Intronic
1126140929 15:45438019-45438041 CCACCGCGCCTGGCCTGAACTGG - Intronic
1126608688 15:50506670-50506692 CCATCGCGCCTGGCTAGAACTGG - Exonic
1126625792 15:50685173-50685195 CCACCGCGCCAGGCCAACATGGG - Intronic
1127072190 15:55297913-55297935 CCACTGTGCCTGGCCACAACTGG - Intronic
1127106560 15:55622676-55622698 CCACCGCGCCCGGCCACACCTGG + Intronic
1127443519 15:59036346-59036368 CCACCGCACCCGGCCAAGACTGG + Intronic
1127591898 15:60433371-60433393 CTACCGCACCCGGCCAAATCAGG + Intronic
1127636707 15:60878042-60878064 CCACCGCACCTGGCCAACGCTGG - Intronic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1128268615 15:66289757-66289779 CCACCGCGCCTGGCCCACAGTGG - Intergenic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1128659196 15:69485327-69485349 CTACCCTGCCTGGGCAAAGCGGG - Intergenic
1128896659 15:71379743-71379765 CCACCGCGCCCGGCCACAAATGG + Intronic
1129284384 15:74512553-74512575 CCACCGCGCCCGGCCAGAAAAGG - Intergenic
1129444812 15:75609474-75609496 CCACCGCGCCCGGCCCAAAGTGG + Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1129991887 15:79972505-79972527 CCACCGTGCCTGGCCCAAAGAGG - Intergenic
1130001865 15:80054792-80054814 CCACCGCGCCTGGCCGAGGCTGG + Intergenic
1131107630 15:89745474-89745496 CCACCGCGCCCGGCCAACACAGG - Intergenic
1131145755 15:90010579-90010601 CCACCGCACCTGGCCAAAACAGG + Intronic
1131167889 15:90155788-90155810 CCACCGCGCCTGGCCAGAGCTGG + Intergenic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1131509498 15:93041872-93041894 CCACCGTGCCCGGCCAAAAAAGG - Intronic
1131566741 15:93492569-93492591 CCACCGCGCCTGGCCCAGATAGG + Intergenic
1132036490 15:98489524-98489546 CCACCGCGCCTGGCCTAGTCAGG - Intronic
1132044514 15:98552058-98552080 CTACCGCGCCTGGCCTCTCCTGG + Intergenic
1132118194 15:99153084-99153106 CCACCGTGCCTGGCCAGCACTGG + Intronic
1132126811 15:99234657-99234679 CCACCGCACCTGGCCAAAAATGG + Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132523556 16:402420-402442 CCACCGCGCCCGGCCCAACCTGG + Intronic
1132855219 16:2041893-2041915 CCACCACGCCTGGCCACACCCGG + Intronic
1132866711 16:2096802-2096824 CCACCGCGCCCGGCCAAAAATGG + Intronic
1132943065 16:2518051-2518073 CCACTGCGCCTGGCCAAGTCAGG + Intronic
1132979806 16:2731495-2731517 CCACCGCGCCTGGCCAAAAATGG + Intergenic
1133149235 16:3814542-3814564 CCACCACGCCTGGCCATAACTGG + Intronic
1133507244 16:6423950-6423972 CCACCACGCCTGGACACAACTGG - Intronic
1133513086 16:6479760-6479782 CCACCGTGCCTGGCCTAGACTGG - Intronic
1133805246 16:9121766-9121788 CCACCACGCCTAGCCAAAAAGGG - Intergenic
1133807029 16:9133507-9133529 CCACTGTGCCTGGCCAAAAGAGG + Intergenic
1134019529 16:10911836-10911858 CTCCCGCACCTGGCCAGAACAGG + Intronic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134180763 16:12045909-12045931 CCACCGTGCCTGGCCAAGGCAGG + Intronic
1134542999 16:15084001-15084023 CCACCGCGCCCGGCCAGAACTGG + Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135137680 16:19897064-19897086 CCACCGCGCCTGGCCAGGGCTGG + Intergenic
1135307511 16:21379672-21379694 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1135360590 16:21810134-21810156 CCACCGCGCCCGGCCAGAACTGG + Intergenic
1135586167 16:23672838-23672860 CCACTGCGCCTGGCCAAACATGG - Exonic
1135697345 16:24601482-24601504 CCACCGCGCCTGGCCCTAAATGG + Intergenic
1135787205 16:25360797-25360819 CCACCGCGCCCGGCCAATAGGGG - Intergenic
1136048347 16:27633035-27633057 CCACCGCGCCCGGCCGAAAAGGG + Intronic
1136262234 16:29086893-29086915 CCACCGCGCCCGGCCAGAACTGG - Intergenic
1136304256 16:29358792-29358814 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1136343714 16:29662344-29662366 CCACCGCGCCTGGCCAGATATGG - Intergenic
1136533242 16:30883802-30883824 CCACCACGCCAGGCCCAAACTGG + Intronic
1136589739 16:31210734-31210756 CCACTGCGCCCGGCCAAAGCTGG - Intergenic
1137413513 16:48249902-48249924 CCACCACACCTGGCCAAAAGGGG - Intronic
1137463326 16:48685811-48685833 CCACTGCGCCTGGCCCAAATAGG - Intergenic
1138160003 16:54744686-54744708 CCCCTGCGCCTGGCCATAACAGG + Intergenic
1138618208 16:58189241-58189263 CAACTGCGCCCGGCCAAAGCTGG + Intronic
1138644721 16:58416173-58416195 CCACCGCGCCTGGCCAGTATAGG + Intergenic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1139022034 16:62761446-62761468 CCACCACGCCTGGCCCACACAGG + Intergenic
1139185477 16:64801084-64801106 CCACCGCGCCCGGCCGAGACAGG + Intergenic
1139401809 16:66687972-66687994 CCACCGCGCCTGGCCAAAATGGG + Intronic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139460885 16:67121487-67121509 CCACCGTGCCTGGCCAAGAGTGG + Intronic
1139465800 16:67153389-67153411 CCACCGCACCTGGCCAAGACTGG - Intergenic
1139488161 16:67271043-67271065 CCACCGAGCCTGGCCAAGGCTGG + Exonic
1139525177 16:67511255-67511277 CCACCGCGCCTGGCCACTTCTGG + Intergenic
1139595324 16:67954440-67954462 CTGCCTTGCCTGGCCCAAACTGG + Intronic
1139604351 16:68007491-68007513 CCACCGCGCCTGGCCGAGACAGG + Intronic
1139620795 16:68140270-68140292 CCACTGCGCCTGGCCAGAAAGGG + Intronic
1139742419 16:69046605-69046627 CCACCGCACCTGGCCAGAAAAGG + Intronic
1139780366 16:69346474-69346496 CCACCGCGCCCAGCCAAGACTGG - Intronic
1139801958 16:69530126-69530148 CCATCGCGCCCGGCCAAGACTGG - Intergenic
1139826101 16:69758359-69758381 CCACCGCGCCCGGCCAAGATAGG + Intergenic
1139897307 16:70298004-70298026 CTACTGTGCCTGGCCAATCCTGG + Intronic
1140074944 16:71689683-71689705 CCACCGCACCCGGCCAAGACAGG + Intronic
1141068230 16:80931195-80931217 CCACCGCGCCTGGCCACGCCCGG - Intergenic
1141107879 16:81248722-81248744 CCACCGCGCCCGGCCACCACTGG - Intronic
1141589472 16:85058364-85058386 CCAACGCGTCCGGCCAAAACAGG - Intronic
1141662840 16:85450771-85450793 CCACCGTGCCCGGCCAAACCTGG - Intergenic
1141718377 16:85740413-85740435 CCACCGCGCCCGGCCACACCTGG - Intronic
1141738019 16:85868237-85868259 CCACCGCGCCTGGCCAAGAGGGG - Intergenic
1141859222 16:86705101-86705123 CCACCGCGCCTGGCCACAGCAGG - Intergenic
1141878655 16:86843364-86843386 CCACCGCGCCCGGCCAAAAAAGG - Intergenic
1141915285 16:87092388-87092410 CCACCGCGCCTGGCCGCAAAGGG - Intronic
1142052519 16:87968039-87968061 CCACCACGCCTGGCCAGAAAAGG + Intronic
1142360997 16:89626828-89626850 CCACCGCGCCTGGCCAAGACTGG - Intronic
1142704622 17:1686799-1686821 CCACCGTGCCAGGCCAAAAAAGG + Intergenic
1142710988 17:1724075-1724097 CCACCGCGCCCGGCCAGAACTGG - Intronic
1142771912 17:2104236-2104258 CCACCGCGCCCGGCCACACCTGG + Intronic
1142832230 17:2557855-2557877 CAACCGCGCCCGGCCAGCACAGG + Intergenic
1142846120 17:2678112-2678134 CCACCGCGCCTGGCCACGCCCGG - Intronic
1143025419 17:3938822-3938844 CCACCGTGCCCGGCCAAGACTGG + Intronic
1143069738 17:4280918-4280940 CCACCGCACCTGGCCACAAAGGG + Intronic
1143526068 17:7473400-7473422 CCACCGCGCCTGGCCAGGCCCGG + Intronic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1143604633 17:7975483-7975505 CCACCACACTTGGCCAAAACTGG - Intergenic
1143643376 17:8213030-8213052 CCACCGCGCCTGGCCAGAACTGG - Intergenic
1143791055 17:9295901-9295923 CCACTGCGCCTGGCCACACCTGG - Intronic
1143808727 17:9453091-9453113 CCACCGCGCCTGGCCAGGATGGG + Intronic
1143865718 17:9921670-9921692 GCACCGCGCCTGGCCAACAAAGG - Intronic
1143900807 17:10173479-10173501 CCACCGCGCCTGGCCGAGAGAGG - Intronic
1143958588 17:10696155-10696177 CCACCGCGCCCGGCCATAATTGG - Intronic
1144198685 17:12919671-12919693 CCACCGCGCCTGGCCAGGAATGG + Intronic
1144369167 17:14573772-14573794 CCACCGCGCCTGGCCGAAGAGGG - Intergenic
1144560723 17:16318643-16318665 CCACCACACCTGGCCAAAGCTGG - Intronic
1144949003 17:18984053-18984075 CCACCGCGCCCGGCCAAGGCAGG - Intronic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1145179380 17:20732254-20732276 CCACCGCGCCTGGCCAAGTAGGG + Intergenic
1145907810 17:28525812-28525834 CTACCAGGTGTGGCCAAAACAGG + Intronic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1145950172 17:28811151-28811173 CCACCGCGCCTGGCCTAAATGGG - Intronic
1146020060 17:29270005-29270027 CCACCGCGCCTGGCCAAGCCTGG + Intronic
1146046603 17:29513654-29513676 CCACCGCGCCTGGCCATACCTGG - Intronic
1146083462 17:29804979-29805001 CTACCACACCTGGCCATAAAAGG + Intronic
1146210216 17:30936627-30936649 CCACCGCGCCCGGCCAATATGGG - Intronic
1146363382 17:32197713-32197735 CCACCGTGCCTGGCCACACCCGG + Intronic
1146590044 17:34121025-34121047 CCACCGTGCCTGGCCAGTACTGG + Intronic
1146754954 17:35421825-35421847 CCACCGCGCCTGGCCGAGGCAGG + Intronic
1147003001 17:37378423-37378445 CCACCATGCCTGGCCAAAGCTGG - Intronic
1147163985 17:38583838-38583860 CCACCGCGCCAGGCCAAAGTAGG + Intronic
1147191484 17:38740470-38740492 CCACCGCGCCCGGCCAACTCTGG - Intronic
1147263330 17:39221384-39221406 CCACCGCGCCTGGCCAAGACTGG + Intronic
1147294793 17:39473601-39473623 CCACCGCACCTGGCCACACCCGG - Intronic
1147883272 17:43667667-43667689 CCACCGCGCCTGGCCCTGACAGG + Intergenic
1148322854 17:46768073-46768095 CCACCGCACCCGGCCAACACTGG + Intronic
1148459494 17:47830791-47830813 CCACCGCGCCCAGCCGAAACTGG + Intronic
1148465733 17:47864129-47864151 CCACCACGCCTGGCCTACACTGG + Intergenic
1148507386 17:48138655-48138677 CCACTGCGCCTGGCCACAACTGG + Intronic
1148580998 17:48743669-48743691 CTACCGCGCCCGGCCAATCTGGG + Intergenic
1148594760 17:48844803-48844825 CTACCGCGCCCGGCCAATCTGGG + Intronic
1148670974 17:49409821-49409843 CCACCGCACCTGGCCACAAGTGG + Intronic
1148878986 17:50710946-50710968 CCACCGTGCCTGGCCAGCACTGG - Intergenic
1148922897 17:51054721-51054743 CCACCGCACCTGGCCAAATGTGG + Intronic
1149092004 17:52794607-52794629 CCACCGCACCTGGCCAATCCAGG + Intergenic
1149769935 17:59312543-59312565 CCACTGCGCCTGGCCTAAAATGG + Intergenic
1149931147 17:60756897-60756919 CCACCGCGCCTGGCCAAGAAGGG - Intronic
1150254372 17:63732290-63732312 CTACCGCACCTGGCCAATAGTGG + Intronic
1150385065 17:64752532-64752554 CCACCGCGCCTGGCCAACGTGGG + Intergenic
1150482412 17:65520680-65520702 CTACCCAGCCTGGGCCAAACTGG - Intergenic
1150701614 17:67451921-67451943 CCACCACGCCTGGCCGAGACTGG + Intronic
1151217072 17:72584208-72584230 CCACCGCGCCTGGCCTCAAAAGG + Intergenic
1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG + Intronic
1151290855 17:73148793-73148815 CCACTGCACCTGGCCAAATCTGG - Intergenic
1151626661 17:75280525-75280547 CCACCGCGCCTGGCCATGCCTGG - Intronic
1151640204 17:75386886-75386908 CCACCGCGCCTGGCCAAGATCGG - Intronic
1151671159 17:75572374-75572396 CCACCGCGCCTGGCCCATGCCGG - Intronic
1151754141 17:76061997-76062019 CCACTGCGCCTGGCCACACCCGG - Intronic
1151796378 17:76349021-76349043 CCACCACGCCTGGCCAAAAATGG - Intronic
1151796694 17:76351227-76351249 CCACCGCGCCCGGCCACACCTGG - Intronic
1151797454 17:76355794-76355816 CCACCGCGCCCGGCCACATCTGG - Intronic
1151818507 17:76483972-76483994 CCACCGCGCCCGGCCACAGCTGG - Intronic
1151925119 17:77189913-77189935 CCACCGCGCCCGGCCTTAACAGG + Intronic
1152582791 17:81174660-81174682 CCACCGCGCCTGGCAAACAGAGG - Intergenic
1152612181 17:81321226-81321248 CCACCGCGCCTGGCCGTCACTGG - Intronic
1152746915 17:82044749-82044771 CCACCACGCCCGGCCAAACCCGG + Intergenic
1152849573 17:82624903-82624925 CCACCGCGCCCGGCCACAAATGG + Intronic
1152863233 17:82708385-82708407 TCACCGCGCCCGGCCAAAATAGG - Intergenic
1152874550 17:82779289-82779311 CCACTGCGCCTGGCCAAGATGGG + Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1153870675 18:9316518-9316540 CCACCGCGCCTGCTGAAAACAGG + Intergenic
1153975823 18:10267773-10267795 CCACCGCGCCCGGCCAATCCTGG - Intergenic
1154174045 18:12071765-12071787 CCACCGTGCCTGGCCACAAAAGG - Intergenic
1154216975 18:12422642-12422664 CCACCGCACCTGGCCCCAACAGG + Intronic
1154384611 18:13881486-13881508 CTCCCATGCCTGGCCAAGACAGG + Intergenic
1154932055 18:21009298-21009320 TCACCGCGCCTGGCCAAGACAGG + Intronic
1154993525 18:21618425-21618447 CCACCGCGCCTGGCCACATAAGG + Intronic
1155279732 18:24227178-24227200 CCACTGCGCCTGGCCAGAAACGG + Intronic
1155305676 18:24475718-24475740 CTACCGCACCTGGCCCAAAAAGG - Intronic
1155456144 18:26016433-26016455 CCACCGTGCCTGGCCAGAATAGG - Exonic
1155950156 18:31902761-31902783 CCACCGCGCCTGGCCAGTAGGGG - Intronic
1156120008 18:33831914-33831936 CCACCGTGCCTGGCCCAGACAGG - Intergenic
1156184272 18:34642842-34642864 CCACCGCACCTGGCCCAGACTGG + Intronic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156380721 18:36558449-36558471 CTTCCGCTTCTGGCCAAAAGAGG - Intronic
1156385252 18:36598834-36598856 CCACCGCGCCTGGCCAAAGAAGG + Intronic
1156456626 18:37298430-37298452 CCACCGCACCCAGCCAAAACTGG - Intronic
1156466794 18:37352932-37352954 CTACCGCGCCCGGCCAAGAAAGG - Intronic
1156652295 18:39238619-39238641 CCACCGTGCCTGGCCGAAAATGG + Intergenic
1157023506 18:43815367-43815389 CCACCACGCCGGGCCAAGACAGG - Intergenic
1157626700 18:49056832-49056854 CCACCGCGCCCGGCCACACCTGG + Intronic
1157750352 18:50172974-50172996 CCACTGCGCCTGGCCCACACTGG - Intronic
1157835102 18:50894274-50894296 CCACCGCGCCCGGCCAAAAAGGG - Intronic
1158169391 18:54579084-54579106 CCACCGCGCCCGGCCAGAAAAGG + Intergenic
1158580428 18:58676240-58676262 CTACCACGCCTGGCCACAATAGG - Intronic
1158849956 18:61485784-61485806 CCACCGCACCTGGCCAAAATGGG - Intronic
1159032689 18:63247483-63247505 CCACCGCGCCCGGCCACAATAGG + Intronic
1159304446 18:66622047-66622069 CCACCGCGCCCGGCCCAGACAGG - Intergenic
1159460495 18:68716789-68716811 CCACCGCGCCAGGCCACATCTGG - Intronic
1159742541 18:72190410-72190432 CCACCGCGCCTGGCCCATTCTGG + Intergenic
1160754277 19:749541-749563 CCACGGCGCCTGGCCAAGATGGG - Intergenic
1161225608 19:3143831-3143853 CCACTGCGCCTGGCCAAGAGAGG - Intronic
1161233013 19:3184616-3184638 CTACCGCGCCCGGCTAGAAAGGG - Intergenic
1161312754 19:3603885-3603907 CTACCCCTCCTGGCCAATGCAGG - Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161655395 19:5511261-5511283 CTACCGCGCCCGGCCAGGCCTGG + Intergenic
1161833985 19:6632572-6632594 CCGCCGCGCCTGGCCACAACAGG - Intergenic
1162065926 19:8125501-8125523 CCACCACGCCTGGCCTGAACAGG - Intronic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162312592 19:9915803-9915825 CCACCGCGCCTGGCGAGAAAGGG + Intronic
1162317224 19:9946903-9946925 CCACCGCGCCTGGCCAGAGCTGG - Intergenic
1162397579 19:10426050-10426072 CCACCTCGCCTGGCCAAAAGTGG - Intronic
1162603546 19:11689299-11689321 CCACCGCGCCTGGCCCAGACTGG - Intergenic
1162645881 19:12049935-12049957 CCACCGCACCCGGCCAAAATTGG - Intronic
1162706141 19:12555979-12556001 CCACCGTGCCTGGCCTACACAGG - Intronic
1162733314 19:12731833-12731855 CCACCGCGCCTGGTCAAAAAGGG - Intronic
1162989152 19:14291140-14291162 CCACCGCGCCCGGCCAGAATTGG + Intergenic
1163037846 19:14581617-14581639 CCACCGCGCCTGGCCAGAAATGG + Intergenic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163255935 19:16155891-16155913 CTACCACACCTGGCCGGAACTGG + Intronic
1163303200 19:16461016-16461038 CCACCGCGCCTGGCCCCAGCTGG - Intronic
1163319410 19:16564591-16564613 CCACTGCGCCTGGCCAAGACAGG + Intronic
1163332463 19:16649288-16649310 CCACTGCGCCTGGCTGAAACAGG - Intronic
1163432837 19:17278594-17278616 CCACCGCGCCCGGCCCACACTGG + Intronic
1163497775 19:17656562-17656584 CCACCGCACCTGGCCAAAAGCGG - Intronic
1163599703 19:18241552-18241574 CCACCGCGCCCGGCCAAGACAGG + Intronic
1163600690 19:18247581-18247603 CCACCGCGCCTGGCCAGCTCTGG + Intronic
1163704935 19:18806880-18806902 CCACCGCGCCCAGCCGAAACGGG - Intergenic
1163851197 19:19664498-19664520 CCACCGCGCCCGGCCTAAAGTGG - Intergenic
1163908779 19:20170182-20170204 CCACCGCGCCCGGCCAAAATGGG + Intronic
1164150042 19:22542649-22542671 CCACCGCGCCCGGCCATGACTGG + Intergenic
1164225668 19:23243633-23243655 CCACCGCGCCCGGCCCAAACAGG - Intronic
1164638863 19:29811113-29811135 CCACCGCGCCCGGCCTCAACTGG + Intergenic
1164947304 19:32307060-32307082 CCACCGTGCCTGGCCCAGACTGG + Intergenic
1165021352 19:32926847-32926869 CCACCGCGCCTGGCCTGAAATGG + Intronic
1165047346 19:33115780-33115802 CCACCGCGCCTGGCTAAAGTGGG + Intronic
1165488553 19:36110181-36110203 CCACCGCACCTGGCCCAAAGGGG - Intergenic
1165531154 19:36402849-36402871 CCACCGCGCCTGGCCATGCCTGG - Intronic
1165943558 19:39427913-39427935 CCACCGCACCTGGCCAGGACAGG - Exonic
1165996960 19:39850443-39850465 CCACCGCGCCAAGCCAAAATGGG - Intergenic
1166074142 19:40404089-40404111 CCACCGCGCCCGGCCAAAAGCGG + Intronic
1166138003 19:40789064-40789086 CCACCGCACCTGGCCGACACAGG + Intronic
1166386638 19:42385999-42386021 CCACCGCGCCTGGCCTAAAAAGG - Intergenic
1166388980 19:42398316-42398338 TCACCGCGCCTGGCCACACCTGG - Intergenic
1166657041 19:44619981-44620003 CCACTGCGCCTGGCCGACACTGG - Intronic
1166836770 19:45671907-45671929 CCACCGCGCCCGGCCACCACAGG + Intronic
1166840843 19:45696019-45696041 CCACCGCGCCTGGTCATCACAGG + Intronic
1166867583 19:45849756-45849778 CCACTGCGCCTGGCCAAGGCTGG - Intronic
1166986986 19:46666673-46666695 CCACCGCGCCTGGCCGAGACTGG - Intergenic
1167010881 19:46806670-46806692 CCACCGCACCCGGCCAACACCGG + Intergenic
1167141617 19:47655236-47655258 CCACCACGCCTGGCCAAACTGGG - Intronic
1167176927 19:47871275-47871297 CCACCGTGCCTGGCCAACCCTGG + Exonic
1167335314 19:48881803-48881825 CTACCGCGCCAGGCCGAGAATGG + Intronic
1167442332 19:49515566-49515588 CTACCGCGTCTGGCCATACCTGG + Intronic
1167480155 19:49725291-49725313 CCACCGCGCCTGGCCAGGGCAGG + Intergenic
1167540366 19:50082750-50082772 CCACTGCGCCTGGCCCAAAACGG - Intergenic
1167572092 19:50295036-50295058 CCACCGCGCCCGGCCACACCTGG - Intronic
1167898908 19:52603589-52603611 CCATCGTGCCTGGCCAGAACTGG - Intronic
1167926296 19:52823773-52823795 CCACCGCGCCTGGCCTGAAGTGG - Intronic
1168218841 19:54946076-54946098 CCACCGCGCCCGGCCGAGACAGG + Intronic
1168478419 19:56695573-56695595 CTACCGTGCCCTGCCAAAATGGG - Intergenic
1168646260 19:58060837-58060859 CCACCGCGCCCGGCCAAATCTGG - Intronic
925466986 2:4114879-4114901 CCACCGCGCCCAGCCAAAAGTGG - Intergenic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
926194637 2:10755321-10755343 CCACCGTGCCTGGCCACACCTGG + Intronic
926243960 2:11108360-11108382 CTACCGCGCCTGGCCAATAAAGG - Intergenic
926927976 2:18007472-18007494 CCACTGCGCCTGGCCAACAGTGG - Intronic
927050268 2:19321331-19321353 CCACCGCGCCTGGCCCACACGGG - Intergenic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927570624 2:24156343-24156365 CCACCACGCCTGGCCAGAAGGGG - Intronic
927611036 2:24540744-24540766 CCACCGCACCTGGCCAGAACTGG + Intronic
927913717 2:26920476-26920498 CCACCACGCCTGGCCAACAATGG - Intronic
928087288 2:28353650-28353672 CCACCACGCCTGGCCTGAACTGG + Intergenic
928143046 2:28747408-28747430 CCACCGCACCTGGCCCTAACTGG - Intergenic
928557000 2:32437175-32437197 CCACCGCTCCAGGCCAAAAGAGG + Intronic
928963512 2:36954221-36954243 CCACCACGCCTGGCCAAATTTGG - Intronic
929314775 2:40464180-40464202 CCACCACACCTGGCCAAAAGAGG + Intronic
929464698 2:42133984-42134006 CCACCGCGCCTGGCCACAATAGG - Intergenic
929535426 2:42780491-42780513 CCACCGCGCCCGGCGAACACAGG + Intronic
929596088 2:43177041-43177063 CCACCACGCCTGGCCAAACAAGG + Intergenic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930813905 2:55571905-55571927 CCACTGCGCCTGGCCAACACTGG + Intronic
930832900 2:55764181-55764203 ATACCTTGCCTGGCCAAAAGTGG - Intergenic
931381762 2:61760618-61760640 CCACCACGTCTGGCCAAAAAGGG + Intergenic
931758962 2:65399666-65399688 CCACTGCGCCTGGCCTTAACTGG + Intronic
931775773 2:65539270-65539292 CCACCGCGCCCGGCCAGAATTGG + Intergenic
931873337 2:66484845-66484867 CCACTGCGCCTGGCCAAAAAGGG + Intronic
932060520 2:68493819-68493841 CCACCGCGCCTGGCCACGCCTGG - Intronic
932804685 2:74773592-74773614 CCACCGCGCCCGGCCAACACTGG - Intergenic
932920585 2:75909867-75909889 CCACCGCGCCCGGCCGAAAAAGG - Intergenic
933350857 2:81150414-81150436 CCACCGCACCTGGCCAGTACTGG + Intergenic
933429421 2:82156477-82156499 CCACCACGCCTGGCCAAGAATGG + Intergenic
933703899 2:85275628-85275650 CCACCGCACCTGGCCTACACTGG - Intronic
933901313 2:86852252-86852274 CCACCACATCTGGCCAAAACTGG + Intronic
934066909 2:88349537-88349559 TCACCGCGCCTGGCCCAAAGCGG - Intergenic
934175110 2:89572035-89572057 CCACCGCACCTGGCCAAGAAAGG - Intergenic
934285426 2:91646389-91646411 CCACCGCACCTGGCCAAGAAAGG - Intergenic
934544410 2:95202913-95202935 CCACCGCGCCTGGCCAGAAAAGG + Intergenic
934852478 2:97710322-97710344 CCACCGCGCCAGGCCAAAAATGG - Intergenic
935230158 2:101089059-101089081 CCACCACGCCTGGCCAACATTGG - Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
935779236 2:106496985-106497007 CCACCACGTCTGGCCAAAACTGG - Intergenic
936473989 2:112823900-112823922 CCACCGCGCCCGGCCAAGAGTGG + Intergenic
936692051 2:114901481-114901503 CCACCGCGCCCGGCCACAAATGG + Intronic
936789985 2:116140134-116140156 CCACCGCGCCTGGCCTAGATGGG - Intergenic
936956001 2:118022860-118022882 CCACCGCGCCCGGCCTAAACTGG + Intergenic
937366489 2:121265769-121265791 CCACCGTGCCTGGCCAAGAGTGG + Intronic
937574512 2:123403118-123403140 CCACCGCGCCGGGCCAAAGATGG + Intergenic
937598506 2:123699550-123699572 CCACCGTGCCTGGCCAAATGTGG - Intergenic
938967298 2:136399798-136399820 CCACCGTGCCCGGCCAGAACTGG + Intergenic
939379884 2:141421239-141421261 CCACCGCGCCCGGCCGAAAGAGG - Intronic
939438018 2:142203796-142203818 CCACTGCGCCTGGCCCAAAAAGG - Intergenic
939974291 2:148698348-148698370 CCACTGCGCCCAGCCAAAACAGG - Intronic
940129275 2:150362884-150362906 CTACCGTGCCCGGCCAAAAGGGG - Intergenic
940370286 2:152893675-152893697 CCACCGCGCCTGGCCTCTACTGG + Intergenic
940377833 2:152976609-152976631 CCACCACGCCTGGCCGAAAATGG + Intergenic
940486331 2:154300388-154300410 CCACCGCACCTGGCCAGAAATGG + Intronic
940921502 2:159312759-159312781 CCACTGCACCTGGCCAAAAAAGG + Intergenic
940957997 2:159750238-159750260 CCACTGCGCCCGGCCTAAACTGG - Intronic
941212570 2:162659628-162659650 CCACTGCGCCTGGCCAATAGTGG + Intronic
941497799 2:166228542-166228564 CCACTGCGCCCGGCCAAGACTGG + Intronic
941820147 2:169836370-169836392 CTACCACGCCTGGCCCCACCAGG + Intronic
942028484 2:171935041-171935063 CCACCGCGCCTGGCCTAGAGTGG + Intronic
942097429 2:172547210-172547232 CCACCGCGCCTGGCCAAGACGGG + Intergenic
942154052 2:173108416-173108438 CCACCGCGCCCGGCATAAACTGG + Intronic
942235993 2:173905709-173905731 CCACCACGCTTGGCCAAATCTGG - Intergenic
942331551 2:174829987-174830009 CCACCGCGCCCGGCCAAATTAGG - Intronic
942566420 2:177268681-177268703 CCACCGCGCCTGGCCTATACTGG - Intronic
942724979 2:178996363-178996385 CCACCGCACCTGGCCAAAATTGG + Intronic
942884785 2:180910138-180910160 CCACCGCGCCCGGCCCAAATCGG - Intergenic
943643129 2:190380677-190380699 CCAACGCGCCCAGCCAAAACAGG + Intergenic
944156087 2:196609217-196609239 CCACTGCACCTGGCCAAAACTGG - Intergenic
944238412 2:197461980-197462002 CCACCGCGCCCGGCCTAAAGAGG - Intronic
944580053 2:201124620-201124642 CCACCGCGCCTGGCCAGTTCAGG + Intronic
944757232 2:202775803-202775825 CTACCGCGCCTGGCCTTACAAGG + Exonic
944832162 2:203543757-203543779 CCACCGTGCCTGGCCCAAAAGGG - Intergenic
945172729 2:207013468-207013490 CCACCTCACCTGGCCAAAACTGG + Intergenic
945292645 2:208141332-208141354 CCACCACGCCTGGCCTACACTGG - Intergenic
945764855 2:213962470-213962492 CCACCGCGCCCAGCCAGAACTGG + Intronic
946274444 2:218620210-218620232 CTACTGCACCTGGCCACACCTGG - Intronic
946839531 2:223806569-223806591 CCACCGCACCTGGCCAACAAAGG + Intronic
946848958 2:223886435-223886457 CCACTGCGCCCGGCCTAAACAGG - Intronic
947766511 2:232641318-232641340 CCACCGCACCTGGCCACAATCGG + Intronic
948009718 2:234641852-234641874 CCACTGTGCCTGGCCAACACTGG - Intergenic
948141475 2:235675464-235675486 CGACCGCGCCTGGCCTGAAAAGG + Intronic
949005869 2:241647329-241647351 CCACTGCGCCTGGCCACCACCGG - Intronic
1168796911 20:616597-616619 CCACCGCGCCTGGCCACAAGGGG + Intergenic
1169126433 20:3130942-3130964 CCACTGCGCCTGGCCCAAAGAGG - Intronic
1169223447 20:3840845-3840867 CCACCGCGCCCGGCCACCACTGG - Intergenic
1169377155 20:5075350-5075372 CCACCGCGCCCGGCCTAAAATGG + Intronic
1169405998 20:5321795-5321817 CCACCGCGCCCGGCCAGAAAGGG + Intergenic
1169452139 20:5721187-5721209 CCACCACGCCTGGCCTAAAAAGG - Intergenic
1169591765 20:7150788-7150810 CCACAGTGCCTGGCCAAAAAAGG + Intergenic
1170806093 20:19633360-19633382 CCACCGCGCCCGGCCACGACTGG - Intronic
1172140043 20:32716326-32716348 CCACTGCGCCCGGCCCAAACTGG - Intronic
1172297170 20:33821097-33821119 CCACCGCACCCGGCCAAACCAGG - Intronic
1172357072 20:34287677-34287699 CCACCGTGCCTGGCCAGAAGGGG + Intronic
1172397653 20:34620522-34620544 CCACCGCGCCTGTCCAAGTCAGG - Intronic
1172542080 20:35726416-35726438 CCACCACGCCTGGCCCAAAAAGG + Intronic
1172559101 20:35870015-35870037 CTACCGCGCCTGGCCACACCCGG - Intronic
1172676828 20:36678393-36678415 CTACCGCACCCGGCCAATCCTGG - Intronic
1172726099 20:37043192-37043214 CCACCGCGCCTGGCCACACCCGG - Intronic
1172864752 20:38087245-38087267 CCACTGCGCCTGGCCACAACTGG + Intronic
1172934757 20:38611859-38611881 CCACCGTGCCTGGCCACACCCGG + Intronic
1173235229 20:41239294-41239316 CCACCGTGCCTGGCCAATAAGGG + Intronic
1173840923 20:46156600-46156622 CCACCGCGCCTGGCCAGCAGTGG + Intergenic
1173989556 20:47290876-47290898 CCACCGCGCCCGGCCAAACAGGG + Intronic
1174007119 20:47419623-47419645 CCACCGCGCCTGACCACAACTGG + Intergenic
1174150485 20:48482883-48482905 CTACCGCGCCCGGCCAGGAAGGG + Intergenic
1174219225 20:48939258-48939280 CCACCGCGCCTGGCCTATAGTGG + Intronic
1174522564 20:51142973-51142995 CCACCGCGCCTGGCCAGCATGGG - Intergenic
1174587560 20:51620858-51620880 CCACCGCGCCTGGCCTAGAGTGG - Intronic
1174591771 20:51651639-51651661 CCACCACTCCTGGCCAAAAAAGG - Intronic
1174622313 20:51885237-51885259 CCACCGCGCCTGGCCCAGAATGG - Intergenic
1174633911 20:51982249-51982271 CCACCGCACCTGGCCGAGACTGG + Intergenic
1174643573 20:52066408-52066430 CCACCGCGCCTGGCCACACCTGG - Intronic
1174680998 20:52408026-52408048 CCACTGCGCCTGGCCTTAACTGG + Intergenic
1174914165 20:54637833-54637855 CCACCGCGCCCGGCCAAAGTAGG - Intronic
1174926109 20:54761910-54761932 CCACTGCGCCTGGCCATCACTGG - Intergenic
1175442152 20:58999780-58999802 CCACCGTGCCCGGCCATAACTGG - Intronic
1175442204 20:59000088-59000110 CTGCTGCGCCCGGCCATAACTGG - Intronic
1175697905 20:61116362-61116384 CCACCGCGCCTGGTCAGGACTGG - Intergenic
1176156346 20:63623509-63623531 CCACCGCGCCCGGCCTAAAGTGG - Intronic
1176721796 21:10399527-10399549 CCACCGCGCCTGGCCAGGAAGGG + Intergenic
1177179759 21:17732241-17732263 CCACCGCGCCCGGCCACACCTGG + Intergenic
1177187350 21:17812520-17812542 CCACCGCGCCCGGCCAACAGTGG - Intronic
1177194140 21:17884527-17884549 CCACCGCGCCTGGCCGATAATGG + Intergenic
1177539405 21:22472079-22472101 CCACCGCGCCCGGCCCACACTGG - Intergenic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1178325769 21:31644315-31644337 CCACCACGCCCGGCCTAAACTGG - Intergenic
1178437357 21:32571964-32571986 CCACTGCGCCCGGCCCAAACTGG + Intergenic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1178789156 21:35682622-35682644 CCACCGCGCCTGGCCTAAATTGG + Intronic
1178800810 21:35793590-35793612 CCACCGTGCCAGGCCACAACAGG + Intronic
1178962358 21:37076980-37077002 CCACCGCGCCTGGCCTACAAAGG + Intronic
1179061256 21:37981649-37981671 CCAGCGCGCCTGGCCAAATGTGG + Intronic
1179142025 21:38734059-38734081 CGCCACCGCCTGGCCAAAACTGG - Intergenic
1179405422 21:41121782-41121804 CCACCGCGCCAGGCCCAGACGGG + Intergenic
1179767866 21:43587376-43587398 CTACCGTGCCTGGCCATCCCAGG - Intronic
1180163478 21:46008301-46008323 CCACCGTGCGTGGCCAAGACTGG + Intergenic
1180213302 21:46309029-46309051 CCACTGCGCCTGGCCAAATCTGG - Intronic
1180224266 21:46380445-46380467 CCACCGCGCCCGGCCAACCCTGG + Intronic
1180227672 21:46405408-46405430 CCACCGCTCCTGGCCATAAAAGG - Intronic
1180251623 21:46594003-46594025 CCACCGCACCTGGCCAAGTCTGG - Intergenic
1180302982 22:11052304-11052326 CCACCGCGCCTGGCCAGGAAGGG + Intergenic
1180636736 22:17267831-17267853 CCACTGCGCCTGGCCTAGACTGG - Intergenic
1181139263 22:20792219-20792241 CTACCTCGGCCAGCCAAAACTGG + Intronic
1181343997 22:22203758-22203780 TTATCGCGGCTGCCCAAAACGGG + Intergenic
1181481443 22:23201740-23201762 CCACCGCGCCCGGCCAAGTCTGG + Intronic
1181537620 22:23554648-23554670 CCACCGCACCTGGCCAGTACTGG - Intergenic
1181557466 22:23679628-23679650 CCACCGTGCCTGGCCACAAATGG - Intergenic
1181585076 22:23848739-23848761 CCACCGCGCCCAGCCAACACAGG - Intergenic
1181767069 22:25099798-25099820 CCACCGCACCTGGCCAAATATGG + Intronic
1182034602 22:27187957-27187979 CCACCGCACCTGGCCTAAGCAGG + Intergenic
1182049488 22:27301935-27301957 CCACCACGCCTGGCCAATATCGG + Intergenic
1182237631 22:28888828-28888850 CCACCGCGCCCGGCCAGACCTGG - Intronic
1182273260 22:29169233-29169255 CCACCGCGCCTGGCCGACGCTGG - Intergenic
1182631313 22:31687754-31687776 CCACCGCGCCCGGCCAATATTGG - Intronic
1183059909 22:35329990-35330012 CCACCGCGCCTGGCCAAGTGAGG - Intronic
1183120348 22:35725538-35725560 CCACCGCGCCTGGCCAGGACTGG + Intronic
1183494394 22:38134272-38134294 CCACCGTGCCTGGCCTAAAGGGG - Intronic
1183522193 22:38302038-38302060 ATTCAGCGCCTTGCCAAAACAGG - Intronic
1183559449 22:38559454-38559476 CCACCGTGCCCTGCCAAAACAGG + Intronic
1183782164 22:40005950-40005972 CCACCGCGCCCGGCTACAACAGG - Intronic
1183819392 22:40333054-40333076 CCACCGCGCCCAGCCAAGACAGG - Exonic
1183859367 22:40658320-40658342 CCACCGCGCCCGGCCAAAGCTGG + Intergenic
1183925701 22:41204505-41204527 CCACCGCGCCCGGCTGAAACTGG - Intergenic
1183941515 22:41298286-41298308 CCACAGCGCCTGGCCACACCTGG + Intergenic
1184090062 22:42288248-42288270 CCACCGCGCCTGGCCATGCCTGG - Intronic
1184157455 22:42677506-42677528 CCACTGCACCTGGCCAAGACTGG - Intergenic
1184169708 22:42751752-42751774 CCACCGCGCCTGGCCACGCCTGG + Intergenic
1184272845 22:43394587-43394609 CCACCGGGCCTGGCCAAATCAGG + Intergenic
1184756453 22:46518746-46518768 CCACCGCGCCCAGCCACAACTGG - Intronic
1184840584 22:47050290-47050312 CCACCGCGCCTGGCCGAGAGGGG + Intronic
1184849201 22:47110190-47110212 CCACCGTGCCTGGCCAGAAAAGG - Intronic
1185040738 22:48502810-48502832 CCACCGCACCTGGCCAAGAGTGG + Intronic
1185069558 22:48648551-48648573 CTACTGCGCCTGGCTGATACGGG - Intronic
1185114371 22:48923171-48923193 CCACCGCGCCTGGCCACATCTGG + Intergenic
949347582 3:3090858-3090880 CCACCACGCCCGGCCAACACAGG + Intronic
949973733 3:9434955-9434977 CCACTGCGCCTGGCCAAGAGGGG - Intronic
950275828 3:11659873-11659895 CCACCGCGCCCGGCCAAGATGGG - Intronic
950805358 3:15598306-15598328 CCACCGCGCCTGGCCATAACTGG + Intronic
950829138 3:15857570-15857592 CCACCGCGCCTGGCCGCAAGTGG + Intronic
950982689 3:17325607-17325629 CCACCGCGCCTGGCCCAATATGG + Intronic
951215373 3:20019574-20019596 CCACCGCGCCTGGCCTAAATTGG - Intergenic
952336934 3:32411789-32411811 CCACTGCGCCTGGCCAAGTCGGG - Intronic
952348582 3:32512011-32512033 CCACCGCGCCCGGCCAAGACAGG + Intergenic
952371395 3:32726405-32726427 CCACCGCCCCTGGCCTAAATAGG - Intronic
952393940 3:32904532-32904554 CCTCCGCGCCTGGCCATAAATGG - Intergenic
952394087 3:32905831-32905853 CCACCACGCCTGGCCCTAACTGG + Intergenic
953440923 3:42916649-42916671 CTACCACGCCTGGCCAATCCAGG + Exonic
953476346 3:43209027-43209049 CTACCGCACCTGGCCAAAATGGG - Intergenic
953729690 3:45436505-45436527 CCACCGCGCCCGGCCACAAACGG - Intronic
953995922 3:47519984-47520006 CCACCGCGCCTGGCCAATGAGGG - Intergenic
954042903 3:47903244-47903266 CCACCGCACCTGGCCAGAAAAGG - Intronic
954225860 3:49180641-49180663 CCACCGCACCTGGCCTAAAAAGG - Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
954579272 3:51694416-51694438 CCACCGCGCCTGGCCAAAGAGGG + Intronic
954620312 3:51991646-51991668 CCACCGCGCCCGGCCTAGACTGG + Intergenic
954669236 3:52279238-52279260 CCACCGCGCCCGGCCTAAAAAGG - Intronic
955147691 3:56336504-56336526 CCACTGCACCTGGCCACAACAGG - Intronic
955171315 3:56567975-56567997 CCACCACGCCCGGCCAAAAGTGG + Intronic
955357210 3:58241015-58241037 CCACCGCGCCCGGCCAAACCTGG + Intronic
956117182 3:65930442-65930464 CCACCGTGCCTGGCCACAAGTGG - Intronic
956132318 3:66065983-66066005 CCACCGAGCCTGGCCATAAGGGG + Intergenic
956139463 3:66131006-66131028 CCACCGCGCCCGGCCATAGCTGG + Intergenic
956726802 3:72163111-72163133 CTACCGCGCCTGGCCTCCCCTGG - Intergenic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
959143295 3:102512451-102512473 CCACCGCGCCTGGCCGTAATAGG + Intergenic
959983765 3:112549519-112549541 CCACCGCGCCTGGCTGAAACAGG - Intronic
960031526 3:113059261-113059283 CCACCACGTCTGGCCAAAAGAGG - Intergenic
960103918 3:113773223-113773245 CCACCGTGCCTGGCCAATATTGG + Intronic
960139384 3:114137702-114137724 CCACCGCGCCCGGCCACATCTGG - Intronic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960813553 3:121649520-121649542 CCACCACGCCTGGCCTAAACAGG + Intronic
961013883 3:123452635-123452657 CCACCGCGCCCGGCCAATACTGG - Intergenic
961031138 3:123605026-123605048 CCACCACGCCCGGCCAAAATGGG - Intergenic
961031614 3:123609794-123609816 CCACCGCGCCTGGCCAGAACTGG + Intergenic
961255245 3:125544341-125544363 CTACTGCACCTGGCCAAGAATGG + Intronic
961560671 3:127726715-127726737 CCACCGCGCCTGGCCTACAGGGG + Intronic
961717546 3:128868968-128868990 CCACCGCGCCCGGCCGGAACTGG + Intergenic
961845675 3:129761036-129761058 CCACCGCGCCCGGCCAGCACAGG - Intronic
962229855 3:133653917-133653939 CAACCGCGCCCGGCTATAACAGG + Intronic
962246180 3:133795861-133795883 CCACTGCACCTGGCCAAAAAGGG + Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962519736 3:136187373-136187395 CCACTGCGCCTGGCCAAATATGG - Intronic
962521451 3:136200940-136200962 CCACTGCGCCTGGCCACACCTGG - Intergenic
962799496 3:138878157-138878179 CCACCGCACCTGGCCACACCTGG + Intergenic
963194470 3:142511366-142511388 CCACCACACCTGGCCAAAATGGG - Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963750391 3:149171990-149172012 CCACCACGCCTGGCCTGAACTGG + Intronic
964112396 3:153101405-153101427 CCACCGCGCCCGGCCAAACATGG - Intergenic
964349394 3:155787902-155787924 CCACCGCGCCCGGCCTATACTGG - Intronic
964539593 3:157764844-157764866 CCACCGCGCCTGGCCAGTATTGG - Intergenic
965010189 3:163077766-163077788 CCACCGTGCCCGGCCAAAATGGG + Intergenic
965579205 3:170249133-170249155 CTACCGCGCCCGGCCAGAATTGG + Intronic
965600002 3:170445217-170445239 CCACCGTGCCTGGCCTGAACTGG - Intronic
965673410 3:171170761-171170783 CTACCGCACCTGGCCAGAAGTGG - Intronic
966373815 3:179275439-179275461 CCACCGTGCCCGGCCAATACTGG - Intergenic
966804573 3:183796979-183797001 CTACCGCGCCTGGCCAGCACTGG - Intronic
966970476 3:185040913-185040935 CCACCGCGCCTGGCCAACCTTGG - Intronic
967160860 3:186736761-186736783 CTACCACGCCTGGCCTCAACTGG - Intronic
967186108 3:186946017-186946039 CCACCGCGCCCGGCCAGAAAAGG - Intronic
967349005 3:188491045-188491067 CCACCGCGCCTGGCCGGCACTGG + Intronic
967439900 3:189494391-189494413 CCACCGCGCCTGGCCAGTAGTGG + Intergenic
967907703 3:194515375-194515397 CCACCGCGCCTGGCCGGAACTGG + Intergenic
968013891 3:195309252-195309274 CCACCGTGCCTGGCCACAAGTGG - Intronic
968035877 3:195547503-195547525 CCACCGCGCCTGGCCAAGAAGGG - Intergenic
968820929 4:2850710-2850732 CCACCGCGCCTGGCCACGCCCGG + Intronic
969633027 4:8349493-8349515 CCACCACGCCTGGCCAAGACAGG - Intergenic
969959749 4:10932658-10932680 CCACCGTGCCTGGCCAACAATGG - Intergenic
970399225 4:15701883-15701905 CCACCGCGCCCGGCCAATCCTGG + Intronic
970879639 4:20913866-20913888 CCACCGCGCCTGGCCATGCCTGG - Intronic
971288097 4:25309411-25309433 CCACCGCGCCTGGGCCAAACTGG - Intergenic
971312083 4:25534112-25534134 CCACCGCTCCTGGCCTAATCAGG - Intergenic
971426135 4:26517631-26517653 CCACCGCACCCGGTCAAAACAGG - Intergenic
971816470 4:31496941-31496963 CCACCGCGCCCGGCCCACACTGG - Intergenic
971851645 4:31992701-31992723 CCACCGCGCCCGGCCCAATCAGG - Intergenic
972044784 4:34652137-34652159 CCACCGTGCCTGGCCAAATTTGG + Intergenic
972284249 4:37633119-37633141 CCACCGTGCCTGGCCAAACATGG - Intronic
972414500 4:38825082-38825104 CCAACGTGCCTGGCCGAAACTGG + Exonic
972545289 4:40074494-40074516 CCACCACGCCTGGCCTACACAGG + Intronic
972555841 4:40180049-40180071 CCACCGCGCCTGGCCTAGAGTGG + Intergenic
972569926 4:40301282-40301304 CCACCGCGCCTGGCCTAGACTGG + Intergenic
972922840 4:43965502-43965524 CCACCACGCCTGGCCGAAAATGG - Intergenic
973339260 4:48986876-48986898 CTACAGCTCCTGGGGAAAACGGG - Intronic
973741239 4:53921439-53921461 CCACCACGCCTGGCCTCAACTGG + Intronic
973753052 4:54043132-54043154 CCACCGCGCCTGGCCGAGACAGG - Intronic
974028211 4:56752588-56752610 CCACCGCGCCTGGCCAGGAAAGG + Intergenic
976178475 4:82377213-82377235 CCACCGCGCCCGGCCAAGCCAGG + Intergenic
976199375 4:82563184-82563206 CCACCGCGCCCGGCCCAACCAGG + Intergenic
976206415 4:82627033-82627055 CCACCACACCTGGCCAAAAATGG + Intergenic
976249355 4:83034630-83034652 CCACCGCGCCCGGCCGAAAGGGG + Intronic
976419976 4:84830899-84830921 CCACTGCGCCTGGCCAACAATGG - Intronic
976499376 4:85769872-85769894 CCACCGCGCCTGGCCAGTAGTGG + Intronic
976752592 4:88465055-88465077 CCACTGCACCTGGCCACAACCGG + Intronic
977174461 4:93803434-93803456 CCACCGCACCCGGCCAAAAAAGG - Intergenic
977412809 4:96689768-96689790 CCACCACGCCTGGCCAAATGTGG - Intergenic
977531401 4:98204734-98204756 CCACTGCCCCTGGCCAAACCAGG - Intergenic
977608061 4:99002785-99002807 CCACGGCGCCTGGCCTTAACAGG - Intronic
977866561 4:102035359-102035381 CCACCGTGCCTGGCCAACATGGG - Intronic
977939405 4:102842820-102842842 CCACCACGCCTGGCCAAAACTGG - Intronic
978177001 4:105743944-105743966 CCACCATGCCTCGCCAAAACAGG + Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978515873 4:109567984-109568006 CCACCGCTCCTGGCCTGAACAGG + Intronic
978754865 4:112291068-112291090 CCACCGCACCTGGCCTAATCAGG + Intronic
978802866 4:112771870-112771892 CCACCGCACCTGGCCTAAACTGG + Intergenic
979643991 4:123045806-123045828 CCACCTCGCCCGGCCAAAACAGG - Intronic
979916140 4:126436583-126436605 CCACTGCGCCTGGCCAATATGGG - Intergenic
980906324 4:138951786-138951808 CTACTCCTCCTGGCCAATACAGG + Intergenic
980936005 4:139226567-139226589 CCACTGCACCTGGCCAAAATTGG - Intergenic
980955241 4:139421506-139421528 CCACCGCGCCCGGCCAGAAGTGG + Intergenic
980955740 4:139427597-139427619 CCACCGCACCTGGCCGAGACTGG + Intergenic
981030689 4:140122503-140122525 CCACCGCGCCCGGCCCAAAATGG - Intronic
981340493 4:143616497-143616519 CCACTGCGCCCGGCCAAAAGTGG - Intronic
981703606 4:147635007-147635029 CCACTGCGCCTGGCCAAGAATGG + Exonic
981982352 4:150809565-150809587 CCACTGCACCTGGCCAAAAATGG - Intronic
983228800 4:165109650-165109672 CCACCGCACCTGGCCAGACCTGG + Intronic
983552475 4:169031813-169031835 CCACCGCGCCTGGCCAGCACAGG - Intergenic
984707629 4:182859375-182859397 CCACTGCGCCTGGCCAGAAAAGG - Intergenic
984927705 4:184820866-184820888 CCACCGCACCTGGCCTAACCTGG + Intronic
985056575 4:186040951-186040973 CCACCGCGCCTGGCCCAAGATGG + Intergenic
985146500 4:186899491-186899513 CCACCGCACCTGGCCTTAACAGG - Intergenic
985260001 4:188106336-188106358 CCACCGCGCCCGGCCGAAAACGG + Intronic
985616924 5:928297-928319 CCACCACGCCCGGCCAAGACTGG - Intergenic
985665017 5:1177550-1177572 CCACCGCGCCCGGCCAAAACTGG - Intergenic
986352749 5:6895579-6895601 CTACTGTGCCTGGCCAAATTAGG + Intergenic
986681847 5:10240706-10240728 CCACTGCGCCTGGCCATAAATGG - Intronic
987065884 5:14289098-14289120 CCACCGCGCCCGGCCACACCTGG - Intronic
987139459 5:14930370-14930392 CTACCGGGCCCGGCCAAAATAGG + Intergenic
987554901 5:19434075-19434097 CCACCGCGCCCGGCCAATGCTGG + Intergenic
987633298 5:20505052-20505074 CCATCGCGCCTGGCCACAAAAGG + Intronic
987804367 5:22744140-22744162 CCACCGCGCCTGGCCTATACTGG - Intronic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
988516446 5:31908755-31908777 CCACCACGCCCGGCCAGAACTGG - Intronic
988622864 5:32841499-32841521 CCACCTCGCCTGGCCTAAAATGG + Intergenic
988637812 5:33006055-33006077 CCACCGCGCCTGGCCAAGAATGG - Intergenic
989154060 5:38327083-38327105 CCACCGCACCTGGCCAATAAGGG + Intronic
989385366 5:40850125-40850147 CCACCGCACCTGGCCGATACTGG - Intronic
989482522 5:41948420-41948442 CCACCGCGCCTGGCCACTAGTGG + Intergenic
989641314 5:43585677-43585699 CCACCGCACCCGGCCAAAAGAGG - Intergenic
989653015 5:43714531-43714553 CTGCCACGCCAGGCCAAAAAGGG - Intergenic
990012987 5:51022498-51022520 CCACCGCGCCCGGCCTACACTGG + Intergenic
990248916 5:53892890-53892912 CTACTGTGCCTGGCCTATACTGG + Intronic
990262925 5:54044530-54044552 CCACTGCACCCGGCCAAAACAGG + Intronic
990303599 5:54473360-54473382 CCACCACGCCTGGCCACACCTGG + Intergenic
990331494 5:54730490-54730512 CCACCGCGCCTGGCCATCTCAGG - Intergenic
990412997 5:55559804-55559826 CCACCGCGCCCGGCCGAGACAGG - Intergenic
991060759 5:62372947-62372969 CCACCACGCCCGGCCAAAAGAGG - Intronic
991226539 5:64279803-64279825 CCACCACGTCTGGCCAAAAATGG - Intronic
991649509 5:68837539-68837561 CCACCGCGCCCGGCCAGAAATGG + Intergenic
991777036 5:70095502-70095524 CCACCGCGCCTGGCCATCACAGG + Intergenic
991856322 5:70970946-70970968 CCACCGCGCCTGGCCATCACAGG + Intronic
991913634 5:71585350-71585372 CCACTGCACCCGGCCAAAACAGG + Intergenic
992085238 5:73272240-73272262 CCACCGTGCCTGGCCACCACAGG + Intergenic
992130141 5:73683778-73683800 CTGCCTCACCTGGCCAAAAGTGG + Intronic
992333710 5:75743416-75743438 CCACTGTGCCTGGCCAACACTGG + Intergenic
992403311 5:76431535-76431557 CCACCGTGCCCGGCCAAGACTGG - Intronic
992610367 5:78503408-78503430 CCACCGCACCTGGCCAAGACGGG - Intronic
992682509 5:79167123-79167145 CCACCGCGCCTGGCCAGACTGGG - Intronic
992721738 5:79567693-79567715 CCACCGCACCTGGCCACAAATGG + Intergenic
992938472 5:81737493-81737515 CCACCGCGCCTGGCCAAACAGGG - Intronic
993710893 5:91223684-91223706 CTACTGTGCCTGGCCACATCAGG + Intergenic
995166181 5:109044466-109044488 CCACCACGCCTGGCCAAATGAGG + Intronic
995680816 5:114717659-114717681 CCACCGCGCCCGGCCAGAAGAGG - Intergenic
995861707 5:116647857-116647879 CCACCGCGCCTGGCCGCAAAGGG + Intergenic
996105029 5:119490853-119490875 CTACCGCACCTGGCCTAGATAGG + Intronic
996554554 5:124764309-124764331 CCACCGCGCCTGGCCAATATGGG + Intergenic
997012386 5:129893845-129893867 CCACCGCGCATGGCCAGGACAGG + Intergenic
997102761 5:130987205-130987227 CCACCGCGCCTGGCCATCTCTGG - Intergenic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997313807 5:132915049-132915071 CCACCGTGCCTGGCCAGAAATGG - Intronic
997523721 5:134539484-134539506 CCACCGCGCCCGGCCAATCCTGG + Intronic
997574251 5:134961569-134961591 CCACCGCGCTTGGCCAGAAGTGG + Intronic
997802032 5:136873306-136873328 CTACCACGCCTGGCCGAGACAGG - Intergenic
997894184 5:137701333-137701355 CCACCGTGCCCGGCCAAAATTGG + Intronic
998087436 5:139337994-139338016 CCACCGCGCCTGGCCAAGTTTGG + Intergenic
999015863 5:148104606-148104628 CCACCGTGCCTGGCCAGAAATGG - Intronic
999797470 5:155001928-155001950 CCACCGTGCCTGGCCGAAATAGG - Intergenic
999983156 5:156977127-156977149 CCACCGTGCCTGGCCAACAATGG - Intergenic
1000079813 5:157834052-157834074 CCTCCGTGCCTGGCCAGAACTGG - Intronic
1000331949 5:160212754-160212776 CCACCGTGCCCGGCCACAACTGG + Intronic
1000497413 5:162002242-162002264 CCACTGCGCCAGGCCAACACTGG - Intergenic
1000622370 5:163500603-163500625 CCACTGCGCCTGGCCAGAATAGG + Intergenic
1001587101 5:172840370-172840392 CTCCCACGCCTGACAAAAACTGG - Intronic
1001608351 5:172980316-172980338 CTACTGCACCTGGCCAGAAGTGG + Intergenic
1001664735 5:173423127-173423149 CCACTGCGCCCTGCCAAAACTGG + Intergenic
1001811274 5:174630100-174630122 CCACCGCGCCCGACCAACACTGG - Intergenic
1002143176 5:177157408-177157430 CCACTGCGCCTGGCCAAAGAGGG - Intronic
1002257446 5:177968617-177968639 CCACCGCACCAGGCCAAGACTGG + Intergenic
1002489047 5:179560920-179560942 CCACCGCGCCTGGCCTAATAAGG - Intronic
1002515079 5:179751722-179751744 CTACTGTGCCTGGCCATAATCGG - Intronic
1002627209 5:180538396-180538418 CCACCGCGCCTGGCCTAAGAAGG - Intronic
1002803932 6:553202-553224 CAACCGTGCCTGGCCAGAAAGGG + Intronic
1003244246 6:4370765-4370787 CCACCGTGCCTGGCCAGAAGAGG + Intergenic
1003474848 6:6471900-6471922 CCACTGCGCCTGGACAACACTGG - Intergenic
1003550342 6:7097665-7097687 CCACTGCGCCTGGCCAAGAAAGG - Intergenic
1003916821 6:10794703-10794725 CCACCGCACCTGGCCAGAATAGG - Intronic
1004382424 6:15144035-15144057 CCACCGCGCCTGGCTCATACTGG - Intergenic
1004396887 6:15253348-15253370 CCACCGTGCCTGGCCAAATAAGG + Intronic
1004409828 6:15370626-15370648 CCACCGCGCCCGGCCATATCTGG + Intronic
1004485839 6:16065645-16065667 CCACCGCGCCTGGCTGAAATTGG + Intergenic
1004615477 6:17283702-17283724 CCACCGCGCCTGGCCCAAAATGG + Intronic
1004660047 6:17702218-17702240 CTACCTCGCCCGGCCAGAAATGG - Intronic
1004727707 6:18326973-18326995 CCACCGCGCCAGGCCAAAGCGGG + Intergenic
1005326854 6:24710549-24710571 CAACCGCGCCCGGCCCAAATTGG + Intronic
1005333119 6:24768088-24768110 CCACCACGCCTGGCCCAAAATGG - Intergenic
1005341115 6:24844762-24844784 CCACCGCGCCTGGCCCAAAATGG + Intronic
1005568639 6:27123187-27123209 CCACTGCGCCTGGCCAGAGCTGG - Intergenic
1005595071 6:27371066-27371088 CTACCGCTCCAGGCTAAAGCCGG + Intergenic
1005638045 6:27769754-27769776 CCACCGCGCCTGGCCAAAAATGG - Intergenic
1006078932 6:31552989-31553011 CCACCGCGCCAGGCCTAAAGGGG + Intronic
1006193914 6:32225797-32225819 CCACCGCACCTGGCCGATACTGG + Intergenic
1006216351 6:32446641-32446663 CCACCGCGCCTGGCCAAAAACGG - Intergenic
1006324538 6:33343599-33343621 CCACCACGCCTGGCCTACACTGG - Intergenic
1006537333 6:34710436-34710458 CCACCGCGCCCGGCCAAGAATGG - Intergenic
1006551788 6:34830098-34830120 CTACCGCGCCTGGCCTCCCCTGG + Intronic
1006902035 6:37509118-37509140 CCACTGCGCCTGGCCACAAATGG - Intergenic
1007357135 6:41329169-41329191 CCACTGTGCCTGGCCAAAAAGGG - Intergenic
1007534029 6:42568440-42568462 CCACCGCGCCTGGCCCAACATGG - Intronic
1008264762 6:49411253-49411275 CCACCGCGCCCGGCCGACACAGG + Intergenic
1008790993 6:55233376-55233398 CCACCACGCATGGCCAAAGCTGG + Intronic
1009025328 6:57992663-57992685 CCACCGCGTCCGGCCAAATCAGG + Intergenic
1009200895 6:60744111-60744133 CCACCGCGTCCGGCCAAATCAGG + Intergenic
1009460399 6:63905615-63905637 CCACCGCGCCTGGCCAAATAAGG + Intronic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1010309366 6:74365823-74365845 CCACCGCGCCTGGCCTATCCTGG - Intergenic
1010419182 6:75652547-75652569 CCACCGCGCCTGGCCACACAAGG - Intronic
1010751247 6:79618418-79618440 CCACGGCGCCTGGCCCAACCTGG - Intergenic
1010753894 6:79644870-79644892 CCACCGCGCCCGGCCAACTCAGG - Intronic
1011102208 6:83735321-83735343 CCACCGCGCCTGGCCTAAACTGG + Intergenic
1011201971 6:84846688-84846710 CCACCGTGCCTGGCCAAGAAAGG - Intergenic
1011257827 6:85442041-85442063 CCACCGCACCTGGCCGATACTGG - Intergenic
1011498596 6:87963777-87963799 CCACTGCGCCCGGCCAAAAGTGG - Intergenic
1011662565 6:89606880-89606902 CCACTGCACCTGGCCAAAAAAGG - Intronic
1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG + Intronic
1011902840 6:92321711-92321733 CTACCGCACCCAGCCCAAACAGG + Intergenic
1012468087 6:99537791-99537813 CCACCGCGCCTGGCCACACCTGG + Intergenic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1013244569 6:108274402-108274424 CCACTGCGCCTGGCCAAAGTGGG - Intergenic
1013283267 6:108658709-108658731 CCACCGTGCCTGGCCAACATTGG + Intronic
1013545968 6:111157567-111157589 CCACCGTGCCTGGCCAAACTTGG + Intronic
1013809844 6:114032222-114032244 CTACCGCGCCTGGCTTAATCAGG + Intergenic
1014333122 6:120096152-120096174 CCACCGCGCCCGGCCAAAAGTGG - Intergenic
1014626184 6:123729245-123729267 CCACCGCGCCCGGCCCTAACAGG - Intergenic
1014848200 6:126306416-126306438 CCACCATGCCTGGCCAAAGCTGG - Intergenic
1014981649 6:127952555-127952577 CCACCACGCCTGGCCTAAAGTGG - Intergenic
1015726214 6:136302142-136302164 CCACCGCACCTGGCCAGAAAGGG - Intergenic
1016458605 6:144258322-144258344 CCACCGAGCCTGGCCTAAATAGG - Intergenic
1016628744 6:146202906-146202928 CCACCGCGCCCGGCCAATTCAGG - Intronic
1016998888 6:149981664-149981686 CCACCGCGCCCGGCCCAAAACGG + Intergenic
1017026245 6:150183791-150183813 CCACCGTGCCCGGCCCAAACTGG + Intronic
1017147868 6:151250891-151250913 CCACTGCGCCCGGCCAAAAATGG + Intronic
1017187041 6:151611994-151612016 CCACTGCGCCTGGCCAAAACTGG + Intronic
1017449763 6:154544065-154544087 CCACCGCGCCTGGCCACGAAGGG - Intergenic
1018253742 6:161897692-161897714 CCACCGCGCCCGGCCGCAACTGG - Intronic
1018591097 6:165423578-165423600 CCACCGCGCCCGGCCTAATCTGG - Intronic
1018819898 6:167366328-167366350 TCACTGCGCCTGGCCCAAACTGG + Intronic
1019113895 6:169741092-169741114 CTACCACGTCTGGCCGAAAAAGG + Intronic
1019446760 7:1075224-1075246 CCACCGCCCCTGGCCTAAAATGG - Intronic
1019458188 7:1142930-1142952 CCACTGCGCCCGGCCAAAAAAGG + Intergenic
1019680793 7:2347927-2347949 CCACCACGCCTGGCCCACACTGG + Intronic
1019913253 7:4114410-4114432 CTGCCGAGTCTGGCCAAACCCGG - Intronic
1020019495 7:4854404-4854426 CCACCGCGCCCGGCCCAAAGTGG - Intronic
1020117766 7:5485762-5485784 CCACCGCGCCCGGCCACACCCGG - Intronic
1020185410 7:5955459-5955481 CCACCACGCCTGGCCAACCCTGG - Intronic
1020195122 7:6031884-6031906 CTACTGCGTCTGGCCAAAAAAGG - Intronic
1020297504 7:6769290-6769312 CCACCACGCCTGGCCAACCCTGG + Intronic
1020390831 7:7656120-7656142 CCACTGCGCCTGGCCAGGACAGG + Intronic
1020724917 7:11800259-11800281 CCACCGCGCCTGGCTCAAATAGG - Intronic
1020912101 7:14143632-14143654 CCACCGCGCCTGGCCAACAGTGG + Intergenic
1021674815 7:23069459-23069481 CCACCGCGCCTGGCCATAGCTGG - Intergenic
1021714844 7:23452289-23452311 CCACCGCACCTGGCCAGAATAGG + Intronic
1021721741 7:23511082-23511104 CCACCGCGCCTGGCCAAATAAGG - Intronic
1021831765 7:24619428-24619450 CTACCGCGCCCAGCCATAAATGG - Intronic
1021941198 7:25680424-25680446 CCACCACGCCTGGCCACACCTGG + Intergenic
1022598086 7:31731673-31731695 CCACTGCGCCTGGCCAGAATTGG + Intergenic
1022871713 7:34487027-34487049 CCACCGCGCCCGGCCAGAACTGG - Intergenic
1023446500 7:40237154-40237176 CCACCGCGCCTGGCCTACCCTGG - Intronic
1023735401 7:43231727-43231749 CCACCGCGCCTGGCCCCAAGAGG - Intronic
1023905433 7:44518455-44518477 CCACCGCACCTGGCCCAAAAAGG + Intronic
1023943854 7:44787768-44787790 CCACCGCACCTGGCCTAAATAGG - Intergenic
1024586327 7:50845042-50845064 CCACCGCGCCTGGCCATCATAGG - Intergenic
1025077671 7:55956991-55957013 CCACTGCGACTGGCCAAAAGGGG + Intronic
1025171895 7:56766380-56766402 CCACTGTGCCCGGCCAAAACAGG + Intergenic
1025699967 7:63809175-63809197 CCACTGTGCCCGGCCAAAACAGG - Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1025801696 7:64792863-64792885 CCACCGCGCCCGGCCATGACTGG + Intergenic
1025861599 7:65335966-65335988 GCACCGCGCCCGGCCAAGACTGG - Intergenic
1025994646 7:66520275-66520297 CTGCCGCGCCTGGCCACACTTGG + Intergenic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026279074 7:68905564-68905586 CCACCGCGCCTGGCCAATATTGG + Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026863741 7:73810453-73810475 CCACCGCGCCTGGCCACATCTGG + Intronic
1027049969 7:75015777-75015799 CCACCGCGCCTGGCCGAGGCAGG - Intronic
1027372506 7:77521084-77521106 CCACCACGCCTGGCCAAAAATGG + Intergenic
1027465987 7:78515611-78515633 CTACAGCGCCTGGCCAAACAAGG - Intronic
1027510800 7:79077268-79077290 CCACCGCGCCGGCCCAAAAAAGG - Intronic
1027710565 7:81595490-81595512 CCACCGCGCCTGGCCAAATTTGG + Intergenic
1028408799 7:90505695-90505717 CCACTGCGCCCGGCCGAAACAGG - Intronic
1028515404 7:91672765-91672787 CTACCATGCCTGGCCCAGACTGG - Intergenic
1028664241 7:93322310-93322332 CCACCGCGCCCGGCCTAAATTGG - Intronic
1028955996 7:96691056-96691078 CCACTGCGCCTGGCCTATACTGG + Intronic
1028978743 7:96943336-96943358 GTACCGTGCCTGGCCCAAATTGG - Intergenic
1028989834 7:97036974-97036996 CCACCGCACCTGGCCCAAACTGG + Intergenic
1029135882 7:98370786-98370808 CCACCGCGCCTGGCCAATTTTGG + Intronic
1029231313 7:99071345-99071367 CCACCGCGCCCGGCCAAAAACGG + Intronic
1029292889 7:99516128-99516150 CCACCACGCCTGGCCACATCTGG + Intronic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029364912 7:100110522-100110544 CCACTGCACCTGGCCACAACTGG - Intronic
1029383069 7:100225893-100225915 CCACCGCGCCTGGCCAAGGCAGG + Intronic
1029415046 7:100437126-100437148 CCACCGCACCTGGCCATAAATGG + Intergenic
1029417781 7:100454264-100454286 CCACCGCGCCTGGCCACACCCGG - Intergenic
1029418682 7:100460300-100460322 CCACAGCGCCTGGCCAAGAGTGG - Intronic
1029571107 7:101370146-101370168 CCACCGCGCCTGGCCTGAAGAGG + Intronic
1029597310 7:101544818-101544840 CCACAACACCTGGCCAAAACAGG + Intronic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1029924098 7:104297568-104297590 CCACCGCGCCTGGCCAAAAAGGG - Intergenic
1030022855 7:105292993-105293015 CCACCACGCCTGGCCAAGCCTGG - Intronic
1030057869 7:105599282-105599304 CCACTACGCCTGGCCAAGACTGG - Intronic
1030208499 7:106973523-106973545 CCACCCCGCCTGGCCTAAAAAGG + Intergenic
1030302415 7:107987787-107987809 CCCCCGCGCCTGGGCCAAACTGG + Intronic
1030307083 7:108029830-108029852 CCACCACGCCTGGCCAAGAAAGG - Intronic
1030872837 7:114778448-114778470 CTATCGCGCCTGGCCAAAAATGG + Intergenic
1030990056 7:116288745-116288767 CCACCGCGCCTGGCCAAATCAGG + Intronic
1032164517 7:129534813-129534835 CCACCGCGCCTGGCCAGAGGAGG - Intergenic
1032599391 7:133277112-133277134 CCACCACGCCTGGCTATAACTGG + Intronic
1032626145 7:133593032-133593054 CCACCGTGCCTGGCCTAAATTGG + Intronic
1032816009 7:135474562-135474584 CCACGGCGCCTGGACTAAACAGG + Intronic
1032955204 7:136962420-136962442 CCACTGCGCCCGGCCACAACTGG + Intronic
1033037379 7:137887419-137887441 CCACCGCGCCTGGCCCAGAAAGG - Intronic
1033059859 7:138095811-138095833 CCACTGCGCCTGGCCAAATTAGG + Intronic
1033105920 7:138523466-138523488 CCACCTCGCCCGGCCAAAAGGGG - Intronic
1033160009 7:138987127-138987149 CCACCACGCCTGGCCAAAAAAGG - Intergenic
1033228251 7:139577437-139577459 CCACCGCGCTGGGCCAACACTGG + Intronic
1033349512 7:140550745-140550767 CCACCGCGCCTGGCCTCAATGGG + Intronic
1033430546 7:141285443-141285465 CCACTGCGCCTGGCCAATTCAGG + Intronic
1033787236 7:144747496-144747518 CCACCGCGCCTGGCCTAAAGTGG - Intronic
1033965746 7:146973313-146973335 CCACCGCGCCTGGCCCACACTGG + Intronic
1034145428 7:148867037-148867059 CCACCACGCCTGGCCAAGACTGG - Intronic
1034171151 7:149064384-149064406 CCACCGCGCCCGGCCATAATTGG + Intergenic
1034175699 7:149097984-149098006 CCACCGCGCCCGGCCAAAATGGG + Intergenic
1034261621 7:149760322-149760344 CCACCGCGCCTGGCCAACCTGGG - Intergenic
1034652332 7:152701303-152701325 CCACCGCGCCTGGCCACACCCGG - Intergenic
1035147582 7:156835405-156835427 CCACTGCGCCTGGCCAAGACTGG - Intronic
1035349343 7:158235047-158235069 CCACCGGGCCTGGCCCAAAATGG + Intronic
1035473088 7:159123005-159123027 CTACTGCGCCCGGCCGACACTGG - Intronic
1035605051 8:924871-924893 CCACCGCGCCTGGCCAATCCAGG + Intergenic
1035713151 8:1733843-1733865 CCACCGCGCCTGGCCCAATTAGG - Intergenic
1036525972 8:9535200-9535222 CCACCGCGCCCGGCCAAAATGGG - Intergenic
1037633593 8:20679988-20680010 CCACCACACCTGGCCAAGACAGG - Intergenic
1037794365 8:21979330-21979352 CCACCACACCTGGCCAAAGCTGG + Intronic
1037939615 8:22941784-22941806 CCACCGCACCTGGCCATCACGGG + Intronic
1038503639 8:28065445-28065467 CCACCGCGCCTGGCCGAAATTGG + Intronic
1038818843 8:30933522-30933544 CCACCGCGCCTGGCCCAAAGTGG + Intergenic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039856618 8:41420724-41420746 CCACCGCGCCTGGCCATATGGGG + Intergenic
1039878878 8:41610937-41610959 CCACCGTGCCTGGCCACCACTGG - Intronic
1040441474 8:47447499-47447521 CCACCGCGCCTGGCCAGAAACGG + Intronic
1040513815 8:48118253-48118275 CTACCATGCCTGGCCAGCACTGG + Intergenic
1040767359 8:50928983-50929005 CCACCGCGCCTGGCCAAGGCTGG + Intergenic
1041268781 8:56090167-56090189 CTACCACACCTGACCAAACCAGG - Intergenic
1042222526 8:66487401-66487423 CTACCGTGCCTGGCCACAGTGGG - Intronic
1042258369 8:66830141-66830163 CCACTGTGCCTGGCCAAAAATGG + Intronic
1042308928 8:67360390-67360412 CCACTGCACCTGGCCACAACTGG - Intergenic
1042674072 8:71299195-71299217 GTACTGACCCTGGCCAAAACTGG + Exonic
1042876179 8:73442065-73442087 CCACTGCGCCTGGCCTAAATGGG - Intronic
1042900279 8:73719114-73719136 CCACCACACCTGGCCAAAACTGG - Intronic
1043110610 8:76175353-76175375 CCACTGCACCTGGCCAAAAGAGG + Intergenic
1043872319 8:85447607-85447629 CCATCGTGCCTGGCCAATACTGG - Intronic
1043988396 8:86721260-86721282 CCACCGCACCTGGCCAGAATTGG + Intronic
1044659642 8:94582484-94582506 CCACCACGCCTGGCCACACCTGG + Intergenic
1044694656 8:94910438-94910460 CCACCGCGCCTGGCCTGAACTGG + Intronic
1045229460 8:100288771-100288793 CCACCGCGCCTGGCCTATATGGG - Intronic
1045282439 8:100760816-100760838 CTACCACGCCTGGCCCTACCTGG - Intergenic
1045331881 8:101162298-101162320 CTACCGCACCCGGCCAGGACAGG + Intergenic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1045632793 8:104146075-104146097 CCACCGAGCCTGGCCCAAAAGGG - Intronic
1045721925 8:105122578-105122600 CCACCGCGCCTGGCCATAGGTGG - Intronic
1045782284 8:105881098-105881120 CCACCGCGCCTGGCCACAAAAGG + Intergenic
1045808572 8:106194404-106194426 CCACCGCGCCTGGCCTAAAATGG + Intergenic
1046004863 8:108466739-108466761 CCACTGCACCTGGCCAAAATTGG + Intronic
1046264184 8:111810002-111810024 CCACCACACCTGGCCAAAAAAGG - Intergenic
1046402921 8:113730621-113730643 CCACTGCGCCTGGCCCATACTGG + Intergenic
1047279090 8:123429575-123429597 CCACCGCACCTGGCCAAGACAGG - Intronic
1047291096 8:123531267-123531289 CCACCGCACCCGGCCAAAACAGG + Intronic
1047492373 8:125385750-125385772 CCACTGCGCCTGGTCGAAACTGG + Intergenic
1047645756 8:126868018-126868040 CCACCACGCCCGGCCAGAACTGG + Intergenic
1047673211 8:127171517-127171539 CCACCACACCTGGCCATAACAGG - Intergenic
1048153608 8:131919308-131919330 CCACTGCACCCGGCCAAAACAGG - Intronic
1048892869 8:138963428-138963450 CCACCGCTCCTGGCCACCACTGG + Intergenic
1049633205 8:143670666-143670688 CCACTGCGCCTGGCCACACCTGG + Intergenic
1049725794 8:144145387-144145409 CCACCGCGCCCGGCCCAAGCTGG - Intergenic
1049732118 8:144183932-144183954 CCACCGCGCCTGGCCAGACAAGG + Intronic
1049847407 8:144809762-144809784 CTACCGCGCCCGGCCAGGAGAGG - Intronic
1049914117 9:299732-299754 CCACCGCGCCCGGCCATAATGGG - Intronic
1050039328 9:1472349-1472371 CTACGGCCCCAGGCCAAATCTGG + Intergenic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050273019 9:3966506-3966528 TCACCGCGCCTGGCCTAAAGAGG - Intronic
1050317619 9:4419500-4419522 CCACCGCACCTGGCCAGAGCTGG - Intergenic
1050382241 9:5042422-5042444 CCACCGCGCCCGGCCAAGACTGG + Intronic
1050430270 9:5555125-5555147 CCACCGCACCTGGCCAATAATGG - Intronic
1050452420 9:5797360-5797382 CCACCACGCCCGGCCAAAGCTGG - Intronic
1050534055 9:6615898-6615920 CCACCGCACCTGGCCTAATCAGG + Intronic
1051129188 9:13840781-13840803 CCACCGCGCCCGGCCTAAACAGG - Intergenic
1051400431 9:16675777-16675799 CCACCGAGCCCGGCCAAAGCTGG - Intronic
1051444608 9:17127015-17127037 CCACCGCGCCTGGCCTCATCTGG + Intergenic
1051504562 9:17813167-17813189 CCACCGCGCCTGGCTATGACTGG - Intergenic
1051650800 9:19322472-19322494 CCACCGCGCCTGGCCTCCACTGG - Intronic
1051807572 9:21012773-21012795 CCACCACGGCTGGCCAAAAGTGG - Intronic
1051833314 9:21306357-21306379 CCACCGCGCCTGGCCTAATTTGG - Intergenic
1052019651 9:23510622-23510644 CCACCGCACCCAGCCAAAACTGG + Intergenic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052526409 9:29625000-29625022 CCACCGCGCCCGGCCAAGCCTGG + Intergenic
1052832215 9:33225238-33225260 CTACTGTGCCTGGCCATAAGAGG + Intronic
1052838960 9:33274901-33274923 CCACCGCGCCTGGCCAGATATGG + Intronic
1052839451 9:33279574-33279596 CCACCGCGCCTGGCCGCTACAGG - Intronic
1052965974 9:34340962-34340984 CCACCACGCCTGGCCAGAAGCGG + Intronic
1053301426 9:36953783-36953805 CTACTGCACCTGGCCAAGATAGG - Intronic
1053328094 9:37175414-37175436 CCACCACGCCTGGCCTAAAATGG - Intronic
1053508002 9:38661310-38661332 CCACCGCACCTGGCCAATAGTGG + Intergenic
1053622429 9:39833314-39833336 CCACCGCGCCTGGCCAAGTGAGG + Intergenic
1053640031 9:40064244-40064266 CCACCGCGCCCGGCCAAATTTGG + Intergenic
1053766101 9:41401238-41401260 CCACCGCGCCCGGCCAAATTTGG - Intergenic
1053813778 9:41882765-41882787 CCACCGCGCCCGGCCGAAAAAGG + Intergenic
1054544716 9:66312391-66312413 CCACCGCGCCCGGCCAAATTTGG - Intergenic
1054616818 9:67304675-67304697 CCACCGCGCCCGGCCGAAAAAGG - Intergenic
1054833984 9:69657130-69657152 CCACCGCGCCCGGCCTAACCGGG + Intronic
1054916201 9:70497402-70497424 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1055406359 9:75977896-75977918 CCACCGCGCCCGGCCAAGAGTGG + Intronic
1055515485 9:77029306-77029328 CCACTGCGCCTGTCCAAAGCAGG - Intergenic
1055959611 9:81808033-81808055 CCACCGCGCCTGGCCTATAGTGG + Intergenic
1056096979 9:83265111-83265133 CCACCGCACCTGGCCGACACGGG - Intronic
1056116493 9:83446358-83446380 CCACCGCGCCCGGCCAACAGAGG - Intronic
1056116611 9:83447308-83447330 CCACCGCGCCCGGCCAGATCAGG + Intronic
1056360971 9:85857134-85857156 CCACCGCGCCTGGCCTCATCTGG - Intergenic
1056926723 9:90840470-90840492 CCACCGCGCCCGGCCAAGGCGGG + Intronic
1057395265 9:94674434-94674456 CCACTGTGCCTGGCCAAAAGAGG - Intergenic
1057613773 9:96569873-96569895 CCACCGCGCCTGGCCGAAACAGG + Intronic
1057774834 9:97999092-97999114 CCACCGCGCCCGGCCGAAAGTGG + Intronic
1057862043 9:98648418-98648440 CCACCGCACCTGGCCCATACAGG + Intronic
1057989856 9:99757468-99757490 CCACCGCACCTGGCCAAGCCTGG - Intergenic
1058145422 9:101405786-101405808 CCACCGTGCCTGGCCTAAAATGG - Intronic
1058182815 9:101818372-101818394 CCACTGCGCCTGGCCAATAGTGG + Intergenic
1058313587 9:103535949-103535971 CCACCGCGCCTGGCCGCAATGGG - Intergenic
1058322138 9:103645670-103645692 CCACCGCGCCCGGCCAAGACTGG + Intergenic
1058391251 9:104497957-104497979 CCACTGCGCCTGGCCAAATGTGG - Intergenic
1058621526 9:106888326-106888348 CCACCGCGCCCGGCCAAATGTGG + Intronic
1058691350 9:107523197-107523219 CCACCGCGCCTGGTCACACCTGG - Intergenic
1058739071 9:107924368-107924390 CCACCACACCTGGCCAAAAGAGG - Intergenic
1059577831 9:115509934-115509956 CCACCGCACCTGGCCAAGAATGG + Intergenic
1059642584 9:116232039-116232061 CCACCGCACCTGGCCAACAGTGG + Intronic
1060637775 9:125212953-125212975 CCACTGCACCTGGCCAATACAGG + Intronic
1060710491 9:125858911-125858933 CCACCGCGCCTGGCCAACTTTGG + Intronic
1060733293 9:126051091-126051113 CCACCGCACCTGGCCAAAATGGG - Intergenic
1061091030 9:128426335-128426357 CCACCGCACCTGGCCAGGACTGG - Intronic
1061094475 9:128447294-128447316 CCACCACGCCTGGCCTAAAAAGG - Intergenic
1061097863 9:128470341-128470363 CCACCACGCCTGGCCAAGAAGGG - Intronic
1061334907 9:129926597-129926619 CCACTGCACCCGGCCAAAACAGG - Intronic
1061381020 9:130257691-130257713 CCACTGTGCCTGGCCAAAGCAGG - Intergenic
1061692270 9:132343030-132343052 CCACCGCGCCCGGCAAAAAAGGG - Intronic
1061982373 9:134113578-134113600 CCACCGCGCCCGGCCAAAAGTGG + Intergenic
1062021380 9:134321009-134321031 CAACCTCGCCTGGCCTAAGCAGG - Intronic
1062336696 9:136074161-136074183 CCACCGCGCCTGGCCATGCCTGG - Intronic
1062472134 9:136710910-136710932 CCACCGTGCCTGGCCACACCAGG - Intergenic
1062504594 9:136866484-136866506 CTACCGCGCCTCGCCAGGCCAGG - Intronic
1062550808 9:137085662-137085684 CCACCGCGCCTGGCCCCAAGGGG + Intergenic
1062687541 9:137822605-137822627 CCACTGCGCCCGGCCCAAACTGG - Intronic
1185498924 X:583192-583214 CCACCGCGCCCGGCCAAAAATGG + Intergenic
1185526688 X:785667-785689 CCACCGCGCCAGGCCAACAATGG + Intergenic
1185560486 X:1056841-1056863 CCACCACGCCTGGCCAAGTCTGG + Intergenic
1185643843 X:1603104-1603126 CCACCGCGCCCGGCCAAAGACGG + Intergenic
1185656368 X:1688898-1688920 CCACCGCGCCCAGCCAAAACAGG - Intergenic
1185696793 X:2201003-2201025 CCACCGCGCCCGGCCTAAAATGG - Intergenic
1185702851 X:2244056-2244078 CCACCGCGCCTGGCCACATGTGG + Intronic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1185816670 X:3162864-3162886 TTACCGCACCTGGCCGAAAGTGG - Intergenic
1185866364 X:3627749-3627771 CCACTGTGCCTGGCCAAAAAGGG + Intronic
1185885230 X:3776541-3776563 CCACCGCGCCTGGCCAACTATGG - Intergenic
1186100280 X:6148799-6148821 CCACCGCGCCTGGCCTGCACTGG + Intronic
1187062036 X:15795833-15795855 CCACTGCGCCTGGCCTGAACAGG - Intronic
1187160990 X:16764984-16765006 CCACTGCACCTGGCCAAAAGTGG + Exonic
1187163084 X:16782181-16782203 CCACCGTGCCTGGCCAGAAATGG + Intergenic
1187166692 X:16810965-16810987 CTACCGTGCCTGGCCAATAGTGG + Intronic
1187387005 X:18858046-18858068 CCACCGCGCCCGGCCAAAAATGG + Intergenic
1187402410 X:18973290-18973312 CCACCGCGCCTGGCCTTAAGAGG + Intronic
1187654015 X:21449015-21449037 CCAACGCGCCTGGCCCAATCTGG - Intronic
1187696549 X:21928353-21928375 CCACCGCGCCTGGCCTTATCTGG + Intergenic
1187794910 X:22993177-22993199 CCACCGCGCTGGGCCAAAAAGGG + Intergenic
1187914418 X:24140010-24140032 CCACTGCACCTGGCCAAGACAGG + Intergenic
1188008255 X:25032714-25032736 CCACCGCGCCTGGCCTAACTTGG + Intergenic
1188067273 X:25677995-25678017 CCACTGCACCTGGCCTAAACTGG + Intergenic
1188206281 X:27363228-27363250 CCACCGTGCCCGGCCAAGACTGG + Intergenic
1188311036 X:28616717-28616739 CCACCGCGCCCGGCCAGAAAAGG + Intronic
1189295668 X:39915793-39915815 CCACCGCGCCTGGCCAACATAGG - Intergenic
1189793647 X:44626609-44626631 CCACCACACCTGGCCAATACTGG + Intergenic
1190228501 X:48563508-48563530 CCACCGCACCCAGCCAAAACTGG + Intergenic
1190410188 X:50129443-50129465 CCACTGCGCCTGGCCAGAAAAGG + Intergenic
1190492139 X:50992835-50992857 CCACCGCACCTGGCCTAATCTGG + Intergenic
1190549266 X:51562486-51562508 CCACCGTGCCTGGCCTAAAATGG - Intergenic
1190692817 X:52926053-52926075 CCACCACGCCTGGCAAAACCTGG + Intergenic
1190867364 X:54396166-54396188 CCACCGCGCCTGGCCAAGGAAGG + Intergenic
1192017021 X:67342078-67342100 CCACCGCACCTGGCCATAATTGG + Intergenic
1192120906 X:68454800-68454822 CCACCGAGCCTGGCCTAAAAAGG + Intergenic
1192372107 X:70522828-70522850 CCACCGCGCCTGGCCGACAGAGG + Intergenic
1192478746 X:71466663-71466685 CCACCGCGCCCAGCCAAGACGGG + Intronic
1193593166 X:83414684-83414706 CCACCGCGCCTGGCCTAAAATGG + Intergenic
1193990850 X:88305249-88305271 CCACCGCGCCTGGCCGAGGCGGG - Intergenic
1195135591 X:101904653-101904675 CCACCGCACCTGGCCAAGGCTGG - Intronic
1195264117 X:103163800-103163822 CCACCGCGCCTGGCCGAATCTGG - Intergenic
1195873809 X:109516840-109516862 CCACCGCGCCTGGCCAACATAGG - Intergenic
1196212720 X:113013271-113013293 CCACCGCACCTGGCCCAAAATGG + Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1197166602 X:123384335-123384357 CCACCACGCCTGGCCGAAAAGGG - Intronic
1197512621 X:127389826-127389848 CCACCGCGCCCGGCCGGAACAGG + Intergenic
1197785492 X:130193121-130193143 CCACCGCGCCCGGCCAATCCTGG - Intergenic
1198150387 X:133902955-133902977 CTACCGCACCCGGCCTAAAATGG - Intronic
1198473885 X:136976765-136976787 CCACCGTGCCTGGCCAACGCAGG + Intergenic
1198744339 X:139874345-139874367 CCACCGCGCCTGGCACAATCAGG + Intronic
1198745501 X:139886301-139886323 CCACCGCGCCTGGCCACAACTGG - Intronic
1199158918 X:144585305-144585327 CCACTGCGCCCAGCCAAAACTGG - Intergenic
1201500401 Y:14635877-14635899 CTACCACACCTGGCCGAAAGTGG + Intronic
1201648065 Y:16257634-16257656 CCACCGCGCCCGGCCAGGACCGG - Intergenic
1201654745 Y:16327667-16327689 CCACCGCGCCCGGCCAGGACCGG + Intergenic
1202046626 Y:20742218-20742240 CCACCACACCTGGCCAAAAATGG - Intergenic
1202053812 Y:20808109-20808131 CCACCGCGCCTGGCCCTGACTGG - Intergenic