ID: 1151283859 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:73095833-73095855 |
| Sequence | GAATCCAGATGGAGTTCTAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1151283859_1151283864 | 12 | Left | 1151283859 | 17:73095833-73095855 | CCCATAGAACTCCATCTGGATTC | No data | ||
| Right | 1151283864 | 17:73095868-73095890 | CTCCTTCTGTCTTATACTGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1151283859 | Original CRISPR | GAATCCAGATGGAGTTCTAT GGG (reversed) | Intergenic | ||