ID: 1151287993

View in Genome Browser
Species Human (GRCh38)
Location 17:73127385-73127407
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151287984_1151287993 27 Left 1151287984 17:73127335-73127357 CCTCAAGGTCAAAGACAGAGGCA No data
Right 1151287993 17:73127385-73127407 GGCACGGCCCTCTCCACCATGGG No data
1151287981_1151287993 29 Left 1151287981 17:73127333-73127355 CCCCTCAAGGTCAAAGACAGAGG No data
Right 1151287993 17:73127385-73127407 GGCACGGCCCTCTCCACCATGGG No data
1151287983_1151287993 28 Left 1151287983 17:73127334-73127356 CCCTCAAGGTCAAAGACAGAGGC No data
Right 1151287993 17:73127385-73127407 GGCACGGCCCTCTCCACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151287993 Original CRISPR GGCACGGCCCTCTCCACCAT GGG Intergenic