ID: 1151284543

View in Genome Browser
Species Human (GRCh38)
Location 17:73100508-73100530
Sequence TGGATGAAGCAGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151284543_1151284547 -2 Left 1151284543 17:73100508-73100530 CCTTCCTCACTCTGCTTCATCCA No data
Right 1151284547 17:73100529-73100551 CAGGCTGATCTGCCTTCTCCTGG No data
1151284543_1151284550 24 Left 1151284543 17:73100508-73100530 CCTTCCTCACTCTGCTTCATCCA No data
Right 1151284550 17:73100555-73100577 ACCAAGCACACTCCTGCCTCAGG No data
1151284543_1151284552 25 Left 1151284543 17:73100508-73100530 CCTTCCTCACTCTGCTTCATCCA No data
Right 1151284552 17:73100556-73100578 CCAAGCACACTCCTGCCTCAGGG 0: 3
1: 17
2: 91
3: 311
4: 845

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151284543 Original CRISPR TGGATGAAGCAGAGTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr