ID: 1151277304

View in Genome Browser
Species Human (GRCh38)
Location 17:73045139-73045161
Sequence CAGTCACTAAGTACCTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151277302_1151277304 0 Left 1151277302 17:73045116-73045138 CCTCTCTGGGGTAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1151277304 17:73045139-73045161 CAGTCACTAAGTACCTGACAAGG 0: 1
1: 0
2: 0
3: 12
4: 142
1151277299_1151277304 10 Left 1151277299 17:73045106-73045128 CCTAAAATGGCCTCTCTGGGGTA 0: 1
1: 0
2: 1
3: 15
4: 179
Right 1151277304 17:73045139-73045161 CAGTCACTAAGTACCTGACAAGG 0: 1
1: 0
2: 0
3: 12
4: 142
1151277294_1151277304 28 Left 1151277294 17:73045088-73045110 CCAGGTTCTGGGGTCTATCCTAA 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1151277304 17:73045139-73045161 CAGTCACTAAGTACCTGACAAGG 0: 1
1: 0
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151277304 Original CRISPR CAGTCACTAAGTACCTGACA AGG Intronic
901615118 1:10532916-10532938 CACACACTAAATAACTGACAGGG - Intronic
901881630 1:12197492-12197514 CAGTCACAAAGAGCCTGGCAGGG - Intronic
902152051 1:14451218-14451240 CAGTTGCTAAGTACCCCACAAGG + Intergenic
905970708 1:42140165-42140187 CACTTACTAAGTGCCAGACATGG - Intergenic
908045645 1:60165310-60165332 CAGTCACTGAGTAGTTGACATGG - Intergenic
908182546 1:61620646-61620668 AAGACAGTAAGTATCTGACATGG + Intergenic
910264597 1:85325021-85325043 CAGTCACTTAGAACCAGAAAAGG + Intronic
910789851 1:91039751-91039773 CAGAAACTAATTACCTGACCAGG - Intergenic
915255461 1:154625538-154625560 CACTTGCTATGTACCTGACACGG - Intronic
916212172 1:162367886-162367908 CAGAAACAAAGTACCTGAGAAGG - Exonic
917371016 1:174294509-174294531 TAGTCTCTAAATTCCTGACATGG - Intronic
921134508 1:212248275-212248297 CATTTACTGAGTACCTGACATGG + Intergenic
1063918737 10:10910944-10910966 GAGCCGCTAAGTACCTGACTCGG - Intergenic
1065749740 10:28874777-28874799 CAGTCACAAAGTCCTGGACAAGG - Intronic
1066008562 10:31171024-31171046 CAGAAACTAAGAACCTGATATGG - Intergenic
1068213886 10:53957525-53957547 CAGTCACTTAGTAACTGTCTGGG - Intronic
1070748624 10:78950703-78950725 CAGTCACTGAGTGCCTGGCATGG - Intergenic
1073032996 10:100542985-100543007 CATTTACTAAGTACCTACCATGG - Intronic
1073655709 10:105413133-105413155 CATTTACTAGGTGCCTGACATGG - Intergenic
1074067650 10:110031693-110031715 CACTCACTAGGTACCAGATAGGG - Intronic
1075086972 10:119420068-119420090 CAGCCAGTAAGTGCCTGAGAGGG - Intronic
1075388230 10:122073218-122073240 CACTCTCTCAGTACCTGCCATGG - Intronic
1075876851 10:125814676-125814698 GGGTCACTAAGTGCCTGACATGG + Intronic
1079613143 11:22457743-22457765 CTGTAACAAAATACCTGACATGG + Intergenic
1080080654 11:28214506-28214528 CATTGATTAACTACCTGACACGG - Intronic
1081247313 11:40784257-40784279 CAGTCACTAAGCAACTGCCCAGG + Intronic
1085734463 11:79027283-79027305 CAGTCACCAAGTTTCTGACCTGG + Intronic
1093069542 12:14694457-14694479 CAGTTACTAAGTACCTATCATGG - Intronic
1094089119 12:26628721-26628743 CAGAAACTAAGTACCTAGCAAGG + Intronic
1094447924 12:30552264-30552286 CAGGCACCAGGAACCTGACAGGG + Intergenic
1099913924 12:88868062-88868084 CATTTACTAAGTGCCAGACATGG + Intergenic
1101624059 12:106421528-106421550 TAGTCAATAAGTACATGAAAAGG - Intronic
1103422780 12:120801821-120801843 CTGACACTAATTAGCTGACAGGG - Intronic
1104544225 12:129696672-129696694 CAGTCTCTACTTACCTGCCATGG - Intronic
1105433432 13:20357929-20357951 CAGTGACTACTTTCCTGACATGG + Intergenic
1107426235 13:40295894-40295916 CATTTATCAAGTACCTGACAGGG - Intergenic
1108025171 13:46170044-46170066 CATTTACTGAGTACCTCACATGG - Intronic
1108705385 13:52980840-52980862 TAGTCACTTAGTAGCTGTCATGG - Intergenic
1109983344 13:69940575-69940597 GATTCTCTAAGTATCTGACAAGG + Intronic
1110918221 13:81049792-81049814 CTGTAATTAAGTACTTGACAGGG + Intergenic
1116325560 14:43529849-43529871 CAGTCACTAAGAAGATAACATGG - Intergenic
1119231296 14:72981882-72981904 CGGTCACTTAGTGCCTGCCAAGG + Exonic
1125323053 15:38509332-38509354 CAGTCACTAAGTAGCCGTCTTGG - Intronic
1125537316 15:40449229-40449251 CACTCACTATGCACCTGGCAAGG - Intronic
1125740261 15:41957865-41957887 AAGACACCAAGTATCTGACATGG + Intronic
1132549028 16:546766-546788 CAGCCACTCAGGACCTCACAGGG + Intronic
1132654400 16:1035884-1035906 CACTCACTCAGCTCCTGACAGGG - Intergenic
1133862893 16:9613072-9613094 CATTCACTTAGTACCTTAGAAGG - Intergenic
1138813069 16:60173467-60173489 CTGTCACAAAGTACATGACTAGG - Intergenic
1144451610 17:15384620-15384642 CTGTCACTCAGCACCTGACAGGG - Intergenic
1146684264 17:34830139-34830161 CCCTCACTAAGTAACTGAAAGGG + Intergenic
1147416044 17:40290663-40290685 TAGTCACTTAGTAGCTGACTTGG - Intronic
1149247999 17:54734198-54734220 CAGCTATTAAGTACCAGACATGG - Intergenic
1151277304 17:73045139-73045161 CAGTCACTAAGTACCTGACAAGG + Intronic
1151627362 17:75285512-75285534 CAGCCAGTAAGCACCTGACTTGG + Intronic
1155672287 18:28386991-28387013 TAGTCAATAAGTACATGAAAAGG + Intergenic
1157212715 18:45757743-45757765 CAGACATCAAGTACCTAACAGGG + Intergenic
1160064305 18:75560930-75560952 CAGTCTCTAAGATACTGACAAGG + Intergenic
1163332679 19:16651123-16651145 CAGTCACTACCTCCCTGAGAGGG + Intronic
1164377705 19:27703685-27703707 CAGACACCAAGTACTTCACAAGG + Intergenic
1164429444 19:28174323-28174345 CAGTCACACGGTACCTGATACGG + Intergenic
1165806733 19:38584882-38584904 CATTCACTGAGTACCAGCCAAGG - Intronic
925144106 2:1569408-1569430 CAGTGAGTAAGAAACTGACAAGG - Intergenic
926995999 2:18736528-18736550 CAGACATTAAGTACTTCACAAGG - Intergenic
929081119 2:38123398-38123420 CACTCACTAGGTACCAGGCATGG - Intergenic
929891242 2:45920002-45920024 CAGTTACTCAGTAACTGGCAGGG - Intronic
931347538 2:61460362-61460384 AAGTCACTAAGTAGCTGTCCTGG + Intronic
934535551 2:95130246-95130268 CAGACACCAAGTACTTAACAAGG + Intronic
934677409 2:96259357-96259379 GAATCACTAAGTACCAGACTCGG + Intronic
936549482 2:113423902-113423924 CAGTTAATAAGTACCTGATGGGG - Intergenic
938837819 2:135125637-135125659 CAGTTACTAAGTGACTAACAGGG + Intronic
941174983 2:162185808-162185830 CAGACACTAAATGCCTGACCTGG - Intronic
946173296 2:217908001-217908023 CATACACTAAGGACCAGACAGGG - Intronic
946606905 2:221415376-221415398 CACTCACTGAATACCAGACATGG - Intergenic
947111218 2:226721502-226721524 GATTCACTGAGTCCCTGACAGGG - Intergenic
947448592 2:230184026-230184048 CAGTCACTTAGTAGCTGTCTTGG - Intronic
1170223471 20:13965365-13965387 CAGACAGTAAGTACCAGAAATGG + Intronic
1170980010 20:21203636-21203658 GAGTCACCAAGTAGCTGACAAGG - Intronic
1179436346 21:41364554-41364576 CAGTCACTACGTACCTGTTATGG + Intronic
1182162464 22:28136802-28136824 CAGTCTCTGTGTACCTGCCATGG - Intronic
1183494778 22:38136798-38136820 CAGTCAGTAAGTGCCAGACCTGG - Intronic
952393206 3:32898585-32898607 CAGACCCTCAGTACCTGACTTGG + Intergenic
957624812 3:82643577-82643599 AAGTCACTATATACCTGTCAGGG - Intergenic
957746972 3:84357799-84357821 CAGTCACTATGTACCTAGCAAGG + Intergenic
958271253 3:91502190-91502212 CAGACATTAAGTACTTTACAAGG - Intergenic
958722048 3:97855815-97855837 CAGACATTAAGTACTTCACAAGG + Intronic
961215275 3:125154964-125154986 CAGTCACTTAGTACCTGGCTTGG - Intronic
961373440 3:126446691-126446713 AACTCACTAGGTCCCTGACATGG + Intronic
962747642 3:138409241-138409263 CAGTCCCTAAGCACTTGAAAGGG + Intergenic
963410101 3:144916604-144916626 CAGTCACTGTTTACGTGACAGGG + Intergenic
963774908 3:149428812-149428834 CAGGCAGTAAGTGCCTGAGAGGG - Intergenic
965411239 3:168334406-168334428 CAGATAGTAAGTACCTGATATGG + Intergenic
969729418 4:8945133-8945155 GACTCACTAAGTACCAGACTTGG + Intergenic
971271981 4:25158709-25158731 TAGTCACCCAGAACCTGACAGGG + Intronic
973533275 4:51854189-51854211 TAGTCACTAGCTACATGACATGG - Intronic
975954791 4:79824634-79824656 CAGACATTAAGTACTTTACAAGG + Intergenic
977169960 4:93749894-93749916 AAGTCAGTAACTACCTCACAGGG + Intronic
983005101 4:162475131-162475153 CAGCCAAGAAGTAACTGACATGG - Intergenic
986204657 5:5612204-5612226 CATACACTAAGTACAAGACAAGG + Intergenic
987056522 5:14198716-14198738 CAGTCACTATGGACTTGACTGGG - Intronic
988946019 5:36200719-36200741 TAGTCACTTAGTAGCTGACTTGG + Intronic
993627968 5:90248935-90248957 CAGTCACTAAGTATTAGACTAGG + Intergenic
998416115 5:141947239-141947261 CATTCACTAAGTCCCAGGCATGG - Intronic
999710494 5:154314243-154314265 CAGCCACTAAGTGACAGACATGG + Intronic
999908382 5:156168888-156168910 CAGTCACTCAGCTGCTGACAAGG + Intronic
1000694821 5:164367824-164367846 TAGTCACTTAGTAGCTGACTGGG - Intergenic
1001145184 5:169177580-169177602 CAGCCACTGAGGACCTGACCAGG - Intronic
1003478308 6:6505636-6505658 CAGTCACTTAGTAACTGGGATGG + Intergenic
1004329369 6:14707774-14707796 AGGTTACTAAGTACCTGTCAGGG - Intergenic
1004932412 6:20475291-20475313 CAGTCACTTAGCAGCAGACATGG + Intronic
1007446088 6:41907253-41907275 CAGTCACTAGCTACCACACAGGG + Exonic
1008648330 6:53539008-53539030 CTGCCACTAAGTAGCTGAAAAGG + Intronic
1008983886 6:57519120-57519142 CAGACATTAAGTACTTTACAAGG + Intronic
1009171944 6:60412027-60412049 CAGACATTAAGTACTTTACAAGG + Intergenic
1012153712 6:95789840-95789862 AAGTCACTTTGTACCTAACAAGG - Intergenic
1013887109 6:114981253-114981275 TAGTCAGTGAGTAGCTGACATGG - Intergenic
1016706578 6:147115569-147115591 CGGTCACTAAGTACCAGAAAAGG - Intergenic
1021992876 7:26153701-26153723 TAGTCACTAAGTGACTGCCAAGG - Intronic
1024688696 7:51776186-51776208 CAGCCATCAAGCACCTGACAAGG + Intergenic
1027299053 7:76810354-76810376 CAGTCTATAAGTACCTAACCCGG + Intergenic
1028464948 7:91140785-91140807 CAGTCACTGAGTACTTGTTACGG - Intronic
1030520303 7:110590083-110590105 CAGTCACTAAGGACCTGTGGTGG - Intergenic
1031493560 7:122419140-122419162 CATTCATTAAATACCTGCCATGG - Intronic
1033991827 7:147297288-147297310 CACCCACTATGTACCAGACATGG + Intronic
1034276580 7:149826458-149826480 CAGGCACTAAGCACCTGGCCAGG - Intergenic
1035381216 7:158442230-158442252 CATTCTCTGATTACCTGACATGG + Intronic
1035872473 8:3150653-3150675 CATTCACTAAGTACCTAACTTGG + Intronic
1040557993 8:48498098-48498120 CAGTCACTCAGTAGCTGTCTAGG + Intergenic
1042773510 8:72404783-72404805 CAGTCAATAAATAGCTGACTGGG + Intergenic
1044493433 8:92847708-92847730 CTGTTATTAAGTACCTAACAAGG + Intergenic
1046136218 8:110030955-110030977 AAGTCTCTACGTCCCTGACAGGG - Intergenic
1046192208 8:110810950-110810972 TAGTCTCTAAGTACCTGTGAGGG + Intergenic
1047024969 8:120814329-120814351 CATTTACTAATTACATGACAGGG - Intergenic
1048882844 8:138884364-138884386 CAGTCAGTAAGTACCTATGAAGG + Intronic
1049903462 9:192926-192948 CAGTTAATAAGTACCTGATGGGG + Intergenic
1050529003 9:6571573-6571595 CAGTCACTTAGTAGCTGCCTTGG - Intronic
1051907112 9:22107790-22107812 CAGTCAACAAGTACCTCATATGG - Intergenic
1053303173 9:36966064-36966086 CAGTCACTAAGAGAATGACAAGG + Intronic
1053746471 9:41203220-41203242 CAGTTAATAAGTACCTGATGGGG + Intergenic
1054480794 9:65662002-65662024 CAGTTAATAAGTACCTGATGGGG - Intergenic
1054681873 9:68228058-68228080 CAGTTAATAAGTACCTGATGGGG - Intergenic
1055270383 9:74551406-74551428 TAGTCACTTAGTAGCTGACCTGG - Intronic
1056820417 9:89837774-89837796 CAGTCACTAAGCAACAGACTAGG - Intergenic
1059705943 9:116823351-116823373 CAGTCAGTCAGTAAATGACAGGG - Intronic
1059813812 9:117888488-117888510 CAATCACTTGGTACCTAACATGG + Intergenic
1060129816 9:121085239-121085261 CAGTCACTAACTCCCACACATGG - Intronic
1060325181 9:122607956-122607978 CAGTGACCAAGTACATGACCAGG - Intergenic
1060722599 9:125988919-125988941 CATTGACTAAGTGCCTGCCATGG - Intergenic
1061887164 9:133597087-133597109 CAGTAACAAATTACCTGGCATGG + Intergenic
1202782602 9_KI270718v1_random:13995-14017 CAGTTAATAAGTACCTGATGGGG + Intergenic
1189247456 X:39574656-39574678 CAGTGGCTAAGTACCTGCAATGG - Intergenic
1193749953 X:85329094-85329116 CAGCTACTAAGTGCCTGAGATGG - Intronic
1196838440 X:119835347-119835369 CAGTTACTAGGTACCTGAGGTGG - Intronic
1198503816 X:137281154-137281176 CAGCCAGTCAGTACCTAACATGG - Intergenic
1199424954 X:147690668-147690690 CTGTCACTAAATTCATGACAAGG - Intergenic