ID: 1151293206

View in Genome Browser
Species Human (GRCh38)
Location 17:73165086-73165108
Sequence CGCCGGGGGTCTGCGGGCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151293193_1151293206 2 Left 1151293193 17:73165061-73165083 CCCAGAGCCCCAGTCTGAGGCTT 0: 1
1: 0
2: 1
3: 21
4: 240
Right 1151293206 17:73165086-73165108 CGCCGGGGGTCTGCGGGCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 144
1151293194_1151293206 1 Left 1151293194 17:73165062-73165084 CCAGAGCCCCAGTCTGAGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 325
Right 1151293206 17:73165086-73165108 CGCCGGGGGTCTGCGGGCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 144
1151293196_1151293206 -5 Left 1151293196 17:73165068-73165090 CCCCAGTCTGAGGCTTGGCGCCG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1151293206 17:73165086-73165108 CGCCGGGGGTCTGCGGGCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 144
1151293190_1151293206 11 Left 1151293190 17:73165052-73165074 CCACCAGCGCCCAGAGCCCCAGT 0: 1
1: 0
2: 3
3: 62
4: 350
Right 1151293206 17:73165086-73165108 CGCCGGGGGTCTGCGGGCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 144
1151293191_1151293206 8 Left 1151293191 17:73165055-73165077 CCAGCGCCCAGAGCCCCAGTCTG 0: 1
1: 0
2: 1
3: 40
4: 340
Right 1151293206 17:73165086-73165108 CGCCGGGGGTCTGCGGGCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 144
1151293199_1151293206 -7 Left 1151293199 17:73165070-73165092 CCAGTCTGAGGCTTGGCGCCGGG 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1151293206 17:73165086-73165108 CGCCGGGGGTCTGCGGGCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 144
1151293197_1151293206 -6 Left 1151293197 17:73165069-73165091 CCCAGTCTGAGGCTTGGCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 88
Right 1151293206 17:73165086-73165108 CGCCGGGGGTCTGCGGGCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151293206 Original CRISPR CGCCGGGGGTCTGCGGGCGA GGG Exonic
900100103 1:958838-958860 CGCCTGGGGTCTCAGGGCCAAGG - Intronic
900127245 1:1074021-1074043 GGCCGGGGGTCAGCGGGCCTGGG + Exonic
900191665 1:1354711-1354733 CCCCGGGGCTCTCCGGGCAACGG - Exonic
901443561 1:9293360-9293382 CGGCGGGGGTCTCGGGGCGCGGG + Intronic
903310656 1:22452356-22452378 CGCCGGGCGTCAGCGGACTATGG + Intronic
903603126 1:24556337-24556359 TGCCTGGGGTCTGCGCGGGAGGG + Intronic
903829135 1:26164446-26164468 CGCCAGAGGGCTGCGGGAGAGGG + Intergenic
905179143 1:36155993-36156015 CGCCGGGAGGCTGCGGGCGCGGG + Intronic
911116064 1:94247659-94247681 GGCCGGGCGTCTGCGGGCCGTGG - Intronic
912568832 1:110607294-110607316 TGCCGGGGTTCTGCCGGCGCTGG - Exonic
912795390 1:112689981-112690003 AGCCAGGGGGCTGTGGGCGACGG - Exonic
915143940 1:153783625-153783647 CCACGGGGGTCTCCGGGCGAGGG - Intergenic
915517485 1:156421643-156421665 TGCCGGGGCTCAGCGGGCGCCGG + Intronic
916620068 1:166487437-166487459 TCCCAGGGGTCTGCTGGCGAAGG - Intergenic
924778405 1:247126827-247126849 AGCCGCGGGGCTGCGGGCGCGGG - Intronic
924783253 1:247171593-247171615 AGCCGCGGGGCTGCGGGCGCGGG + Intronic
1065099940 10:22322008-22322030 CGCCGGGGCTGAGCGGGCGGCGG - Intronic
1065483303 10:26215261-26215283 CTCCGGGGCTCTGGGGGAGACGG - Intergenic
1073577991 10:104641242-104641264 CGCGGGGGGTGTGCGCGCGCCGG - Exonic
1074959006 10:118422067-118422089 CGCCGGGGCTCTGCCTGCCACGG - Intergenic
1075654758 10:124153434-124153456 CACCGAGGGCCTGCGGGCGCTGG + Intergenic
1077331985 11:1987870-1987892 GACCGAGGGTGTGCGGGCGATGG - Intergenic
1077331996 11:1987909-1987931 GACCGAGGGTGTGCGGGCGATGG - Intergenic
1078456866 11:11482369-11482391 CTCCAGGGGTCTGTGGGCCAGGG - Intronic
1080503892 11:32893535-32893557 CGCCTGGGGACGGCGGGTGAAGG + Intronic
1081831605 11:46120390-46120412 CGGCCGGGGGCTGCGGGCGGGGG - Intronic
1082811702 11:57482601-57482623 CGGCGGGGGTTTGGGGGTGAGGG + Intergenic
1083246164 11:61429802-61429824 CGGCCGGAGTCTGCGGGCGGAGG - Exonic
1083945193 11:65919446-65919468 AGCCGGGAGGCTGCGGGCGGCGG + Exonic
1084979545 11:72821885-72821907 CGGCTGGGCTCTGAGGGCGAAGG + Intronic
1089442801 11:118530926-118530948 ACCCGGGCGTCCGCGGGCGAGGG + Exonic
1089564690 11:119364378-119364400 GGCCGGGGGTCAGCGGGCTGGGG - Intronic
1090758570 11:129816002-129816024 CGCAGGGGACCTGCGGGGGAGGG + Intronic
1202814966 11_KI270721v1_random:43046-43068 GACCGAGGGTGTGCGGGCGATGG - Intergenic
1202814977 11_KI270721v1_random:43085-43107 GACCGAGGGTGTGCGGGCGATGG - Intergenic
1099688908 12:85925668-85925690 CTAAGGGGGTCTGCGGGAGAGGG - Intergenic
1102101428 12:110281498-110281520 CGGCGGGCGGCTGAGGGCGAGGG + Intronic
1102151038 12:110689210-110689232 CGTTGGGGGTCTGCGGGCTGTGG - Intronic
1104069380 12:125331113-125331135 GGCCCGGGGTCTGCGGAGGAGGG + Intronic
1105751574 13:23425835-23425857 CGCCGGGGGTCTGTGTGACAAGG + Intronic
1113775582 13:112943336-112943358 CGCCTGGGCTCTGCGGCCGGGGG - Intronic
1118776955 14:68979196-68979218 CGCCGCGGCGCTGCTGGCGAAGG + Exonic
1121342698 14:93115028-93115050 GGCCGGGGGTCCCCGGGCGCCGG + Intronic
1124141116 15:27077943-27077965 CGCCGGGGGTTTGGGGGAGGTGG + Intronic
1132055587 15:98648711-98648733 GGCCGAGGGTCTGCGAGCGCCGG - Intergenic
1132947144 16:2537974-2537996 GGGCGGGGGGCGGCGGGCGACGG + Exonic
1133284419 16:4683939-4683961 GGCTGGGGGTCTGGGGGTGAGGG + Intronic
1134134180 16:11668649-11668671 GGGCCGGGGTCTGCGGGCGGGGG + Intronic
1136556505 16:31010511-31010533 TGCGGGGGGCCTGCGGGCGGGGG + Exonic
1141797803 16:86286642-86286664 CGCAGGGGCGCTGCGGGCAAGGG + Intergenic
1141989689 16:87602779-87602801 CCCCGCGGGGCTGCCGGCGAGGG + Intronic
1142336054 16:89490214-89490236 CGCCGCTGGTCTGGGGGCGGTGG - Intronic
1203120260 16_KI270728v1_random:1530063-1530085 CGCCGGGGGACAGCGGGCTGAGG - Intergenic
1142812338 17:2401163-2401185 CGCCGCGGCCCTGCGGGCGGGGG - Intergenic
1143365352 17:6404866-6404888 GTCCGGGGGTCTGGGGGCTAGGG - Intronic
1144931003 17:18858461-18858483 CGCCAGGGGTCGGCGGGGGCGGG + Intronic
1146260437 17:31417033-31417055 CGCAGGGGGTCTGGGGTGGATGG - Intronic
1148205776 17:45778984-45779006 CGCTGGGGGGCTGCAGGGGAGGG - Intergenic
1150654971 17:67033499-67033521 CGGCGGGGGGTTGCGGGGGAGGG - Intergenic
1151293206 17:73165086-73165108 CGCCGGGGGTCTGCGGGCGAGGG + Exonic
1152344312 17:79742110-79742132 CGCGGGAGCTCTGCGGGCGCTGG + Exonic
1152639852 17:81444883-81444905 AGCCGGGGGTGTGCTGGCCAGGG + Intronic
1152728620 17:81959591-81959613 GGCCGGGGGTCTGTGCGCGCGGG - Intronic
1153265205 18:3262462-3262484 GGCCGGGAGGCTGCAGGCGATGG + Exonic
1154123045 18:11666963-11666985 TGCCTGGGGTCTGCCTGCGAGGG + Intergenic
1156253857 18:35377049-35377071 CGCCCGGGGTCCGCCGGGGAAGG + Intronic
1156385587 18:36601933-36601955 TGCCTGGGCTCTGCAGGCGAAGG - Intronic
1160864288 19:1250264-1250286 CGCTGGGGGGCTGGGGGCGGCGG - Exonic
1161031933 19:2061559-2061581 CGCCCGGGCTCAGAGGGCGAGGG + Intergenic
1161226701 19:3150289-3150311 AGTCTGGGGTCTGCGGGGGATGG + Intronic
1161357632 19:3827709-3827731 AGCCGGGGGCCTGCAGGGGAGGG - Intronic
1161973438 19:7596266-7596288 CGCCGGGGGTCCCCGGGCTCGGG + Intronic
1163842249 19:19618583-19618605 CGCCGCGGGGCGGGGGGCGATGG + Exonic
1165058629 19:33194442-33194464 CGCCGGGGGTCCCCGGGCCCAGG + Intronic
1166107763 19:40605757-40605779 CGCAGGAGGTCTGCTGCCGAGGG + Exonic
1167249781 19:48393756-48393778 CTGCGGGAGGCTGCGGGCGAGGG - Intergenic
1167633410 19:50639561-50639583 CGCTGGGGATCGGTGGGCGAGGG + Intronic
926190071 2:10721683-10721705 CGGTAGGGGGCTGCGGGCGACGG - Exonic
926801771 2:16665721-16665743 GGGCGGGGGTCTGCGGGCGCGGG - Intronic
927988312 2:27428959-27428981 CCCCGGGATTCTGCGGGCGCGGG + Intronic
931671581 2:64653401-64653423 CGCCGGGGGTCCGAGAGCGCGGG + Intronic
936038421 2:109130062-109130084 CGCCGGCAGTCTGCGGGAGCTGG + Exonic
946340032 2:219060760-219060782 CGGCGGGGGGCGGCGGGCGGCGG + Intergenic
946358817 2:219206816-219206838 CGCCGGGGGCCGGCTGGCGCGGG + Exonic
947729240 2:232418987-232419009 CGCCCCGGGTCTGCGGCCGCTGG + Intergenic
948140502 2:235669582-235669604 CGCCGGGGCGGGGCGGGCGACGG - Intronic
1171971547 20:31568198-31568220 CGCTGGGATTCTGCGGGCGCCGG - Exonic
1171977385 20:31604240-31604262 CGCCCGGGGTCTGCAGGTGACGG + Intergenic
1172015510 20:31870493-31870515 GGCCGGGGGTCGGCGGGCGGTGG - Exonic
1173741645 20:45406333-45406355 CGCCGCGGGTCTGCGCGGGGCGG + Intronic
1174121597 20:48269787-48269809 AGCATGGGGTCTGCGGGGGATGG + Intergenic
1174258741 20:49278117-49278139 CGCCCAGGGTCTGCGGGGAACGG - Exonic
1175715685 20:61253003-61253025 CGCCCGGCGGCTGCGGGCCAGGG + Intronic
1175768569 20:61608082-61608104 ACCCTGGGGTCTGGGGGCGAGGG - Intronic
1175962162 20:62642653-62642675 CGCCGGGGGGATGCGCGCGGGGG + Intronic
1176550122 21:8217268-8217290 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1176569050 21:8400303-8400325 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1176576964 21:8444538-8444560 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1176733631 21:10522351-10522373 GTCCGGGGGTCTGCGGGGGTGGG + Intronic
1179186294 21:39087532-39087554 CGCCGGGGGTCTGCTGCCAGCGG + Intergenic
1179392364 21:41005352-41005374 CCCCAGGGGTCTGCAGGCTAAGG - Intergenic
1180068459 21:45424418-45424440 AGCCGTGGGTCTCTGGGCGAGGG + Intronic
1180558984 22:16601192-16601214 GATCGGGGGACTGCGGGCGAGGG - Intergenic
1181519754 22:23438463-23438485 GGCCTGGGATCTGGGGGCGAAGG - Intergenic
1181536590 22:23549432-23549454 CGCTGGGGGTCTGGAGGCCAGGG - Intergenic
1183535373 22:38398109-38398131 GTCCGGGGGTCTGCGGGGGTGGG - Intronic
1184362015 22:44024463-44024485 CCCCGGGGGTCGGCGGGCGCGGG - Intronic
1203255015 22_KI270733v1_random:133600-133622 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203263071 22_KI270733v1_random:178679-178701 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
950345417 3:12288104-12288126 GGCCGAGGGTCTGGGGGCTAGGG + Intronic
952816669 3:37452704-37452726 CGCCGGGGGACGGCGGGAGAAGG + Intronic
953427113 3:42804401-42804423 AGCCGGGGGACTGCGAGCCAGGG - Exonic
963063753 3:141246071-141246093 CGCCTGGGGTCTGCGTGGCAAGG + Intronic
968092718 3:195908858-195908880 CCCCGGGGGCCTGCGGGGGAGGG - Intronic
968572108 4:1347280-1347302 CCCCGGGGCTCTGCGGGCGCCGG + Intronic
968914091 4:3489607-3489629 GGCCTGGTGCCTGCGGGCGAGGG + Intronic
968964920 4:3765007-3765029 AGCCTGGGGTCTGTGGGAGAGGG - Intergenic
969330284 4:6470815-6470837 CGCCGGGTGTGTGCGAGAGAGGG - Intronic
969912257 4:10457365-10457387 CGCCGGCGGTCTGCGGCCGGCGG - Intronic
973338851 4:48984381-48984403 CGCAGGGGGGCTGGGGGCTAGGG + Intergenic
975298879 4:72766267-72766289 CGCAGGGGGTCTGCAGGTGGAGG - Intergenic
976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG + Intronic
977694343 4:99949936-99949958 CGCTGGGGGCCGGCGGGCGGAGG - Intronic
981093467 4:140756307-140756329 GGCCGGGCGTCTGCGGCCGCGGG - Intergenic
991054582 5:62306797-62306819 CTCCGGGGGTCTCTGGGCGAGGG + Intronic
995571740 5:113488528-113488550 CGCCGGGGCGCTCCGGGCGAGGG + Exonic
997608081 5:135191204-135191226 GGCCTGGGGTCTGCGGGGGTGGG + Intronic
1001407083 5:171483911-171483933 CGCCGGGAATCTGCAGGCAACGG - Intergenic
1004185844 6:13420315-13420337 TGGCAGGGGTCTGAGGGCGAGGG + Intronic
1013272863 6:108559618-108559640 CTCCGCGGGGCTGCGGGCGTGGG - Intergenic
1013459014 6:110358003-110358025 CGCCGGGGGGCGGCGGGAGCGGG - Exonic
1014230297 6:118895012-118895034 CGCCGGGGGCAGGCGGGCGGCGG - Intronic
1019282825 7:209034-209056 CGCCGGGCTTCTGCTGGGGATGG + Intronic
1019591507 7:1837815-1837837 GGCCTGGGATCTGGGGGCGAAGG + Intronic
1023915012 7:44582170-44582192 GGCTGGGCCTCTGCGGGCGATGG - Exonic
1026471376 7:70695587-70695609 CCCCCGGGGTCTGCGTCCGAAGG + Intronic
1027151973 7:75739328-75739350 CGCGCGGGGACTGCGGCCGAGGG - Intergenic
1032119323 7:129144979-129145001 CGCCCGGGGTCTCCGCGCCATGG - Exonic
1033836284 7:145316127-145316149 TGCCGGGGGTTTGCGGTCAAGGG - Intergenic
1034349769 7:150408226-150408248 CGCCCGGGGCCTGCTGCCGACGG + Intronic
1035265616 7:157689066-157689088 CGCCCGGGGGCTGCGAGCGCCGG - Intronic
1037305224 8:17497261-17497283 CGCCGAGAGGCCGCGGGCGAGGG + Intronic
1037427810 8:18775888-18775910 TGCAGGGGGTCGGCGGGGGAGGG - Intronic
1040559828 8:48514513-48514535 CGCCGGGTGTCTGCGGGGGCGGG - Intergenic
1041113002 8:54504908-54504930 CGTGGGGGGTTTGGGGGCGAGGG + Intergenic
1042307183 8:67343871-67343893 CGCCGGGAGGCTGGGGGCGGAGG + Intergenic
1044591445 8:93917269-93917291 CGTCGGGGGGCTGGGGGCGGGGG + Intronic
1049718350 8:144104200-144104222 GGGCTGGGGTCTGCGGGCGAAGG - Intronic
1051482945 9:17579112-17579134 CGCCGGGGCTATGGGCGCGAGGG - Exonic
1055090814 9:72364238-72364260 CGCGTGGGGCCTGCAGGCGAAGG - Intronic
1058843507 9:108933798-108933820 CGCCGGCGGTGTCCGGGTGAAGG - Intronic
1061095804 9:128456311-128456333 CGCCGGGGGTGCGAAGGCGACGG - Intronic
1061128187 9:128689707-128689729 CGCCGGCGGCCTGCGGGCCGGGG - Intronic
1062399908 9:136367771-136367793 CGCCCGGGGCCTGCAGGAGAAGG - Exonic
1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203479236 Un_GL000220v1:160712-160734 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1189262528 X:39688876-39688898 CGCCGCGGCTCTGCAGGCGCGGG + Intergenic
1200217269 X:154373587-154373609 GGCCTGGGGTCTGAGGGCCAGGG - Intronic
1200981052 Y:9263606-9263628 TTCCGGGGGTCTTCGGGTGATGG + Intergenic