ID: 1151283864

View in Genome Browser
Species Human (GRCh38)
Location 17:73095868-73095890
Sequence CTCCTTCTGTCTTATACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151283859_1151283864 12 Left 1151283859 17:73095833-73095855 CCCATAGAACTCCATCTGGATTC No data
Right 1151283864 17:73095868-73095890 CTCCTTCTGTCTTATACTGTAGG No data
1151283860_1151283864 11 Left 1151283860 17:73095834-73095856 CCATAGAACTCCATCTGGATTCT No data
Right 1151283864 17:73095868-73095890 CTCCTTCTGTCTTATACTGTAGG No data
1151283857_1151283864 22 Left 1151283857 17:73095823-73095845 CCTCTAAGGTCCCATAGAACTCC No data
Right 1151283864 17:73095868-73095890 CTCCTTCTGTCTTATACTGTAGG No data
1151283862_1151283864 1 Left 1151283862 17:73095844-73095866 CCATCTGGATTCTAAGGCACTTG No data
Right 1151283864 17:73095868-73095890 CTCCTTCTGTCTTATACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151283864 Original CRISPR CTCCTTCTGTCTTATACTGT AGG Intergenic