ID: 1151287993 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:73127385-73127407 |
| Sequence | GGCACGGCCCTCTCCACCAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1151287981_1151287993 | 29 | Left | 1151287981 | 17:73127333-73127355 | CCCCTCAAGGTCAAAGACAGAGG | 0: 1 1: 0 2: 1 3: 14 4: 192 |
||
| Right | 1151287993 | 17:73127385-73127407 | GGCACGGCCCTCTCCACCATGGG | No data | ||||
| 1151287984_1151287993 | 27 | Left | 1151287984 | 17:73127335-73127357 | CCTCAAGGTCAAAGACAGAGGCA | No data | ||
| Right | 1151287993 | 17:73127385-73127407 | GGCACGGCCCTCTCCACCATGGG | No data | ||||
| 1151287983_1151287993 | 28 | Left | 1151287983 | 17:73127334-73127356 | CCCTCAAGGTCAAAGACAGAGGC | No data | ||
| Right | 1151287993 | 17:73127385-73127407 | GGCACGGCCCTCTCCACCATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1151287993 | Original CRISPR | GGCACGGCCCTCTCCACCAT GGG | Intergenic | ||