ID: 1151277302

View in Genome Browser
Species Human (GRCh38)
Location 17:73045116-73045138
Sequence TACCCAAGGCTACCCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151277302_1151277305 6 Left 1151277302 17:73045116-73045138 CCTCTCTGGGGTAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1151277305 17:73045145-73045167 CTAAGTACCTGACAAGGCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 123
1151277302_1151277304 0 Left 1151277302 17:73045116-73045138 CCTCTCTGGGGTAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1151277304 17:73045139-73045161 CAGTCACTAAGTACCTGACAAGG 0: 1
1: 0
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151277302 Original CRISPR TACCCAAGGCTACCCCAGAG AGG (reversed) Intronic
900431709 1:2605876-2605898 CACCCGCGGCTCCCCCAGAGTGG + Intronic
902575065 1:17372474-17372496 GACCCAAGGCTTCCCAAGATGGG - Intronic
902623050 1:17661534-17661556 TACCCTAGGCTTCCACAGCGAGG + Intronic
905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG + Intergenic
912475753 1:109933782-109933804 TGCCCAGGGCTTGCCCAGAGGGG - Intergenic
913401196 1:118435415-118435437 AACCCAAGGCTATCACAGTGTGG - Intergenic
913681579 1:121190954-121190976 GCCCCAACCCTACCCCAGAGTGG + Intronic
914033414 1:143978591-143978613 GCCCCAACCCTACCCCAGAGTGG + Intergenic
914156031 1:145089380-145089402 GCCCCAACCCTACCCCAGAGTGG - Intronic
920380892 1:205534014-205534036 GACCCCAGGCTACCCCTGGGAGG - Intergenic
920468895 1:206209472-206209494 GCCCCAACCCTACCCCAGAGTGG + Intronic
1068526650 10:58138145-58138167 AACCCAAGGCAACCCCACAAAGG + Intergenic
1069437917 10:68402420-68402442 TACCCAAGGACACCCAAGATAGG + Intronic
1069911415 10:71762071-71762093 TACTCCTGGCAACCCCAGAGCGG + Intronic
1077310444 11:1886596-1886618 TTCCCAATGCAGCCCCAGAGTGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083587648 11:63872180-63872202 AGCCCAAGGCTGCCACAGAGAGG - Intronic
1083719498 11:64597445-64597467 TCCCCAAGTCTTCCCCAGCGTGG + Intronic
1084179299 11:67438566-67438588 AACCCACCACTACCCCAGAGAGG + Intronic
1085526862 11:77169263-77169285 TGCCCACGGCTGCCCCAGGGAGG - Intronic
1085584339 11:77687459-77687481 TACCCAAGGTTACCCAAGGTGGG - Intronic
1086899233 11:92347555-92347577 GAGCCAAGGCTGTCCCAGAGAGG + Intergenic
1089777120 11:120845925-120845947 TACCCAATGCAAACCCTGAGAGG + Intronic
1091178968 11:133586247-133586269 CACCCAAGGGTACTCCAGTGGGG + Intergenic
1096084817 12:48858312-48858334 TCCCCAGGGCCACTCCAGAGGGG + Intronic
1099580170 12:84435996-84436018 TAGCCAAGGCTCCCACTGAGAGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1103856270 12:123972979-123973001 TACCCAGGGCAACCGCAGTGCGG - Intronic
1106500254 13:30321580-30321602 TATCCAAGGCTACTCCAATGAGG - Intergenic
1115535881 14:34372925-34372947 TACCAAAGGCCAACACAGAGAGG - Intronic
1118906441 14:70027179-70027201 GAGTCAAGGCTAGCCCAGAGAGG + Intronic
1122045666 14:99021382-99021404 TGCAGAAGGCGACCCCAGAGAGG - Intergenic
1124707101 15:31975203-31975225 TCCGCAGGGCTACACCAGAGTGG - Intergenic
1129711482 15:77822489-77822511 GACACAAGGGGACCCCAGAGAGG - Intergenic
1133264600 16:4575665-4575687 TCCCCAAGGCTGGCCCAGGGTGG + Exonic
1134243117 16:12520318-12520340 TACACCAGGCTTCCCCAAAGCGG - Intronic
1135539300 16:23317639-23317661 TCCCAAAGGGTTCCCCAGAGCGG + Intronic
1141253866 16:82382998-82383020 TCCTCAAGGCAACCCCCGAGGGG + Intergenic
1141736179 16:85855372-85855394 TGTCACAGGCTACCCCAGAGGGG + Intergenic
1144088236 17:11830030-11830052 AACCCAAGTCCACCACAGAGAGG - Intronic
1149685261 17:58531402-58531424 TTCCCAAAGGGACCCCAGAGAGG - Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1156646428 18:39167206-39167228 TACCCAAGACTACCTGAGACAGG - Intergenic
1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG + Intergenic
1161044294 19:2126873-2126895 TACCCAAGGGGACTCCAGAGTGG + Intronic
1162790475 19:13060282-13060304 CATCCAAGGCTTCCTCAGAGTGG - Intronic
1163509115 19:17724969-17724991 GACTCGAGGCTACCCCAAAGAGG + Intronic
1163520006 19:17786533-17786555 TAATCAGGGCTTCCCCAGAGAGG - Intronic
1165426211 19:35746788-35746810 TCCCCAAGGGCACCCCAGCGGGG - Exonic
1167243936 19:48362771-48362793 TACCCAAGGCCACAACATAGTGG - Intronic
925031017 2:649885-649907 TACCCCACGGTACCCCAAAGGGG + Intergenic
925537143 2:4929963-4929985 TATCCAAGGAAACCCCAGATCGG + Intergenic
928389450 2:30897919-30897941 TGCCCCAGGCAACCCCACAGGGG + Intergenic
931668112 2:64624649-64624671 TTCTCAAGGCTGGCCCAGAGGGG - Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932962312 2:76428031-76428053 TACCCCAGGATCCCCCAAAGAGG - Intergenic
934682877 2:96297952-96297974 TACCAAGGGCTACCCCTGAGGGG + Intronic
934692142 2:96370101-96370123 TACCCAGGGATACCACAGAGAGG + Intronic
937480333 2:122251705-122251727 TAGTCAAGTCTTCCCCAGAGTGG - Intergenic
937589536 2:123596437-123596459 TACCCAAGGCTACAACAGTCAGG + Intergenic
937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG + Intronic
940133084 2:150406360-150406382 TAACCCAGGCTACCCTAAAGAGG - Intergenic
946488616 2:220126006-220126028 AACCCCAGTCAACCCCAGAGGGG + Intergenic
1170645117 20:18190953-18190975 TCCCCAAGGCTTAGCCAGAGCGG - Intergenic
1172041428 20:32049306-32049328 TACCTAAGGCTACCTAAGTGTGG + Intergenic
1177101980 21:16909220-16909242 TCCCCAAGGCAACACCAGAATGG + Intergenic
1177617316 21:23539893-23539915 TCCCCTAGGCTAGCCCAGTGTGG - Intergenic
1181513169 22:23397824-23397846 GACCCAAGGCCACCCCAGCCTGG - Intergenic
1182559365 22:31147726-31147748 TGCCCAAGGCTGCCCAGGAGGGG - Intergenic
1184320930 22:43741740-43741762 TACCGAATCCTGCCCCAGAGTGG - Intronic
1184471155 22:44697243-44697265 TACCCTGGGCTCCCCCAGCGTGG + Intronic
1184738428 22:46412514-46412536 TACCCAATCCTGGCCCAGAGAGG - Intronic
952710528 3:36427377-36427399 TTTCCAAGGCTGGCCCAGAGGGG - Intronic
954965107 3:54603410-54603432 CCCCTAAGGATACCCCAGAGGGG - Intronic
958266377 3:91442249-91442271 TACCCAGGGCTACCCTCTAGTGG + Intergenic
961746337 3:129065704-129065726 TGCCCATGGCTAGCCCTGAGGGG + Intergenic
962405422 3:135095891-135095913 TTCCCAAGGCTCTCCCAGAGTGG + Intronic
965864621 3:173190867-173190889 GACCCAAGGCTTCACCAGATGGG + Intergenic
966412611 3:179658659-179658681 TACCCAAGGAGTCCCCAGTGAGG - Intronic
967880005 3:194295074-194295096 TATTTAAGGCTGCCCCAGAGAGG - Intergenic
967895246 3:194390111-194390133 TACTCAATGGAACCCCAGAGAGG + Intergenic
973897137 4:55424540-55424562 CACCCACGGCTACACCATAGGGG - Exonic
987443277 5:17984160-17984182 TTTCCAAGGCTACACCAGACTGG + Intergenic
988508594 5:31846089-31846111 AACCCAAAGCCACCACAGAGGGG - Intronic
993042038 5:82825154-82825176 TTCTCAAGGCTTCCCCAGACAGG - Intergenic
996342128 5:122450907-122450929 ACCCCAAGACTACCCCAGTGAGG + Exonic
997280228 5:132638301-132638323 CACCCAAGGCTACACCTGAATGG + Intronic
997467343 5:134096956-134096978 AATCCACGGCTTCCCCAGAGGGG - Intergenic
1003451495 6:6237800-6237822 TTCCCAGGGCTAGCACAGAGTGG + Intronic
1006379773 6:33690789-33690811 TTCCCAAGGCTCCTCCAGGGAGG - Intronic
1006640111 6:35485489-35485511 AACCCAAGGCCTCCCCAGAATGG + Intronic
1008988896 6:57579708-57579730 TACCCAGGGCTACCCTCTAGTGG - Intronic
1009177437 6:60477946-60477968 TACCCAGGGCTACCCTCTAGTGG - Intergenic
1009940908 6:70286827-70286849 TACCAAAGGCTACAGCAGAATGG + Intronic
1010507506 6:76678348-76678370 TAACCAAGTCTAACCCAGAAGGG - Intergenic
1010723786 6:79311396-79311418 TAGCCAAGTCTACCACATAGTGG + Intergenic
1013864379 6:114677392-114677414 TAAACTAGGCAACCCCAGAGGGG - Intergenic
1019802436 7:3098103-3098125 TAGCCAAGGCAGCCCTAGAGAGG + Intergenic
1025851384 7:65247498-65247520 TAGCCAAGGGCATCCCAGAGTGG - Intergenic
1026455809 7:70571694-70571716 TCCCCAAGGCTCCTCCACAGAGG - Intronic
1039219630 8:35315307-35315329 GACCCAAGCCTGCCCCATAGGGG - Intronic
1044992958 8:97812730-97812752 AACCCAAGACAACCTCAGAGTGG + Intronic
1058937940 9:109786298-109786320 TTCCCAAGGATCCCTCAGAGGGG + Intronic
1059755451 9:117289237-117289259 GACCCAAGGCTACCACCGTGTGG - Intronic
1060656334 9:125374964-125374986 GCCCCAAGGCTCCTCCAGAGAGG - Intergenic
1189128906 X:38478338-38478360 TATCCAAGGCTACCACAAAGTGG + Intronic
1189235423 X:39483456-39483478 CAGCCAAGTCTAACCCAGAGAGG + Intergenic
1195992517 X:110696741-110696763 TACATAAGGATACCTCAGAGCGG - Intronic
1199274191 X:145922793-145922815 CACCTATGGCTACCCCACAGTGG - Intergenic
1200906130 Y:8484723-8484745 TTCTCAAGGCAAGCCCAGAGAGG - Intergenic