ID: 1151274878

View in Genome Browser
Species Human (GRCh38)
Location 17:73026820-73026842
Sequence AACTGAAGGCGGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 754
Summary {0: 1, 1: 0, 2: 4, 3: 102, 4: 647}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151274862_1151274878 25 Left 1151274862 17:73026772-73026794 CCTCCCCACCCTACCCATCAACC 0: 1
1: 1
2: 2
3: 91
4: 1315
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647
1151274863_1151274878 22 Left 1151274863 17:73026775-73026797 CCCCACCCTACCCATCAACCCAC 0: 1
1: 0
2: 1
3: 45
4: 615
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647
1151274860_1151274878 29 Left 1151274860 17:73026768-73026790 CCCTCCTCCCCACCCTACCCATC 0: 1
1: 2
2: 16
3: 254
4: 1764
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647
1151274869_1151274878 12 Left 1151274869 17:73026785-73026807 CCCATCAACCCACCAGGAGAAAA 0: 1
1: 0
2: 0
3: 20
4: 262
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647
1151274861_1151274878 28 Left 1151274861 17:73026769-73026791 CCTCCTCCCCACCCTACCCATCA 0: 1
1: 0
2: 16
3: 660
4: 1710
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647
1151274864_1151274878 21 Left 1151274864 17:73026776-73026798 CCCACCCTACCCATCAACCCACC 0: 1
1: 0
2: 2
3: 55
4: 521
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647
1151274871_1151274878 4 Left 1151274871 17:73026793-73026815 CCCACCAGGAGAAAAATCACTGT 0: 1
1: 0
2: 2
3: 21
4: 225
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647
1151274873_1151274878 0 Left 1151274873 17:73026797-73026819 CCAGGAGAAAAATCACTGTTTTA 0: 1
1: 0
2: 5
3: 43
4: 405
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647
1151274870_1151274878 11 Left 1151274870 17:73026786-73026808 CCATCAACCCACCAGGAGAAAAA 0: 1
1: 0
2: 2
3: 108
4: 937
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647
1151274868_1151274878 16 Left 1151274868 17:73026781-73026803 CCTACCCATCAACCCACCAGGAG 0: 1
1: 0
2: 2
3: 23
4: 238
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647
1151274872_1151274878 3 Left 1151274872 17:73026794-73026816 CCACCAGGAGAAAAATCACTGTT 0: 1
1: 0
2: 4
3: 29
4: 251
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647
1151274865_1151274878 20 Left 1151274865 17:73026777-73026799 CCACCCTACCCATCAACCCACCA 0: 1
1: 0
2: 2
3: 73
4: 747
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647
1151274867_1151274878 17 Left 1151274867 17:73026780-73026802 CCCTACCCATCAACCCACCAGGA 0: 1
1: 0
2: 1
3: 12
4: 246
Right 1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG 0: 1
1: 0
2: 4
3: 102
4: 647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151274878 Original CRISPR AACTGAAGGCGGGCCAGGTG TGG Intronic
900461958 1:2805871-2805893 ACCTGCAGATGGGCCAGGTGTGG - Intergenic
900732919 1:4274529-4274551 AACTATAAACGGGCCAGGTGTGG - Intergenic
901373401 1:8819187-8819209 AATTGAATGTGGGCCGGGTGCGG - Intergenic
901456363 1:9365145-9365167 AAATGAAAACAGGCCAGGTGTGG - Intronic
901486719 1:9568559-9568581 AAATGAAGTCTGGCCGGGTGCGG + Intronic
902148912 1:14426533-14426555 AACTGCAGTTGGGCCAGCTGGGG - Intergenic
902563320 1:17292529-17292551 AAATGTAGTTGGGCCAGGTGTGG - Intergenic
902575315 1:17373780-17373802 AAGTGATGGTAGGCCAGGTGTGG - Intronic
902591017 1:17474694-17474716 AACAAAAGTTGGGCCAGGTGAGG - Intergenic
903485348 1:23685838-23685860 AACAGAAGGATGGCCAGGCGTGG + Intergenic
903600319 1:24533507-24533529 TACTAAATGAGGGCCAGGTGTGG + Intronic
903914559 1:26754095-26754117 AAGTTCAGTCGGGCCAGGTGTGG - Intronic
904134229 1:28298798-28298820 AAGAGAAGGCAGGCCGGGTGCGG + Intergenic
904152747 1:28455845-28455867 AACTGAGTCAGGGCCAGGTGTGG + Intronic
904431062 1:30464685-30464707 AAGTGAAGATGGGCCGGGTGTGG + Intergenic
905599810 1:39240040-39240062 AAGTGTAAGTGGGCCAGGTGTGG - Intronic
905777442 1:40678115-40678137 AAAGGAAGCAGGGCCAGGTGCGG + Intergenic
905899755 1:41573749-41573771 AACTGAGGGCGGGAGAGCTGGGG + Intronic
905969716 1:42132250-42132272 AGCAGCAGGAGGGCCAGGTGTGG + Intergenic
906023321 1:42650916-42650938 AACTGACTGTAGGCCAGGTGTGG - Intronic
906308366 1:44735781-44735803 AAAAGAAGGTGGGCCAGCTGTGG - Intergenic
906392320 1:45429158-45429180 AACTGAAAGCTCGCCAGGTGCGG + Intronic
906612993 1:47216126-47216148 CCCTGAAGGCAGGCCTGGTGGGG - Intergenic
906771722 1:48491111-48491133 AACGGCAAGCTGGCCAGGTGTGG + Intergenic
907460457 1:54602435-54602457 AACTGAGGTCTGGCCAGGGGAGG + Intronic
909612771 1:77570386-77570408 AACTGAGGATAGGCCAGGTGTGG - Intronic
909663348 1:78107532-78107554 AAAGGAAGGCTGGCCAAGTGTGG + Intronic
910115280 1:83724850-83724872 AACTGGAGGAGGGCCTGGTTTGG + Intergenic
911111692 1:94195087-94195109 AACTGGAAGCTGGCCAGGAGTGG + Intronic
911214901 1:95181907-95181929 GATTGAAGGCCTGCCAGGTGCGG - Intronic
911597559 1:99814289-99814311 AACTGAAATCCGGACAGGTGAGG - Intergenic
911671770 1:100615721-100615743 AAGTGAAAGTGGGCCAGGCGCGG - Intergenic
912997710 1:114547933-114547955 AAGTGAAATTGGGCCAGGTGCGG - Intergenic
915612362 1:157004644-157004666 AACTGAAGACGGGTGGGGTGAGG + Intronic
915893017 1:159788930-159788952 AAGTGAGGACTGGCCAGGTGCGG - Intergenic
916052887 1:161048521-161048543 AACTGAAGGAGGAGCAGGGGAGG - Exonic
916212647 1:162371297-162371319 AACTTGATGCTGGCCAGGTGTGG - Intronic
916225307 1:162483833-162483855 AACTGAAGCAAAGCCAGGTGTGG - Intergenic
916676129 1:167065736-167065758 TAGTGAGGGCTGGCCAGGTGTGG + Intronic
917163956 1:172090674-172090696 AACTGAAGGTGGGCAGGGGGTGG - Intronic
918369879 1:183849239-183849261 AACTGAAAACTGGCCAGGCGTGG - Intronic
920043589 1:203119384-203119406 ACCTGTACGTGGGCCAGGTGTGG + Intronic
920218964 1:204381976-204381998 AACTCAGTGAGGGCCAGGTGTGG + Intergenic
920492294 1:206426091-206426113 AAGTGAGGTTGGGCCAGGTGAGG - Intronic
920530319 1:206697170-206697192 AACTGAGGGAGGGACAGATGTGG + Intronic
921093617 1:211867170-211867192 AAGTGAACTTGGGCCAGGTGTGG - Intergenic
921156502 1:212443029-212443051 AATGGAAGGAAGGCCAGGTGTGG - Intronic
921695326 1:218202891-218202913 GACTGAATCTGGGCCAGGTGTGG - Intergenic
921860228 1:220035536-220035558 AAATCAAGGCTGGCCAAGTGTGG + Intronic
922134241 1:222809137-222809159 AACAGAAAGTGGGCCAGGTGTGG - Intergenic
922319209 1:224470608-224470630 AACTGAAAGAGGGCTGGGTGTGG - Intronic
922329068 1:224557745-224557767 AACTGGTTGAGGGCCAGGTGTGG - Intronic
923153200 1:231253257-231253279 AACTGGAGGTAGGCCGGGTGTGG - Intronic
923599497 1:235389619-235389641 AACTAAATGCAGGCCAGGCGTGG - Intronic
923657737 1:235932877-235932899 AAGTGAAAGCCGGCCAGGTGCGG + Intergenic
923856254 1:237848439-237848461 AACTGAAGAGGGGCCGGGCGCGG - Intergenic
924212021 1:241779533-241779555 AAATGAATATGGGCCAGGTGTGG + Intronic
924266883 1:242291514-242291536 AACTGACAACGGGCCAGGTGCGG + Intronic
924319316 1:242831528-242831550 AAGTGGAGACTGGCCAGGTGTGG + Intergenic
924326852 1:242903654-242903676 AACAGCAGGCAAGCCAGGTGCGG + Intergenic
924668928 1:246103465-246103487 AAGAGATGGGGGGCCAGGTGAGG - Intronic
924738212 1:246778317-246778339 AAGATAAGGCAGGCCAGGTGTGG - Intergenic
1063120426 10:3101959-3101981 AACTGAAGTTGGGCCGGGCGCGG + Intronic
1063456069 10:6183496-6183518 AACTGGAGTCTGGCCTGGTGTGG + Intronic
1063648041 10:7905589-7905611 AACTTAAGCAGGGCCAGGCGCGG + Intronic
1064571178 10:16694867-16694889 AACTGCATGTCGGCCAGGTGTGG - Intronic
1065309818 10:24404276-24404298 AACTAAAAGTGGGCCGGGTGCGG + Intronic
1065345669 10:24745822-24745844 AACTGAAACAGGGCCAGGCGCGG + Intergenic
1065352173 10:24805578-24805600 AACTAAAAATGGGCCAGGTGTGG + Intergenic
1066077888 10:31898538-31898560 AAATGCAGTTGGGCCAGGTGCGG - Intronic
1066717937 10:38306989-38307011 AACTGACAATGGGCCAGGTGCGG - Intergenic
1067107994 10:43378247-43378269 AACTGATGGGAGGCCAGGTCTGG + Intergenic
1067687033 10:48471916-48471938 AACAGCAGCTGGGCCAGGTGCGG + Intronic
1069154026 10:65001776-65001798 AACTAAAGACAGGCCAGGCGCGG - Intergenic
1069505719 10:68996268-68996290 AAATAAAGGTGGGCCGGGTGTGG + Intronic
1069659690 10:70115474-70115496 AAATAAATGCAGGCCAGGTGTGG + Intronic
1070026912 10:72640569-72640591 AATTGAAGCTCGGCCAGGTGTGG + Intergenic
1070164935 10:73890159-73890181 AGCTGGAGGATGGCCAGGTGCGG - Intergenic
1070866007 10:79708590-79708612 GACAGATGGCGGGACAGGTGTGG + Intronic
1072044493 10:91641286-91641308 AAAAGAAGACGGGCCAGGTGCGG + Intergenic
1072188046 10:93060808-93060830 GACTGGAGGAGGGACAGGTGGGG + Intergenic
1072213224 10:93266017-93266039 CACTGAAGAAAGGCCAGGTGAGG + Intergenic
1072321007 10:94250209-94250231 AAAAGAAGGTAGGCCAGGTGCGG + Intronic
1072880401 10:99221133-99221155 AACTGAAAGCCGGCCAAGTGCGG - Intronic
1072890629 10:99320911-99320933 ATCTCATGGAGGGCCAGGTGTGG + Intergenic
1073191836 10:101656906-101656928 AAGTGTAGGGGGGACAGGTGGGG - Intronic
1074328270 10:112474745-112474767 AACTGAATGCAGGCCAGGCATGG - Intronic
1074410126 10:113221141-113221163 AACTGAAAGTGTGCCAGTTGGGG - Intergenic
1075129006 10:119722626-119722648 AATAGAAGGCGGGAAAGGTGGGG + Intergenic
1075333665 10:121593739-121593761 AACTGAAGGAGGGCCGGGCCAGG + Exonic
1075851357 10:125590404-125590426 AAGAGAAGGAGGGCCAGGCGTGG - Intronic
1075889156 10:125930625-125930647 CAATGAAGATGGGCCAGGTGCGG - Intronic
1076068881 10:127470150-127470172 AACTGAAGCCTGGCCAGGGGCGG - Intergenic
1076819987 10:132933456-132933478 AACTGAAGTCCGGCCAAGCGTGG - Intronic
1077087758 11:763196-763218 AGGTGAGGGCGGGGCAGGTGAGG - Intronic
1077087806 11:763306-763328 AGGTGAGGGCGGGGCAGGTGAGG - Intronic
1077328306 11:1973119-1973141 GAGGGCAGGCGGGCCAGGTGGGG - Intronic
1077626620 11:3777906-3777928 TACTGATGGCAGGCCAGGCGCGG + Intronic
1078073075 11:8131608-8131630 AAGTGAATAGGGGCCAGGTGCGG + Intronic
1078094941 11:8290971-8290993 AACTGAAGACTGGCCAAGGGAGG - Intergenic
1078229720 11:9429222-9429244 AAGTGAATGTTGGCCAGGTGCGG + Intronic
1078935705 11:15948300-15948322 AACTGACGGAGGCCTAGGTGGGG - Intergenic
1080367893 11:31598242-31598264 AAGAAAAGGCTGGCCAGGTGCGG - Intronic
1080852731 11:36084330-36084352 TTCTGAAGCCGGGCGAGGTGGGG + Intronic
1081524838 11:43920316-43920338 AAATGAAGGCGGGGCGTGTGGGG - Intergenic
1081553076 11:44132024-44132046 AACACAAAGTGGGCCAGGTGTGG - Intronic
1082020345 11:47527803-47527825 AACACAAAGCAGGCCAGGTGTGG + Intronic
1082119393 11:48361975-48361997 AACTGCATCCAGGCCAGGTGTGG - Intergenic
1082254904 11:50023180-50023202 AACTGCATCCAGGCCAGGTGTGG + Intergenic
1083079673 11:60077715-60077737 AAATGAAGGAGGGCTGGGTGTGG + Intergenic
1083401069 11:62423873-62423895 AACTGAGGGCAGGGAAGGTGGGG - Intergenic
1083998761 11:66284798-66284820 AACTGAAGCCTGGCCAGGAGGGG + Intronic
1084428518 11:69098588-69098610 TACTAAAAGGGGGCCAGGTGCGG - Intergenic
1084859759 11:72010771-72010793 AGCTGAAGGTGGGGCAGCTGGGG - Exonic
1085321787 11:75578922-75578944 AGATTAAGGAGGGCCAGGTGCGG - Intergenic
1085477038 11:76795328-76795350 AGATGAAGGCGGGCCTGGTCTGG - Intronic
1085624948 11:78064704-78064726 AATTGAAGAGGGGCCAGGCGCGG + Intronic
1085745626 11:79111993-79112015 CACTGCAGGAGGGCAAGGTGGGG + Intronic
1086063898 11:82727391-82727413 AACTGAAGTCTGGCCGGGGGCGG + Intergenic
1086153101 11:83635083-83635105 TACTGTATGCAGGCCAGGTGTGG + Intronic
1086394750 11:86403142-86403164 AAATAAATGCAGGCCAGGTGTGG - Intronic
1087978387 11:104579163-104579185 AAATGAAGATAGGCCAGGTGTGG - Intergenic
1088647864 11:111931357-111931379 GACTGATGTCAGGCCAGGTGCGG + Intronic
1089300829 11:117497730-117497752 ACCTGGAGGCTGGGCAGGTGAGG + Intronic
1089719642 11:120403214-120403236 AAGTAAAGGCAGGCCAGGCGCGG + Intronic
1089996211 11:122910182-122910204 AAGTGGAGAGGGGCCAGGTGTGG + Intronic
1090015806 11:123085537-123085559 AATGGAAGGCAGGCCAGGCGTGG - Intronic
1090293462 11:125566610-125566632 GAAGGATGGCGGGCCAGGTGCGG + Intergenic
1090701339 11:129298651-129298673 TGCTGAAGCGGGGCCAGGTGCGG + Intergenic
1090876446 11:130792552-130792574 AACTGAGCGTGGGCCGGGTGTGG - Intergenic
1090948098 11:131449281-131449303 AACTGGAGGGTGACCAGGTGTGG + Intronic
1202811284 11_KI270721v1_random:28298-28320 GAGGGCAGGCGGGCCAGGTGGGG - Intergenic
1091529700 12:1342172-1342194 AAGTTAATGCGGGCCGGGTGCGG + Intronic
1091666074 12:2419430-2419452 GACTGGAGGTGGGCCTGGTGGGG - Intronic
1091733499 12:2899401-2899423 AACTGACGGCAGGCCAGATTTGG + Intronic
1091820543 12:3472415-3472437 CACTGAAGGCAGGACAGGAGTGG + Intronic
1092447535 12:8571300-8571322 AACTATACGAGGGCCAGGTGTGG + Intergenic
1092465070 12:8724108-8724130 GACTGAAGAATGGCCAGGTGTGG - Intronic
1092494990 12:8984541-8984563 AACTGAATGAGGGCCAGGCACGG - Intronic
1092514277 12:9192318-9192340 AACTGAAAGTGGGTCATGTGGGG - Intronic
1092627529 12:10343071-10343093 AAGTAAAGGCAGGCCAGGCGCGG - Intergenic
1092822881 12:12370013-12370035 AAGTGAAGGTGGGCCGGGCGTGG - Intronic
1092902811 12:13075744-13075766 AAAGGAAGGCAGGCCTGGTGCGG - Intronic
1092945354 12:13449357-13449379 AACAGAAGAGGGGACAGGTGAGG - Intergenic
1093003187 12:14022752-14022774 AAATGAAGGCAGGCTGGGTGAGG - Intergenic
1094098720 12:26737541-26737563 AATAGAAGGTAGGCCAGGTGCGG - Intronic
1094590441 12:31814619-31814641 AATTCAAAGCTGGCCAGGTGCGG + Intergenic
1095113608 12:38327517-38327539 AACTGAAGGTCGGTCAGGTCAGG + Exonic
1095260758 12:40096217-40096239 AACTCAGGGCTGGCCGGGTGCGG - Intronic
1095770347 12:45947965-45947987 TTCTGAATGCTGGCCAGGTGTGG - Intronic
1096663430 12:53144995-53145017 AACTGAAGTTGGGCCAGGAGTGG + Intergenic
1096702393 12:53393922-53393944 ACCAGAAGGTGGGCCAGGTGTGG + Intronic
1096715704 12:53490010-53490032 AACAGATTGGGGGCCAGGTGTGG + Intronic
1097539122 12:60914111-60914133 CCCTGAAGGTGGGGCAGGTGTGG - Intergenic
1097902970 12:64891623-64891645 AAAGGAAGCTGGGCCAGGTGAGG - Intergenic
1100511991 12:95284712-95284734 AAGTAAGGGCGGGCCAGGCGAGG + Intronic
1101625766 12:106439764-106439786 AATTGACTGAGGGCCAGGTGTGG + Intronic
1102137028 12:110583579-110583601 AATTGCAGGTGGGCCACGTGAGG + Intergenic
1102138564 12:110595827-110595849 AACAGAATACAGGCCAGGTGCGG + Intergenic
1102282324 12:111628104-111628126 AAATGTAGGTTGGCCAGGTGTGG - Intergenic
1102413967 12:112744364-112744386 AACTGAAGCCTGGCCGGGTATGG - Intronic
1103253545 12:119521629-119521651 AACTCAAAGAGGGCCAGGTGGGG + Intronic
1103469601 12:121169613-121169635 AACTTGAGACAGGCCAGGTGCGG + Intronic
1103814047 12:123638598-123638620 TACTGAACGAGGGCCAGGTGTGG - Intronic
1104001982 12:124865655-124865677 ACCAGAAGGCAGGCCAGGTGGGG - Intronic
1104201808 12:126596847-126596869 AACTGAAATGCGGCCAGGTGCGG - Intergenic
1104555449 12:129796042-129796064 AAATTAAAGAGGGCCAGGTGCGG + Intronic
1104981899 12:132576936-132576958 GACTGGAGTCGGGCCAGGTGGGG + Intronic
1105496033 13:20931671-20931693 AAATAAAGGCAGGCCGGGTGTGG + Intergenic
1105544453 13:21341430-21341452 AACAGCAGGCGGGCCAGGTGCGG - Intergenic
1105656432 13:22444780-22444802 AAGAGAATGCTGGCCAGGTGCGG - Intergenic
1105934811 13:25089113-25089135 ACCTGAAGCTTGGCCAGGTGTGG + Intergenic
1106180583 13:27365949-27365971 AAATAAAGAAGGGCCAGGTGTGG - Intergenic
1106933040 13:34687699-34687721 AGCTGAAAGTGGGCCGGGTGTGG - Intergenic
1106980943 13:35279042-35279064 AACAGAAGGTGGGCCAGCTCTGG + Intronic
1107588731 13:41881507-41881529 AACAGAAGGGGGGAAAGGTGGGG - Intronic
1108616596 13:52139606-52139628 AACAAAAAGCAGGCCAGGTGTGG + Intronic
1109299809 13:60579519-60579541 ATGTGAATGGGGGCCAGGTGTGG + Intergenic
1109406270 13:61903749-61903771 AGCTGAACGAGGCCCAGGTGGGG + Intergenic
1110212336 13:72988149-72988171 GACTCAAGAAGGGCCAGGTGCGG - Intronic
1110383396 13:74879842-74879864 AAGTGAATGGGGGGCAGGTGGGG - Intergenic
1111310574 13:86479499-86479521 AACTGTAATCAGGCCAGGTGCGG + Intergenic
1111489698 13:88955833-88955855 AACTTAAGGAAGGCCAGGTGCGG + Intergenic
1112274196 13:98001162-98001184 AAAGGAAGGATGGCCAGGTGTGG - Intronic
1112585630 13:100716285-100716307 CACTGGAGAAGGGCCAGGTGAGG - Intergenic
1113186714 13:107695081-107695103 AACTGACATCAGGCCAGGTGTGG - Intronic
1113747719 13:112756548-112756570 AGCGGATGGCGGGGCAGGTGGGG + Intronic
1114633239 14:24172795-24172817 AAGGGAAGGAGGGCCTGGTGCGG + Intronic
1115607699 14:35021337-35021359 ATTTGAAAGCTGGCCAGGTGCGG + Intronic
1115800715 14:36990584-36990606 ATCTGAAATCAGGCCAGGTGCGG + Intronic
1115863420 14:37714885-37714907 TATTGAGGGCTGGCCAGGTGTGG + Intronic
1116078707 14:40145575-40145597 AAGTCACGGCGGGCCAGGCGCGG - Intergenic
1116217467 14:42037236-42037258 AATTGAATGATGGCCAGGTGTGG + Intergenic
1116400181 14:44497145-44497167 AACAGAAGGCAGCCCAGGTAGGG + Intergenic
1116435893 14:44895271-44895293 AAGAGAATGAGGGCCAGGTGTGG + Intergenic
1116787113 14:49299859-49299881 GAATGAAGGGGGGCCAGGTGTGG + Intergenic
1116819833 14:49617146-49617168 AAGTGATGGTAGGCCAGGTGAGG + Intergenic
1116843707 14:49845057-49845079 AACTTAATCTGGGCCAGGTGTGG - Intronic
1117148878 14:52865030-52865052 AACTGTATTCAGGCCAGGTGTGG + Intronic
1117314165 14:54557681-54557703 AACTGAATGCAGGCCAGGGTGGG + Intergenic
1117314347 14:54559022-54559044 AACTGAATGCAGGCCGAGTGCGG - Intergenic
1117341125 14:54792520-54792542 ACCAGAAGGCGGGCAAGGGGAGG + Exonic
1117477337 14:56109836-56109858 AAGTGAATGCAGGCCGGGTGTGG + Intergenic
1118733782 14:68687977-68687999 GAATGAAGGAGGGCCAGGTGCGG + Intronic
1119342811 14:73894870-73894892 AGTTGAAGACAGGCCAGGTGTGG + Intronic
1119455351 14:74750878-74750900 AAAAGAAAGTGGGCCAGGTGCGG + Intergenic
1119903831 14:78283797-78283819 AGCCGAAGACAGGCCAGGTGAGG - Intronic
1120911278 14:89669243-89669265 AACTGCAGGAGGCCAAGGTGGGG + Intergenic
1121208751 14:92190685-92190707 TCCTGGAGGAGGGCCAGGTGGGG + Intergenic
1122112282 14:99510727-99510749 AACTGGAGGCATGCCGGGTGGGG - Exonic
1122332135 14:100927797-100927819 AATTGAAAGAAGGCCAGGTGTGG + Intergenic
1122551722 14:102553839-102553861 AAAGGAATGCTGGCCAGGTGTGG + Intergenic
1122559131 14:102598736-102598758 AACTGAATCAGGGCCAGGCGTGG - Intronic
1122771015 14:104097653-104097675 ACGTGGAGGCGGGGCAGGTGGGG + Intronic
1122808058 14:104270661-104270683 GACGGAAGGCGGGCCATGTGTGG - Intergenic
1122875381 14:104661914-104661936 GACGGAAGGCGGGCCGTGTGTGG + Intergenic
1122969964 14:105148511-105148533 CACTGGAGCTGGGCCAGGTGAGG + Intronic
1122987985 14:105221390-105221412 ACCTGAAGGCGGTCCCAGTGAGG + Intronic
1202907967 14_GL000194v1_random:89244-89266 AATTGAAGGGAGGCCGGGTGCGG - Intergenic
1123685130 15:22791754-22791776 AAGTGAAAGAGGGCCAGGTGCGG - Intronic
1124143459 15:27098141-27098163 TACTGAATGTTGGCCAGGTGTGG + Intronic
1125029691 15:35063674-35063696 AGCTGAAAGATGGCCAGGTGCGG - Intergenic
1125617725 15:41030650-41030672 AAGTGAATGTTGGCCAGGTGTGG - Intronic
1125833950 15:42734907-42734929 AATTGAGATCGGGCCAGGTGTGG - Intronic
1126458770 15:48893504-48893526 AACTGAAGGCTGGCCAGATTTGG + Intronic
1126822636 15:52520018-52520040 AATAGAAGCCAGGCCAGGTGCGG - Intronic
1127495055 15:59502964-59502986 AAATGAAGCCTGGCCAGGAGTGG + Intronic
1127767234 15:62198181-62198203 AACTAAGAGTGGGCCAGGTGTGG - Intergenic
1127913694 15:63438425-63438447 AAATGAAATGGGGCCAGGTGCGG + Intergenic
1127954230 15:63838708-63838730 AAATCAAGTCAGGCCAGGTGCGG - Intergenic
1128326234 15:66725928-66725950 AAGTGAAGGGGTGGCAGGTGGGG - Intronic
1128347530 15:66863950-66863972 TGCTGAAGACGGGGCAGGTGGGG - Intergenic
1128675402 15:69604836-69604858 AAGTGGAAGAGGGCCAGGTGCGG + Intergenic
1129001269 15:72336347-72336369 AAATTAAGGCAGGCCAGGTGCGG - Intronic
1129072240 15:72961171-72961193 ATCTTAAGATGGGCCAGGTGTGG - Intergenic
1129191105 15:73937994-73938016 AACAGGAGGCTGGCCGGGTGCGG + Intronic
1129343092 15:74898827-74898849 AACAGGAGCCGGGCCAGGCGTGG - Exonic
1129769875 15:78196080-78196102 AAATGCAGGCGGGACAGGGGAGG + Intronic
1129884791 15:79030608-79030630 AACTGCAGGAGGGACAGGTCTGG - Intronic
1129884853 15:79030900-79030922 GGCTGAAAGAGGGCCAGGTGAGG + Intronic
1130377507 15:83342631-83342653 AACAGAAGTCTGGCCAGGCGCGG - Intergenic
1131123775 15:89840716-89840738 AAGTGAAGTCAGGCCAGGCGTGG - Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131325357 15:91438217-91438239 TAGTGAATGCTGGCCAGGTGCGG + Intergenic
1131730405 15:95273539-95273561 AACTGAGGGCTGGTCTGGTGTGG - Intergenic
1132067397 15:98743604-98743626 ACCTGGAGGCGGGCCACATGGGG + Intronic
1132144056 15:99416417-99416439 AAGAGAAGGCGGGCAAGGTGGGG + Intergenic
1132476781 16:143210-143232 ATCTGCAGGAGGGCCGGGTGGGG + Intergenic
1132831209 16:1929421-1929443 CCCTGAGGGCGGGCCAGGTCCGG + Intergenic
1133157875 16:3888566-3888588 AACTGAAAGCAGGCCGGGTGCGG - Intergenic
1133161204 16:3912915-3912937 GACTGCAGGGGGCCCAGGTGGGG + Intergenic
1133375772 16:5286058-5286080 AACTGCAGTCTGGCCAGGTGTGG - Intergenic
1133539867 16:6739584-6739606 AATAGAAGGTGGGCCAGGTGGGG + Intronic
1133884333 16:9811466-9811488 AACAAGAGGTGGGCCAGGTGTGG + Intronic
1134241584 16:12510736-12510758 AACTGCAGGCTGGACAGCTGGGG - Intronic
1134584591 16:15398882-15398904 AACTGAAAACCGGCCAGGTGAGG - Intronic
1134681415 16:16128437-16128459 AACTGAACTCAGGCCGGGTGTGG - Intronic
1135092655 16:19531675-19531697 TACTGAAGATGGGCCAGGCGCGG + Intronic
1135176290 16:20232685-20232707 AACTGAGTGCCTGCCAGGTGAGG - Intergenic
1135579998 16:23617427-23617449 AAATCAAGGCAGGCCAGGTGCGG + Intronic
1136085994 16:27885437-27885459 AGCTGCAGGTGGGCCAGGTGTGG - Intronic
1136219045 16:28816020-28816042 AACTAAAAGAGGGCCAGGCGTGG - Intergenic
1136389431 16:29953136-29953158 AACTGTAGGGGGGCCAAGCGTGG - Intronic
1136986666 16:35112714-35112736 AAATGAAGCCTAGCCAGGTGCGG + Intergenic
1137425605 16:48377785-48377807 AACAAAAGAAGGGCCAGGTGTGG + Intronic
1137719204 16:50618048-50618070 AACAGGAGGTGGGCCAGGTTTGG + Intronic
1138484469 16:57328960-57328982 CAATGAAGGCAGGCCAGGTGCGG - Intergenic
1138537329 16:57666977-57666999 AGGAGAAGGCTGGCCAGGTGTGG + Intergenic
1139087859 16:63610031-63610053 AAATGAAAGCAGGCCAGTTGTGG - Intergenic
1139788635 16:69414214-69414236 AGTTGGAGGCAGGCCAGGTGCGG - Intergenic
1140033987 16:71359199-71359221 AGCTGAAGGCAGGGGAGGTGGGG - Intronic
1140117296 16:72053453-72053475 AAATGAAGACAGGCCAGGCGTGG - Intronic
1140507901 16:75485913-75485935 GACTGAAGGGAGGCCAGGTGGGG - Intronic
1140754281 16:78053577-78053599 AATAGAAAGCAGGCCAGGTGTGG - Intronic
1141546053 16:84769951-84769973 GAAAGAAGGCGGGCCAGGTGTGG + Intronic
1142387749 16:89777138-89777160 AGGTCAAGGCTGGCCAGGTGTGG + Intronic
1142660585 17:1426399-1426421 AATTGCTGGCAGGCCAGGTGTGG - Intronic
1142901518 17:3015069-3015091 AACTGAGGGCAGGACAGGGGTGG - Intronic
1143213398 17:5206238-5206260 AACTGATGCTTGGCCAGGTGCGG - Intergenic
1143444279 17:6998078-6998100 AGGTGAAGGCGTGGCAGGTGAGG + Intronic
1143907135 17:10217869-10217891 AAATGTAGCCAGGCCAGGTGCGG - Intergenic
1144386881 17:14756191-14756213 AAAGGAAGGGGGGCCAGGCGCGG - Intergenic
1144442295 17:15294347-15294369 ACCTGAAAGCTGGCCAGGTGCGG - Intergenic
1145844218 17:28023823-28023845 AAATGAAGACTGGCCGGGTGCGG + Intergenic
1146100456 17:29975545-29975567 GAGTGTAGGTGGGCCAGGTGTGG - Intronic
1146285302 17:31570571-31570593 AACTTTATGAGGGCCAGGTGCGG + Intergenic
1146336065 17:31971718-31971740 AGTTGCAGGAGGGCCAGGTGTGG - Intronic
1146555080 17:33816164-33816186 AACTGAAGGGGGGGCGGGTGGGG + Intronic
1146940200 17:36839236-36839258 CAGTGAAGGAGGGCCAGGTGTGG - Intergenic
1146999133 17:37347879-37347901 AAGTCAAAGAGGGCCAGGTGCGG + Intronic
1147218506 17:38914630-38914652 ACCTGAGGCCGGGCCAGCTGGGG + Intronic
1147228476 17:38999614-38999636 AAGTGAAAAAGGGCCAGGTGTGG - Intergenic
1147358839 17:39918638-39918660 AACTGAAAGTTGTCCAGGTGTGG + Exonic
1147432426 17:40380628-40380650 GAAAGAAGGCTGGCCAGGTGTGG - Intergenic
1147444633 17:40467377-40467399 AACTGATTGGGGGCCAGGTGCGG - Intergenic
1147445191 17:40470957-40470979 AACTGGAAGCCAGCCAGGTGTGG - Intergenic
1147611192 17:41802840-41802862 AACTTAAGATGGGCCAGGTGCGG - Exonic
1147834569 17:43320827-43320849 AACTGAATGCTGGCCAGATGTGG + Intergenic
1148149947 17:45390910-45390932 AAAAGAATGAGGGCCAGGTGTGG + Intergenic
1148174440 17:45551274-45551296 AATTGAAGGGGGGCCGGGTGTGG + Intergenic
1148274823 17:46294173-46294195 AATTGAAGGGGGGCCGGGTGTGG - Intronic
1148296929 17:46511752-46511774 AATTGAAGGGGGGCCGGGTGTGG - Intronic
1148361481 17:47016232-47016254 AATTGAAGGGGGGCCGGGTGTGG - Intronic
1149085892 17:52715555-52715577 AAATGAATCCGGGCCAGGTGCGG - Intergenic
1149450048 17:56743002-56743024 AACTGAGAGCGGGGAAGGTGAGG - Intergenic
1149495789 17:57116486-57116508 AAGTGAAGCTGGGCCAGGCGTGG + Intronic
1149780412 17:59392938-59392960 AATGAAAGGAGGGCCAGGTGCGG - Intronic
1150295931 17:64007550-64007572 AACTGAGTGAGGGCCAGGTGCGG - Intronic
1150405659 17:64898196-64898218 AATTGAAGGGGGGCCGGGTGTGG + Intronic
1150599787 17:66640868-66640890 AACATGATGCGGGCCAGGTGTGG + Intronic
1150700705 17:67444604-67444626 AAGAGAAGGCTGGCCAGGCGCGG + Intronic
1151010872 17:70494548-70494570 ACCTGAAAATGGGCCAGGTGTGG + Intergenic
1151273093 17:73011982-73012004 GACTGAAAGATGGCCAGGTGCGG + Intronic
1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG + Intronic
1151317262 17:73330736-73330758 AACCGAACGCTGGCCAGGTGCGG + Intergenic
1151325571 17:73377900-73377922 AACAGCAGGCAGGCCGGGTGCGG - Intronic
1151467071 17:74292700-74292722 GACTGAAATCAGGCCAGGTGTGG - Intronic
1151724441 17:75876210-75876232 AACAGAAGCTGGGACAGGTGGGG - Intronic
1151856111 17:76723234-76723256 AACTGTATGCAGGCCCGGTGCGG - Intronic
1151977646 17:77491520-77491542 AAGAGAAGCTGGGCCAGGTGTGG + Intronic
1152077114 17:78166617-78166639 AACAGCAGGTGTGCCAGGTGGGG - Intergenic
1152699623 17:81812487-81812509 ACCTGCAGGAGGGTCAGGTGGGG + Intronic
1152897686 17:82922746-82922768 CACTGGGGGCGGGGCAGGTGGGG - Intronic
1153116128 18:1658590-1658612 AAATGAATGCAGGCCAGGTGCGG - Intergenic
1153560949 18:6371205-6371227 AACTGGCGGCGGGCCAGATGTGG + Intronic
1153732573 18:8029347-8029369 CACTGATGGCAGGACAGGTGTGG - Intronic
1153847453 18:9062829-9062851 AATAGAAGGCCAGCCAGGTGTGG + Intergenic
1155486629 18:26350518-26350540 AACTGAAGGTTAGCCAGGTATGG + Intronic
1156032180 18:32725318-32725340 AACGCAAGGAAGGCCAGGTGTGG - Intronic
1156822531 18:41390161-41390183 AACAGAATGCAGGCCAGGTCTGG + Intergenic
1156874456 18:41991231-41991253 AATTGTATGCAGGCCAGGTGTGG + Intronic
1158452862 18:57582470-57582492 AAAGGAAGGAGTGCCAGGTGTGG + Intronic
1158590537 18:58775110-58775132 GAAAGAAGGCAGGCCAGGTGCGG + Intergenic
1158595452 18:58811933-58811955 ATCTGCAGTGGGGCCAGGTGTGG - Intergenic
1158650659 18:59281767-59281789 AATTGAAAGCAGGTCAGGTGCGG - Intronic
1160002711 18:75042189-75042211 ATGAGAAGGCTGGCCAGGTGTGG - Intronic
1160337345 18:78054255-78054277 AACAGAAGCCCTGCCAGGTGGGG - Intergenic
1160698546 19:495841-495863 AAGTGCAGGCGGGCCGGGCGCGG + Intronic
1160919301 19:1512388-1512410 AAGGGGAGGGGGGCCAGGTGCGG + Intronic
1161211253 19:3067185-3067207 AACTTAAGAGGGGCCAGGCGTGG - Intergenic
1161385848 19:3992407-3992429 AAATGAAAACAGGCCAGGTGCGG - Intergenic
1161752803 19:6110161-6110183 GACTGAACGCGGGGGAGGTGCGG - Intronic
1161882912 19:6969707-6969729 AACAGAAGGTGGGCCAGATTTGG + Intergenic
1162019417 19:7861927-7861949 AGCTGAAGGCGCTCAAGGTGCGG + Exonic
1162202948 19:9034489-9034511 AATTGAAGGAGGGCCAGGTGTGG + Intergenic
1162269288 19:9600930-9600952 AAATGAAGGGGAGCCAGATGTGG - Intergenic
1162346920 19:10124173-10124195 AAAAAAAGGCGTGCCAGGTGCGG - Intergenic
1162507983 19:11098711-11098733 AACTAAATGCAGGCCAAGTGTGG + Intronic
1162708434 19:12573363-12573385 AGCTCAAGTCAGGCCAGGTGAGG + Intronic
1162714314 19:12620191-12620213 AAATAAAGACAGGCCAGGTGCGG - Intronic
1162836982 19:13326493-13326515 GACTGCATGTGGGCCAGGTGTGG + Intronic
1163214541 19:15866194-15866216 AAATGAATACAGGCCAGGTGCGG + Intergenic
1163452842 19:17389128-17389150 AACTCAAAGCTGGCCAGGTGTGG - Intergenic
1165069702 19:33248300-33248322 AAGGGAAGGCGGGCCAGGAAAGG - Intergenic
1165189472 19:34050658-34050680 AAAAGAACGAGGGCCAGGTGTGG + Intergenic
1165445218 19:35853083-35853105 AAAGGAAGGGAGGCCAGGTGCGG - Intronic
1165713699 19:38030142-38030164 AACTGTATACCGGCCAGGTGCGG - Intronic
1166302778 19:41921797-41921819 GACTGAAGAAGGGCGAGGTGGGG - Intronic
1166858636 19:45796440-45796462 AAGTCAAGGCTGGCCAGGTGCGG - Intronic
1167118856 19:47504530-47504552 TGCAGAAGGAGGGCCAGGTGTGG + Intronic
1167167826 19:47811292-47811314 AACTCAGGGCCGGCCAGGTGCGG - Intronic
1167735310 19:51291014-51291036 AAATGAAGGCTGTTCAGGTGGGG - Intergenic
1167845782 19:52162972-52162994 GACTGAAGTGGGGCCAGGTGCGG - Intronic
1167923580 19:52804976-52804998 AACTTGAGACAGGCCAGGTGCGG + Intronic
1168153897 19:54462876-54462898 AGCTGGAGGCGGCCCAGGAGAGG - Exonic
1168451159 19:56467581-56467603 ATCTGAAGGTGGGGCAGGTGGGG - Intronic
926703773 2:15822013-15822035 AAACTAAGGCCGGCCAGGTGTGG - Intergenic
927056327 2:19368905-19368927 AGCTCGAGGCGGGCCAGGTATGG - Intergenic
927180192 2:20440443-20440465 AGCTGAAGGAGGGAAAGGTGAGG - Intergenic
927565774 2:24111347-24111369 AATGGAAGTGGGGCCAGGTGCGG - Intronic
927745894 2:25620675-25620697 AAGTGATGGATGGCCAGGTGTGG + Intronic
927816060 2:26218716-26218738 AATTGAAAACCGGCCAGGTGTGG + Intronic
927819250 2:26248450-26248472 TACTCAAGGTGGGCCAGGGGTGG - Intronic
928955517 2:36863011-36863033 AGCTAAAAGCAGGCCAGGTGCGG - Intronic
929222794 2:39482463-39482485 AAATGAGTGCAGGCCAGGTGTGG - Intergenic
929477438 2:42265528-42265550 AAATGCAGCCGGGCCAAGTGTGG - Intronic
930057562 2:47263713-47263735 AGCTGAAGCCGGGCCGGGTGCGG + Intergenic
930792476 2:55348561-55348583 AACTTAAGTCTGGCCAGGTGCGG - Intronic
930872815 2:56184899-56184921 AGGTGAGCGCGGGCCAGGTGGGG + Exonic
932157706 2:69433468-69433490 AAAAAAAGACGGGCCAGGTGTGG - Intronic
932435434 2:71700364-71700386 ACCTGCAGGGGGGACAGGTGGGG + Intergenic
932741583 2:74294959-74294981 AACTGAAAGAGGGCCAGGCATGG - Intronic
933034715 2:77380504-77380526 AACTTATGGTAGGCCAGGTGTGG + Intronic
933170471 2:79119360-79119382 AACTGATGATGGGCCTGGTGTGG - Intergenic
933756097 2:85639735-85639757 AAATGAAAATGGGCCAGGTGTGG - Intronic
935728906 2:106048484-106048506 AAAAGAAGGTGGGCCGGGTGTGG - Intergenic
936401623 2:112168979-112169001 AACAGCAGGCAGGCCAGGAGCGG + Intronic
936411617 2:112263261-112263283 AAGAAAAGGCTGGCCAGGTGTGG + Intergenic
936456694 2:112680628-112680650 AAATTAAAGCAGGCCAGGTGAGG - Intergenic
937180602 2:119992669-119992691 AACTGATATCTGGCCAGGTGCGG + Intergenic
937317098 2:120938610-120938632 AGCTGAAAGCTGGCCAGGTCTGG + Intronic
937371455 2:121300482-121300504 AAGGCAAGGCAGGCCAGGTGCGG - Intergenic
937446680 2:121964367-121964389 AGCTAAAAGCAGGCCAGGTGCGG + Intergenic
937454017 2:122025829-122025851 AACTGACTTGGGGCCAGGTGCGG + Intergenic
937851419 2:126639521-126639543 TACTGGAGCTGGGCCAGGTGGGG - Intergenic
937934752 2:127234222-127234244 AAATGAAATTGGGCCAGGTGTGG - Intergenic
937940012 2:127277946-127277968 AGATGAAGGCTGGCCAGGTGTGG + Intronic
938274218 2:130002941-130002963 AACTCCTTGCGGGCCAGGTGTGG + Intergenic
939381443 2:141441366-141441388 AACCCAGGGCTGGCCAGGTGTGG - Intronic
939598991 2:144165079-144165101 TAGGGAAGGCTGGCCAGGTGCGG + Intronic
940487683 2:154316920-154316942 AAATACAGGTGGGCCAGGTGCGG + Intronic
940876044 2:158898019-158898041 AATGGAAGTGGGGCCAGGTGCGG - Intergenic
941614934 2:167708368-167708390 AAATGGAGTCAGGCCAGGTGCGG + Intergenic
941867182 2:170347312-170347334 AAGTGATGGGGGGCCAGGTGTGG + Intronic
942135757 2:172923556-172923578 AACCCAAGTCTGGCCAGGTGTGG - Intronic
942824852 2:180163314-180163336 AACAGAAGGCGGCCCAGGAATGG - Intergenic
943219764 2:185090139-185090161 AACTGAATGCCGGCCAGGCATGG - Intergenic
943502231 2:188706360-188706382 AACCTAATGCTGGCCAGGTGTGG - Intergenic
943857975 2:192823569-192823591 AAATGAAAGAGGGCCAGGTGCGG + Intergenic
944742299 2:202624422-202624444 AAGCAAAGGCCGGCCAGGTGCGG + Intergenic
944893943 2:204145063-204145085 AACTGAGGGCAGGCCAGGGCGGG + Intergenic
945306232 2:208261671-208261693 AAATAAATACGGGCCAGGTGTGG + Intronic
945882829 2:215344395-215344417 AACTTAAAGTTGGCCAGGTGTGG + Intronic
945995506 2:216432697-216432719 AACTGAAGGCAGACAAGGTGAGG - Exonic
947606600 2:231490030-231490052 AACTGTAGGCGGGCCTGAAGAGG + Intergenic
948242321 2:236447867-236447889 AAATGAAAGCTGGCCAGGGGAGG + Intronic
948618113 2:239214559-239214581 AACAGAATTGGGGCCAGGTGAGG + Intronic
948812688 2:240492280-240492302 TAATGAAGTAGGGCCAGGTGTGG - Intronic
1168752683 20:294359-294381 ATTTGAAGTGGGGCCAGGTGCGG - Intergenic
1169006324 20:2210102-2210124 AACAGAAAGAAGGCCAGGTGCGG - Intergenic
1169581793 20:7031761-7031783 CACTGAAAGCCAGCCAGGTGTGG + Intergenic
1169735765 20:8835999-8836021 AACTGAAGTCTGGCTAGTTGAGG + Intronic
1170120062 20:12901762-12901784 AGGTGAAGGCAGGCCAGGTGTGG - Intergenic
1170570055 20:17627522-17627544 TGCTGGAGGCGGGCCAGGCGCGG - Exonic
1171347959 20:24480036-24480058 AACTGCAGGTGGGGGAGGTGTGG - Intronic
1171471159 20:25372493-25372515 AGCTGAAAGAGGGCCAGGTGTGG - Intronic
1172145469 20:32754767-32754789 AATTGTAGGCCGGCCAGGTGTGG + Intergenic
1172409347 20:34710132-34710154 TGGAGAAGGCGGGCCAGGTGCGG + Exonic
1172429042 20:34875276-34875298 AAGAGAATGTGGGCCAGGTGTGG + Intronic
1172725669 20:37038891-37038913 AAATGACTGCAGGCCAGGTGCGG - Intronic
1173517016 20:43671758-43671780 AATGGAAATCGGGCCAGGTGTGG - Intronic
1173605502 20:44328119-44328141 AACTGAAGAAGGGCCCGGTGTGG - Intergenic
1173792818 20:45839223-45839245 AACTGAGAGCTGGCCAGGCGCGG + Intronic
1173947552 20:46963717-46963739 ACCTGAAGGTGGGCCGGGGGTGG + Intronic
1174193911 20:48759257-48759279 TACTGCAGGCAGGCCAGGCGCGG + Intronic
1174849884 20:53983610-53983632 AGCTGAAGGCATGACAGGTGGGG - Intronic
1175141531 20:56864390-56864412 AATTGAAGCTCGGCCAGGTGCGG + Intergenic
1175264614 20:57695198-57695220 AAAGGAATGCAGGCCAGGTGAGG + Intronic
1175442528 20:59001738-59001760 AGCTGAAGGCAGGCCAGGCTGGG - Intronic
1176218388 20:63958769-63958791 AACTGAAGGCCAGCCAGGGGAGG - Exonic
1176600691 21:8791020-8791042 AATTGAAGGGAGGCCGGGTGTGG + Intergenic
1177245802 21:18521434-18521456 AACACAAGGCAGGCCAGCTGGGG - Intergenic
1177546245 21:22562151-22562173 CACCAAAGGCGAGCCAGGTGCGG - Intergenic
1177902836 21:26937947-26937969 AAATAAAGTCAGGCCAGGTGCGG + Intronic
1178138901 21:29659668-29659690 AACTCAATGCCGGCCAGGCGCGG + Intronic
1178586789 21:33877341-33877363 GCCTGCAGGTGGGCCAGGTGCGG - Intronic
1178851588 21:36216784-36216806 AGCTGAGGGCTGGCCGGGTGTGG + Intronic
1179468974 21:41597959-41597981 ACATGAAGGCGGGGCAGCTGGGG - Intergenic
1180032101 21:45219233-45219255 AACTGAATGGTGGCTAGGTGTGG + Intronic
1180237198 21:46470045-46470067 AAATGAATTCAGGCCAGGTGCGG + Intronic
1180417674 22:12783525-12783547 AATTGAAGAGAGGCCAGGTGTGG - Intergenic
1180684490 22:17654712-17654734 AAGAGAAGACAGGCCAGGTGCGG - Intronic
1180959617 22:19756729-19756751 AACCGCGGCCGGGCCAGGTGAGG + Exonic
1181387916 22:22558386-22558408 GACAGAAGGCGGGCCAGGGCGGG + Intronic
1181878601 22:25959562-25959584 AAATGAAGACAGGCCAGGAGCGG - Intronic
1181972403 22:26701256-26701278 AATTAAATGTGGGCCAGGTGTGG - Intergenic
1182300350 22:29333556-29333578 AAAATAAGGGGGGCCAGGTGTGG + Intronic
1182562561 22:31172195-31172217 AAGTGAAACCTGGCCAGGTGTGG + Intronic
1182808653 22:33097102-33097124 AAAGGAAGGGGGCCCAGGTGAGG - Intergenic
1183055901 22:35305369-35305391 AACTGATGGCGGGCCAGGCACGG + Intronic
1183131861 22:35844794-35844816 AACTGAAGTAAGGCCAGGCGCGG - Intronic
1183279429 22:36924114-36924136 AACTGAAGGCGGTGGAGGGGTGG - Intronic
1183407148 22:37635903-37635925 AACTGACTGGGGGCCGGGTGTGG - Intronic
1183439190 22:37813593-37813615 AGCTGCAGGAGGCCCAGGTGGGG + Exonic
1183573810 22:38674211-38674233 AAATGGAGCCTGGCCAGGTGTGG + Intergenic
1183658026 22:39201799-39201821 AACTGAAATCTGGCCAGGTGCGG + Intergenic
1183807239 22:40221727-40221749 ATAAGAAGGTGGGCCAGGTGTGG - Intronic
1183895271 22:40963343-40963365 AACTCATTGCAGGCCAGGTGCGG + Intronic
1184107703 22:42377957-42377979 GAATGAAGGATGGCCAGGTGTGG + Intergenic
1184323817 22:43766321-43766343 CACTTGAGGGGGGCCAGGTGTGG - Intronic
1184775228 22:46619799-46619821 ACTTGGAGGAGGGCCAGGTGGGG + Intronic
1184787604 22:46679324-46679346 AACTGACCACGTGCCAGGTGTGG + Exonic
1185019908 22:48367956-48367978 AGCTGTAGGGGAGCCAGGTGGGG + Intergenic
949985715 3:9538988-9539010 ACCTGAATTTGGGCCAGGTGTGG - Intronic
950061379 3:10074232-10074254 AACTGTGAGCTGGCCAGGTGTGG - Intronic
950242724 3:11386154-11386176 AAATGAAGGCGGGCAGAGTGGGG - Intronic
950954870 3:17041651-17041673 AAAATAAGGCAGGCCAGGTGCGG + Intronic
951016634 3:17739696-17739718 AAATGAAAGCAGGCCAGGCGCGG + Intronic
951711188 3:25585998-25586020 AACTGGGGGCAGGCCAGGCGGGG + Intronic
951902506 3:27670721-27670743 CACTGAAGGCAGCTCAGGTGTGG + Intergenic
952878264 3:37966241-37966263 AAATGTAGGCAGGCCAGGGGAGG - Intronic
952887395 3:38020065-38020087 AACTGAGGCCTGGCCTGGTGGGG - Intronic
953948033 3:47165202-47165224 AACTGAAAGTGGGCCGGGCGCGG + Intergenic
954018963 3:47721718-47721740 AAGTGAAAGGGGGCCAGGTGTGG + Intronic
954357795 3:50097103-50097125 TACTGAGGGTTGGCCAGGTGCGG + Intronic
954727085 3:52621759-52621781 TACTTAAGGGGAGCCAGGTGTGG + Intronic
955019890 3:55109659-55109681 AACTGCCTGCAGGCCAGGTGCGG - Intergenic
955213019 3:56959685-56959707 ACCAAAAGGCTGGCCAGGTGCGG + Intronic
955317965 3:57954380-57954402 AACAGAAAGATGGCCAGGTGTGG - Intergenic
957131299 3:76225422-76225444 AAATGAATTCAGGCCAGGTGTGG + Intronic
957676173 3:83368455-83368477 AACAAAAGGCAGGCCGGGTGCGG + Intergenic
959815444 3:110669008-110669030 AAATGCAGAGGGGCCAGGTGTGG + Intergenic
960083755 3:113568841-113568863 AAAAGAAGCCAGGCCAGGTGCGG + Intronic
960635587 3:119781524-119781546 AACAGAAGGCTGACCAGGAGTGG - Intronic
960931165 3:122852280-122852302 AACCAAAGACAGGCCAGGTGTGG - Intronic
961286844 3:125812904-125812926 AACTGCAGTCTGGCCAGGTGTGG - Intergenic
962731607 3:138288925-138288947 GTCTGAAGCAGGGCCAGGTGAGG - Intronic
963097734 3:141562959-141562981 AACTGAACGTGGGCCAGGTGCGG - Intronic
963724900 3:148908927-148908949 TACTATAGGCTGGCCAGGTGTGG + Intergenic
963768618 3:149365645-149365667 AAGAGAAGGAGGGCCAGGTAGGG + Intergenic
963990093 3:151642974-151642996 AAATCAAGACAGGCCAGGTGTGG + Intergenic
964476035 3:157098458-157098480 AGCTCAAGGGGTGCCAGGTGAGG - Intergenic
964610181 3:158604944-158604966 AAAACAAGGCTGGCCAGGTGCGG - Intronic
964611416 3:158620317-158620339 AAAAGAAGTAGGGCCAGGTGTGG - Intergenic
965258310 3:166444996-166445018 CACTGAGGGTGAGCCAGGTGCGG - Intergenic
965459842 3:168948648-168948670 AAGTGAAAAGGGGCCAGGTGTGG + Intergenic
965874986 3:173305777-173305799 AAATGAAGGTGGGCCGGGCGCGG - Intergenic
966393464 3:179476787-179476809 AACTCAAGCAGGCCCAGGTGAGG - Intergenic
966528753 3:180949672-180949694 AACTAAATGGGGGCCAGGTTCGG - Intronic
966780759 3:183582050-183582072 AATGGAAAGGGGGCCAGGTGTGG + Intergenic
967123373 3:186403585-186403607 AAATGAAGTCGGGTCAGGCGCGG - Intergenic
967162190 3:186748719-186748741 AAATAAAGGCTGGCCAGGTGAGG + Intergenic
968175854 3:196549008-196549030 AACTGAATGCTGGCTGGGTGTGG - Intergenic
968211229 3:196850510-196850532 AACTGAGTGGGGGCCAGGGGTGG + Intergenic
968439825 4:617631-617653 AGATGAAGGAGGGGCAGGTGGGG - Intergenic
968529490 4:1083350-1083372 AACTCAATGGGGGCCGGGTGTGG + Intronic
969963486 4:10970753-10970775 AACTCTGGGCAGGCCAGGTGTGG - Intergenic
970609260 4:17710033-17710055 AACTGGACCCAGGCCAGGTGCGG + Intronic
971085632 4:23271742-23271764 AAGTGCTGGAGGGCCAGGTGTGG - Intergenic
971330777 4:25679688-25679710 AAGTGAAGTCAGGCTAGGTGGGG - Intergenic
972426720 4:38940179-38940201 AATGAAAGGCAGGCCAGGTGTGG - Intronic
972619268 4:40731230-40731252 AACAGGTGGTGGGCCAGGTGTGG + Intergenic
973364122 4:49193768-49193790 AATTGAAGAGAGGCCAGGTGTGG + Intergenic
974234658 4:59165762-59165784 AACTCAAGATGGGCCAGGCGTGG + Intergenic
974705562 4:65511015-65511037 CACTGAAGAATGGCCAGGTGAGG + Intronic
975582259 4:75917754-75917776 AAGTGAAAGCAGGCCAGGTGCGG - Intronic
975784574 4:77874274-77874296 AAATGCAGGCGGTCCGGGTGCGG - Intronic
975956189 4:79842019-79842041 AAATGAAGGAAGGCCAGGTGTGG - Intergenic
976284092 4:83354835-83354857 AACTGAACTTGGGGCAGGTGTGG + Intergenic
976427442 4:84921943-84921965 AAATGAAAGCAGGCCAGGTGCGG - Intronic
976750405 4:88446815-88446837 TACTATAGGCTGGCCAGGTGTGG + Intergenic
977739148 4:100456088-100456110 ATTTGAAGAAGGGCCAGGTGTGG - Intronic
977804471 4:101280527-101280549 AACTGGAAACGGACCAGGTGTGG + Intronic
979285638 4:118921195-118921217 AACTCAGGTTGGGCCAGGTGTGG - Intronic
981193647 4:141892841-141892863 AACTGAGACCTGGCCAGGTGTGG - Intergenic
981311107 4:143298990-143299012 AAAGAAAGGCAGGCCAGGTGTGG + Intergenic
981548944 4:145923312-145923334 GATTGAATGCAGGCCAGGTGCGG + Intronic
983776102 4:171609482-171609504 AACTGCATGGGAGCCAGGTGAGG + Intergenic
984378196 4:178958123-178958145 AACTGAAAACAGGCCTGGTGTGG - Intergenic
985513366 5:324493-324515 ACCTGAAACTGGGCCAGGTGTGG + Intronic
985525698 5:400383-400405 AACGGAGGTCGGGGCAGGTGAGG - Intronic
985770412 5:1806434-1806456 AACTGAGGGCCAGGCAGGTGAGG - Intronic
986200948 5:5577742-5577764 AACAGATGGAGGGCCGGGTGCGG + Intergenic
988960446 5:36365523-36365545 AACCTAAAGCAGGCCAGGTGTGG - Intergenic
989633773 5:43513070-43513092 AAGACAAGGTGGGCCAGGTGCGG - Intronic
989963405 5:50441341-50441363 AACTGATGGAGGGCCGGGCGCGG - Exonic
990188535 5:53232625-53232647 AACTGAGGGCTGGCCAAGGGTGG - Intergenic
990193725 5:53290015-53290037 AAATCAAGGGAGGCCAGGTGTGG - Intergenic
990386888 5:55273794-55273816 AGATGAAGGCTGGCCAAGTGCGG + Intronic
990431706 5:55741495-55741517 AAGTGCAGGATGGCCAGGTGCGG + Intronic
990575220 5:57117437-57117459 AACTGAATTCAGGCCAGGCGCGG - Intergenic
990577790 5:57139809-57139831 AAATGAAGTCAGGCCAGGCGAGG - Intergenic
991643344 5:68775966-68775988 AACAAAAAGCTGGCCAGGTGCGG - Intergenic
992057097 5:73000896-73000918 AAGGGAAGTTGGGCCAGGTGTGG - Intronic
992109012 5:73474990-73475012 CACTCAAGGCTGGCCAGGTGTGG - Intergenic
992392630 5:76343012-76343034 AAGAGAATGTGGGCCAGGTGCGG - Intronic
992859681 5:80897834-80897856 AACTGAATTTGGGCCAGGAGTGG + Intergenic
993386374 5:87267844-87267866 AAAGGAAGGCGGGGCAGGGGAGG - Intergenic
994055479 5:95409447-95409469 AACTGATGACAGGCCAGGCGTGG - Intronic
995175747 5:109174478-109174500 AACTGAGGTTGGGCAAGGTGGGG - Intronic
995838606 5:116422309-116422331 AAAAGGAAGCGGGCCAGGTGTGG + Intergenic
995943483 5:117613208-117613230 AACAGAAGAGGGGCCAGGAGTGG + Intergenic
995948478 5:117680349-117680371 AAAAGAAAGCAGGCCAGGTGCGG - Intergenic
996289534 5:121835445-121835467 GACAGAATTCGGGCCAGGTGTGG - Intergenic
996739261 5:126784317-126784339 AAATGACAGCCGGCCAGGTGCGG - Intronic
997493646 5:134301589-134301611 AACAGAAGTTGGGCCAGATGCGG + Intronic
997516239 5:134491852-134491874 ACCTGAAAGCGGGCCAGTTATGG - Intergenic
998379955 5:141717292-141717314 AGCTGGAGGGGGGCCAGGGGCGG + Intergenic
998486227 5:142504901-142504923 ACCTAAAGGCGGGCCAGGCGTGG - Intergenic
998521530 5:142805390-142805412 AACTAAATGTGGGCCAGGCGTGG - Intronic
999070532 5:148739090-148739112 AACTGGAGGCAAGACAGGTGAGG + Intergenic
999751880 5:154633620-154633642 AGAGCAAGGCGGGCCAGGTGTGG - Intergenic
1000184969 5:158850714-158850736 AACTTAAGTAGGGCCAGGTGTGG + Intronic
1002073101 5:176692308-176692330 AACAGAATGAGGGCCAGGCGCGG - Intergenic
1002116734 5:176968081-176968103 AAATGATGACTGGCCAGGTGTGG + Intronic
1002920269 6:1564223-1564245 AAATGAAGACTGGCCAGGTGCGG + Intergenic
1003261301 6:4518612-4518634 GACTGAAGGCAGGCATGGTGAGG - Intergenic
1004529464 6:16440089-16440111 AATTGAAGTGGGGCCAGGTGCGG + Intronic
1005451770 6:25980709-25980731 AATGGAAGAAGGGCCAGGTGTGG - Intronic
1005753146 6:28902479-28902501 AACTGTAGGCAGGCCGGGCGCGG + Intergenic
1006195158 6:32235799-32235821 AAATGAAAGCAGGCCGGGTGTGG + Intergenic
1006273137 6:32979854-32979876 ACCTGTAGGCAGGGCAGGTGGGG - Exonic
1007710669 6:43822011-43822033 AAGAGAGGGTGGGCCAGGTGCGG + Intergenic
1007882456 6:45182550-45182572 AAAGAAAGGCAGGCCAGGTGCGG - Intronic
1008158457 6:48047223-48047245 AACTGGAAGCTGGCCAGGAGTGG - Intronic
1010417356 6:75627960-75627982 ATCTGAAAGCAGGCCAGGCGTGG - Intronic
1011037178 6:82990566-82990588 AAGGAAAGGCAGGCCAGGTGTGG - Intronic
1012411787 6:98966930-98966952 AAGTGCAGGTGGGCCAGGTGCGG - Intergenic
1013339604 6:109200602-109200624 ATCTGAAGCTTGGCCAGGTGCGG - Intergenic
1013628793 6:111964744-111964766 GAATGAAAGAGGGCCAGGTGTGG + Intergenic
1014201390 6:118612926-118612948 AACTGAAATGAGGCCAGGTGTGG + Intronic
1014431805 6:121379828-121379850 AACTGGAGGCAGGCCAGATTTGG - Intergenic
1015998176 6:139015793-139015815 AGGTGAAGGTAGGCCAGGTGCGG + Intergenic
1016356023 6:143219312-143219334 AACTGCAGTCAGGCCAGGTGTGG + Intronic
1016421043 6:143883327-143883349 AGCTGCAGGTGGGTCAGGTGTGG - Intronic
1016565607 6:145450061-145450083 AACTGAAACCAGGCCTGGTGTGG + Intergenic
1016646469 6:146414690-146414712 AATAAAAGGCAGGCCAGGTGTGG - Intronic
1017173977 6:151484558-151484580 TACTGAAAGCTGGCGAGGTGTGG - Intergenic
1017257839 6:152353982-152354004 AAATGAAAACAGGCCAGGTGCGG + Intronic
1017748060 6:157464883-157464905 AGCTCAGGGCGGGCCAGCTGTGG + Intronic
1017807472 6:157958180-157958202 TACTGAAAGGAGGCCAGGTGTGG - Intergenic
1017861410 6:158401362-158401384 AAAAGAGGGCTGGCCAGGTGCGG - Intronic
1018205240 6:161430843-161430865 TACTGAATGCTGGCCAGGTGCGG + Intronic
1018246681 6:161830540-161830562 AAACAAAGGCGGGCCGGGTGCGG - Intronic
1019398168 7:834526-834548 AACGCAAGGCCGGCCAGCTGAGG - Intronic
1019503237 7:1376088-1376110 AACTGCAGGCTGGCTAGGTGTGG - Intergenic
1019732934 7:2637579-2637601 AACTGACGGTGGGGCAGGTGGGG - Intronic
1020218521 7:6215298-6215320 AAATGAGGACAGGCCAGGTGCGG + Intronic
1021201063 7:17729142-17729164 AACCGAAGGTTGGCCAGGTATGG + Intergenic
1021700906 7:23318513-23318535 AAATAAAGGTTGGCCAGGTGCGG - Intronic
1021818040 7:24467338-24467360 AATTAAAGGGGGGCCAGGCGTGG - Intergenic
1022299532 7:29090151-29090173 AATTCAAGGGTGGCCAGGTGTGG - Intronic
1022664726 7:32399872-32399894 AAATGAAGTCAGGCCTGGTGTGG - Intergenic
1022809422 7:33854366-33854388 AACTGAAGGCATGCCAGGTCTGG - Intergenic
1022896322 7:34753412-34753434 AACAGAAGACCAGCCAGGTGTGG + Intronic
1023273628 7:38494247-38494269 AAGTGAAGATGGGCCAGGTGCGG - Intronic
1023972899 7:45004715-45004737 AACTGGTGGTTGGCCAGGTGCGG + Intronic
1025091238 7:56065790-56065812 AACTGAAAATGGGCCAGGTGAGG + Intronic
1025900603 7:65741454-65741476 AAATGACAGCTGGCCAGGTGCGG + Intergenic
1026009409 7:66625231-66625253 AAGTGAAGTAGGGCTAGGTGAGG + Intergenic
1026061034 7:67026361-67026383 ATCTGTAGGTAGGCCAGGTGTGG - Intronic
1026322285 7:69278267-69278289 AGCAGAAGAGGGGCCAGGTGTGG - Intergenic
1026717328 7:72801036-72801058 ATCTGTAGGTAGGCCAGGTGTGG + Intronic
1026728188 7:72888152-72888174 AACTGGATCCAGGCCAGGTGTGG - Intronic
1026870305 7:73847025-73847047 AGCCCAAGGCAGGCCAGGTGTGG + Intergenic
1026974579 7:74489631-74489653 AACTGAAACCAGGCCAGGAGTGG - Intronic
1026992153 7:74592821-74592843 CATTGAAGGCGGGCCGGGTACGG - Intronic
1027115642 7:75477636-75477658 AACTGGACCCAGGCCAGGTGTGG + Intronic
1027120891 7:75519013-75519035 AACTGGACCCAGGCCAGGTGTGG + Intergenic
1027159788 7:75793938-75793960 AAAAGAAAGCGGGCCAGGTGAGG + Intergenic
1027421868 7:78024688-78024710 AATTGAAAGAGGGCCACGTGTGG + Intronic
1028301508 7:89206459-89206481 AACTGAATGCTGGCCAGGCACGG + Intronic
1029112558 7:98221009-98221031 AACTGAAAGAGGGCCAGGCGCGG + Intronic
1029282283 7:99443626-99443648 AATTGTATGTGGGCCAGGTGTGG + Intronic
1029464034 7:100714317-100714339 AACTGATGAGGGGCCGGGTGAGG - Intergenic
1029721895 7:102372997-102373019 AACTGGATCCAGGCCAGGTGTGG - Intronic
1029727088 7:102413935-102413957 ACTGGAAGGAGGGCCAGGTGCGG + Intronic
1030250226 7:107435360-107435382 AACTGAAATCTGGCCAGGCGCGG + Intronic
1030288521 7:107849416-107849438 AAATAAAAGCAGGCCAGGTGCGG - Intergenic
1030609469 7:111673078-111673100 ACCTAAAGGCTGGCCAGGCGTGG - Intergenic
1031599742 7:123692512-123692534 ATCAGAAGGCAGGCCAGGCGGGG + Exonic
1031695750 7:124850973-124850995 AAATTAAGACAGGCCAGGTGTGG + Intronic
1031982032 7:128134334-128134356 AATTAAAGGAGTGCCAGGTGGGG + Intergenic
1032147817 7:129400014-129400036 TAATGAAAGGGGGCCAGGTGCGG - Intronic
1032330910 7:130978099-130978121 AACCAAAGTAGGGCCAGGTGTGG - Intergenic
1032816738 7:135483532-135483554 AACTCCAAGCAGGCCAGGTGCGG + Intronic
1033148353 7:138890969-138890991 AGATGAAGGCGGGCCCAGTGGGG - Intronic
1033352700 7:140574507-140574529 AAGAGAAACCGGGCCAGGTGTGG - Intronic
1033378173 7:140784935-140784957 AACTTAAGTCGGGCCAGGCGCGG - Intronic
1034770641 7:153771628-153771650 CACTTCAGGGGGGCCAGGTGTGG - Intergenic
1035311626 7:157973243-157973265 AACTAAAGGCAGGCCAAGTAGGG - Intronic
1035596543 8:862581-862603 AACTGGAGTCTGGCCAGGCGAGG - Intergenic
1036252445 8:7173876-7173898 AACTGCATTCTGGCCAGGTGTGG + Intergenic
1036365051 8:8113584-8113606 AACTGCATTCTGGCCAGGTGTGG - Intergenic
1036812526 8:11877356-11877378 AACTGGAACCGGGCCGGGTGCGG + Intergenic
1036885876 8:12552504-12552526 AACTGCAGTCTGGCCAAGTGTGG + Intergenic
1036950862 8:13137886-13137908 AAGTGATGTCTGGCCAGGTGCGG - Intronic
1037580658 8:20244310-20244332 AGCACAAGGCGGGCCAGGTGCGG - Intergenic
1037975562 8:23208744-23208766 AACTGAATGCCGGCCAGGCGCGG - Intronic
1038032830 8:23659675-23659697 AAAAGTAGGCAGGCCAGGTGTGG + Intergenic
1038564288 8:28606842-28606864 AAAGGAAGGAAGGCCAGGTGGGG - Intronic
1038599539 8:28926006-28926028 AAATGAACCTGGGCCAGGTGCGG + Intronic
1038831491 8:31066166-31066188 AACTGTCTGCCGGCCAGGTGCGG - Intronic
1038971966 8:32646634-32646656 GACTGAAAGCTGGCAAGGTGGGG + Intronic
1039811704 8:41054813-41054835 AACCAAAAGTGGGCCAGGTGTGG - Intergenic
1039984411 8:42435824-42435846 CACTGAAGGATGGCCGGGTGTGG + Intronic
1039988574 8:42468437-42468459 AGCTGAGGGAGGGCCTGGTGGGG + Intronic
1040015608 8:42696663-42696685 ACCAGAAGGTGGGCCTGGTGGGG + Intergenic
1040027215 8:42792814-42792836 AAGGGAAGGTGGGCCAGGCGCGG + Intronic
1040558054 8:48498594-48498616 AACTGAAGCTTGGCCAGGCGTGG - Intergenic
1043091861 8:75914298-75914320 AACTAAAGCTGGGCCAGGTGCGG - Intergenic
1043430118 8:80186330-80186352 AACTGATTGGGGGCCAGGTGCGG - Intronic
1043874916 8:85475015-85475037 AACTTAAAAGGGGCCAGGTGTGG + Intronic
1044082305 8:87900769-87900791 AGTTGAAGGTGGGCCAGGTGCGG - Intergenic
1045014399 8:97987129-97987151 AACTAAAAGTAGGCCAGGTGTGG - Intronic
1046333675 8:112755039-112755061 TAATGAGGGCGGGCCAGGCGAGG + Intronic
1047072691 8:121364636-121364658 AACTGAATGCTGGCCGGGTGCGG + Intergenic
1047531763 8:125683231-125683253 CACTGAAGACAGGCCATGTGAGG - Intergenic
1049032053 8:140045333-140045355 AACCCAAGTCCGGCCAGGTGCGG + Intronic
1050324417 9:4486010-4486032 AGCAAAAGTCGGGCCAGGTGCGG - Intergenic
1050538525 9:6650371-6650393 AAGTGGAGGCAGGCCAGGTGCGG - Intergenic
1052486158 9:29102369-29102391 AGCTGCAGATGGGCCAGGTGTGG - Intergenic
1052961931 9:34305894-34305916 TAATGAAGTGGGGCCAGGTGTGG - Intronic
1053240703 9:36492525-36492547 TACTGAAGGGGCGCCGGGTGCGG + Intergenic
1053353190 9:37426657-37426679 AAGTGAACGCAGACCAGGTGCGG + Intronic
1053420403 9:37973962-37973984 AACTGAAATCAGGCCGGGTGTGG + Intronic
1055085891 9:72314054-72314076 AACTGAAGGTGGGCCCTTTGGGG - Intergenic
1056775087 9:89506054-89506076 AACTGAATGCTAACCAGGTGGGG - Intergenic
1057127131 9:92626105-92626127 TACTGAAATGGGGCCAGGTGTGG + Intronic
1057424677 9:94938651-94938673 GACTGAAGGTGGGCCAGGCAAGG + Intronic
1057456183 9:95214135-95214157 AACAGAAAATGGGCCAGGTGTGG + Intronic
1057828841 9:98391982-98392004 AGCTGAACCCAGGCCAGGTGTGG + Intronic
1057906156 9:98985080-98985102 AACTGAATAGGGGCCAGGTATGG - Intronic
1058157893 9:101535195-101535217 AAGTCAAGGCGGGCCGGGCGCGG - Intronic
1058986397 9:110212114-110212136 ACCTGAAATCCGGCCAGGTGCGG + Intergenic
1059117345 9:111611548-111611570 AAGTGAAGATGGGCCCGGTGTGG - Intergenic
1060151003 9:121288216-121288238 GACAGAAAGCAGGCCAGGTGAGG - Intronic
1060569837 9:124628316-124628338 AATCAAAGGCAGGCCAGGTGCGG - Intronic
1060781991 9:126419744-126419766 ATCTGAAGACTGGCCAGGTCTGG - Intronic
1061512961 9:131072002-131072024 AAAAGAAGGAGGGCCAGGTGTGG + Intronic
1061523105 9:131133592-131133614 ACCTGAAATCAGGCCAGGTGCGG - Intronic
1061845787 9:133387285-133387307 AGCTGAAGGTGGGGCAGGAGGGG + Intronic
1061978001 9:134082101-134082123 GAATGAAGTTGGGCCAGGTGAGG + Intergenic
1061998473 9:134202842-134202864 AAAAGAAGCCAGGCCAGGTGTGG + Intergenic
1062039821 9:134399170-134399192 AGCTGAAGGTGGGTGAGGTGGGG + Intronic
1203542207 Un_KI270743v1:99757-99779 AATTGAAGAGAGGCCAGGTGCGG + Intergenic
1185876529 X:3706475-3706497 AATTCAAGGGAGGCCAGGTGTGG - Intronic
1185953642 X:4464758-4464780 AATGGAATGCAGGCCAGGTGTGG + Intergenic
1186154323 X:6709830-6709852 AACTAAATTTGGGCCAGGTGTGG + Intergenic
1186180557 X:6968908-6968930 AGATGAAGAAGGGCCAGGTGCGG - Intergenic
1186193998 X:7093813-7093835 AACAGAAACTGGGCCAGGTGTGG + Intronic
1187920547 X:24197177-24197199 AACTTGAGACAGGCCAGGTGTGG + Intronic
1188015591 X:25104424-25104446 AAGTGACTGCTGGCCAGGTGTGG - Intergenic
1188408074 X:29836967-29836989 TAATGAAGGTGGGCCAGGTGCGG + Intronic
1189082668 X:37991396-37991418 AGCTGAAGGCGGGGAAGGGGTGG + Intronic
1189252536 X:39612665-39612687 AACAGAATGGCGGCCAGGTGCGG + Intergenic
1189313837 X:40039530-40039552 AACTAAAAATGGGCCAGGTGTGG - Intergenic
1189325041 X:40106761-40106783 AACGGAAGGCGGTGCAGGCGGGG + Intronic
1190143586 X:47869983-47870005 AAATGCAGTTGGGCCAGGTGTGG - Intronic
1190273801 X:48887074-48887096 AACTGAAAGGGGGCTAAGTGGGG + Intergenic
1190823771 X:53998161-53998183 AAAGAAAGGCAGGCCAGGTGTGG + Intronic
1190883332 X:54509183-54509205 AACAGAAGGAGGGCCAGGTGCGG - Intergenic
1192589748 X:72350085-72350107 AACTGGAGAAGGGCCAGGAGTGG + Intronic
1193384356 X:80853172-80853194 AAATTAAGTCAGGCCAGGTGTGG + Intergenic
1193680200 X:84509366-84509388 AAGTGAAGGCAGGCTGGGTGCGG - Intergenic
1194281627 X:91960712-91960734 ACCTGAAACCTGGCCAGGTGTGG - Intronic
1194619282 X:96149024-96149046 TACAGAAAGGGGGCCAGGTGCGG + Intergenic
1194840343 X:98732648-98732670 ATCAGAAAGAGGGCCAGGTGTGG - Intergenic
1195040083 X:101005928-101005950 AAAAGAATGTGGGCCAGGTGCGG + Intergenic
1196151544 X:112380440-112380462 AATTGATCCCGGGCCAGGTGCGG - Intergenic
1196259035 X:113555844-113555866 ACCGGAAGGCAGGCCGGGTGCGG - Intergenic
1196310458 X:114158292-114158314 AATTCAAAGTGGGCCAGGTGTGG + Intergenic
1196666789 X:118325698-118325720 AACTGAGGGCGGGGGAGGGGGGG - Intergenic
1196689063 X:118539758-118539780 AGCTGAAGGAGGGCCAGGCATGG + Intronic
1196845689 X:119895247-119895269 ACCTGAAGCCTGGCCAGGTGGGG + Intergenic
1196915599 X:120531748-120531770 CAGTGAAGGTGGGCCAGGTACGG - Intronic
1197213007 X:123843551-123843573 AACTGAGGCCAGGCCGGGTGTGG - Intergenic
1198030300 X:132747887-132747909 AACTGCAGGCTGGCCAGGTTTGG + Intronic
1198194784 X:134349292-134349314 AAGTTAATGAGGGCCAGGTGTGG + Intergenic
1199756201 X:150867471-150867493 AACATAATGTGGGCCAGGTGCGG + Intronic
1200282346 X:154787760-154787782 AAGGGAAAGCTGGCCAGGTGTGG - Intronic
1200599221 Y:5185367-5185389 ACCTGAAACCTGGCCAGGTGTGG - Intronic
1200748611 Y:6924296-6924318 AAGTGAAGTTGGGCCAGGTGCGG + Intronic
1201074622 Y:10177669-10177691 AAGAAAAGGCAGGCCAGGTGCGG - Intergenic
1201163824 Y:11189251-11189273 AATTGAAGGGAGGCCGGGTGCGG - Intergenic
1201224299 Y:11802532-11802554 AACAGCAGGCAAGCCAGGTGTGG + Intergenic
1201327341 Y:12776429-12776451 AAGTGAATGTTGGCCAGGTGTGG - Intronic
1201534004 Y:15025297-15025319 AACTAAATGGGGGCCAGGTGTGG - Intergenic
1201783028 Y:17744064-17744086 AAGTGAAGGCTGGCCAGCTGTGG - Intergenic
1201818525 Y:18161923-18161945 AAGTGAAGGCTGGCCAGCTGTGG + Intergenic
1202174390 Y:22084295-22084317 AACTGGAGGCTGGCCTGCTGTGG - Intronic
1202216970 Y:22502087-22502109 AACTGGAGGCTGGCCTGCTGTGG + Intronic
1202326217 Y:23693983-23694005 AACTGGAGGCTGGCCTGCTGTGG - Intergenic
1202544555 Y:25976071-25976093 AACTGGAGGCTGGCCTGCTGTGG + Intergenic