ID: 1151287981

View in Genome Browser
Species Human (GRCh38)
Location 17:73127333-73127355
Sequence CCTCTGTCTTTGACCTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 192}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151287981_1151287987 -3 Left 1151287981 17:73127333-73127355 CCCCTCAAGGTCAAAGACAGAGG 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1151287987 17:73127353-73127375 AGGCAGGCAACTGAGCTTTTGGG No data
1151287981_1151287990 13 Left 1151287981 17:73127333-73127355 CCCCTCAAGGTCAAAGACAGAGG 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1151287990 17:73127369-73127391 TTTTGGGCCTGCAGGAGGCACGG No data
1151287981_1151287988 5 Left 1151287981 17:73127333-73127355 CCCCTCAAGGTCAAAGACAGAGG 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1151287988 17:73127361-73127383 AACTGAGCTTTTGGGCCTGCAGG No data
1151287981_1151287989 8 Left 1151287981 17:73127333-73127355 CCCCTCAAGGTCAAAGACAGAGG 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1151287989 17:73127364-73127386 TGAGCTTTTGGGCCTGCAGGAGG No data
1151287981_1151287993 29 Left 1151287981 17:73127333-73127355 CCCCTCAAGGTCAAAGACAGAGG 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1151287993 17:73127385-73127407 GGCACGGCCCTCTCCACCATGGG No data
1151287981_1151287992 28 Left 1151287981 17:73127333-73127355 CCCCTCAAGGTCAAAGACAGAGG 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1151287992 17:73127384-73127406 AGGCACGGCCCTCTCCACCATGG No data
1151287981_1151287986 -4 Left 1151287981 17:73127333-73127355 CCCCTCAAGGTCAAAGACAGAGG 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1151287986 17:73127352-73127374 GAGGCAGGCAACTGAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151287981 Original CRISPR CCTCTGTCTTTGACCTTGAG GGG (reversed) Intergenic