ID: 1151287984

View in Genome Browser
Species Human (GRCh38)
Location 17:73127335-73127357
Sequence TGCCTCTGTCTTTGACCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151287984_1151287990 11 Left 1151287984 17:73127335-73127357 CCTCAAGGTCAAAGACAGAGGCA No data
Right 1151287990 17:73127369-73127391 TTTTGGGCCTGCAGGAGGCACGG No data
1151287984_1151287986 -6 Left 1151287984 17:73127335-73127357 CCTCAAGGTCAAAGACAGAGGCA No data
Right 1151287986 17:73127352-73127374 GAGGCAGGCAACTGAGCTTTTGG No data
1151287984_1151287988 3 Left 1151287984 17:73127335-73127357 CCTCAAGGTCAAAGACAGAGGCA No data
Right 1151287988 17:73127361-73127383 AACTGAGCTTTTGGGCCTGCAGG No data
1151287984_1151287987 -5 Left 1151287984 17:73127335-73127357 CCTCAAGGTCAAAGACAGAGGCA No data
Right 1151287987 17:73127353-73127375 AGGCAGGCAACTGAGCTTTTGGG No data
1151287984_1151287989 6 Left 1151287984 17:73127335-73127357 CCTCAAGGTCAAAGACAGAGGCA No data
Right 1151287989 17:73127364-73127386 TGAGCTTTTGGGCCTGCAGGAGG No data
1151287984_1151287992 26 Left 1151287984 17:73127335-73127357 CCTCAAGGTCAAAGACAGAGGCA No data
Right 1151287992 17:73127384-73127406 AGGCACGGCCCTCTCCACCATGG No data
1151287984_1151287993 27 Left 1151287984 17:73127335-73127357 CCTCAAGGTCAAAGACAGAGGCA No data
Right 1151287993 17:73127385-73127407 GGCACGGCCCTCTCCACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151287984 Original CRISPR TGCCTCTGTCTTTGACCTTG AGG (reversed) Intergenic