ID: 1151283859

View in Genome Browser
Species Human (GRCh38)
Location 17:73095833-73095855
Sequence GAATCCAGATGGAGTTCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151283859_1151283864 12 Left 1151283859 17:73095833-73095855 CCCATAGAACTCCATCTGGATTC No data
Right 1151283864 17:73095868-73095890 CTCCTTCTGTCTTATACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151283859 Original CRISPR GAATCCAGATGGAGTTCTAT GGG (reversed) Intergenic