ID: 1151288993

View in Genome Browser
Species Human (GRCh38)
Location 17:73134942-73134964
Sequence GTGTGGAAGGGGAAGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151288986_1151288993 14 Left 1151288986 17:73134905-73134927 CCTAAATATATCTGTATGTATGT No data
Right 1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG No data
1151288985_1151288993 20 Left 1151288985 17:73134899-73134921 CCTTGACCTAAATATATCTGTAT No data
Right 1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151288993 Original CRISPR GTGTGGAAGGGGAAGATGGC TGG Intergenic
No off target data available for this crispr