ID: 1151291762

View in Genome Browser
Species Human (GRCh38)
Location 17:73155741-73155763
Sequence AGTGGCCAGGTCCCATCACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151291755_1151291762 27 Left 1151291755 17:73155691-73155713 CCGCTACAAGGGAGCAAGAAGAA No data
Right 1151291762 17:73155741-73155763 AGTGGCCAGGTCCCATCACGAGG No data
1151291758_1151291762 3 Left 1151291758 17:73155715-73155737 CCAGCAGGGAAGTCTTACTTTTG No data
Right 1151291762 17:73155741-73155763 AGTGGCCAGGTCCCATCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151291762 Original CRISPR AGTGGCCAGGTCCCATCACG AGG Intergenic
No off target data available for this crispr