ID: 1151294100

View in Genome Browser
Species Human (GRCh38)
Location 17:73171106-73171128
Sequence CCCCAAGGGCAGAGGCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 244}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151294100_1151294108 22 Left 1151294100 17:73171106-73171128 CCTTCTAGCCTCTGCCCTTGGGG 0: 1
1: 0
2: 3
3: 32
4: 244
Right 1151294108 17:73171151-73171173 AAGTGAGGTCAATGTAAGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 197
1151294100_1151294110 28 Left 1151294100 17:73171106-73171128 CCTTCTAGCCTCTGCCCTTGGGG 0: 1
1: 0
2: 3
3: 32
4: 244
Right 1151294110 17:73171157-73171179 GGTCAATGTAAGAAGGGAAAGGG 0: 1
1: 0
2: 1
3: 23
4: 319
1151294100_1151294105 -2 Left 1151294100 17:73171106-73171128 CCTTCTAGCCTCTGCCCTTGGGG 0: 1
1: 0
2: 3
3: 32
4: 244
Right 1151294105 17:73171127-73171149 GGATTTGCTTCATTAATTTCAGG 0: 1
1: 0
2: 3
3: 19
4: 309
1151294100_1151294106 7 Left 1151294100 17:73171106-73171128 CCTTCTAGCCTCTGCCCTTGGGG 0: 1
1: 0
2: 3
3: 32
4: 244
Right 1151294106 17:73171136-73171158 TCATTAATTTCAGGCAAGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 194
1151294100_1151294107 21 Left 1151294100 17:73171106-73171128 CCTTCTAGCCTCTGCCCTTGGGG 0: 1
1: 0
2: 3
3: 32
4: 244
Right 1151294107 17:73171150-73171172 CAAGTGAGGTCAATGTAAGAAGG 0: 1
1: 0
2: 2
3: 15
4: 286
1151294100_1151294109 27 Left 1151294100 17:73171106-73171128 CCTTCTAGCCTCTGCCCTTGGGG 0: 1
1: 0
2: 3
3: 32
4: 244
Right 1151294109 17:73171156-73171178 AGGTCAATGTAAGAAGGGAAAGG 0: 1
1: 0
2: 3
3: 12
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151294100 Original CRISPR CCCCAAGGGCAGAGGCTAGA AGG (reversed) Intergenic
900714223 1:4133633-4133655 ACCCAAGGGCATTGGCAAGAGGG - Intergenic
901539100 1:9903295-9903317 CCCCAATGGCAGGGCCAAGAGGG - Intronic
903025998 1:20430408-20430430 CCCCAAGGACTGAGGATGGATGG - Intergenic
903568512 1:24286694-24286716 CCCCAAGGGCTGTGGCAAGCAGG - Intergenic
905430385 1:37918221-37918243 GGCCAAGTGCAGAGGCTAAATGG - Intronic
905715422 1:40145432-40145454 CCCAAAGGGCAGAGGAAAGAAGG + Intergenic
906483911 1:46220101-46220123 CCCCCAGGGGAGAGGCTTCAAGG + Exonic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907053793 1:51346366-51346388 CCCAGAGGGCAGAGGCTCTAAGG + Intergenic
907462227 1:54611897-54611919 TCCCAAGGGCAGGAGCCAGAGGG + Intronic
912304849 1:108557003-108557025 AACCAAGGCCAGAGGGTAGAGGG - Intergenic
913238023 1:116801928-116801950 CCCGATGGGCAGAGTCTAGGAGG + Intergenic
917288185 1:173443101-173443123 CCCAAAGGGAAGAGGCAAAATGG - Intergenic
918116986 1:181506276-181506298 CCCAAAGTGAAGAGCCTAGACGG - Intronic
918308994 1:183272193-183272215 AGCCAAGGCCAGAGGCTACAGGG - Intronic
919582301 1:199391795-199391817 CCCCATCAGCAAAGGCTAGACGG + Intergenic
920418431 1:205813556-205813578 CCCGAAGGCCAGAGGCTCCAAGG - Intronic
920437435 1:205956544-205956566 CCCCAGGGGCAGAGGCCATTTGG - Intergenic
922558499 1:226550148-226550170 TCCCAAGAGCAGAGGCCAGCTGG + Intronic
1063188124 10:3668585-3668607 CCCCCAGGGCAGATGCAAGGGGG - Intergenic
1064519897 10:16190090-16190112 CCACATGGGCAGGGTCTAGAAGG - Intergenic
1065968688 10:30788807-30788829 ACCCATGGGCAGAGGGTAGAGGG + Intergenic
1068549063 10:58385654-58385676 CCCCTAGGGCACAGGCAAGCGGG - Intronic
1068935114 10:62628169-62628191 CCCCAGGAGCAGAGGCCAGGAGG - Intronic
1069572841 10:69504797-69504819 CCCCAGGGGCAGAGGCAAGCTGG - Intronic
1069683439 10:70301151-70301173 GCCCAAGGGAAGAGGCAAGGTGG - Exonic
1069909889 10:71752554-71752576 CCACAAGGGCAGAGGCTGAGGGG - Intronic
1072952708 10:99861857-99861879 CCCCAGGGGCCGAGGCTGCAGGG - Intergenic
1074783721 10:116820683-116820705 CCCCAAGGAAAGAGTGTAGATGG - Intergenic
1075668756 10:124248785-124248807 CCCAAGGTGAAGAGGCTAGAAGG + Intergenic
1075686195 10:124366944-124366966 CTCCAAGGGCAGAGGCAGGGAGG - Intergenic
1077197396 11:1288287-1288309 CCCTAAGGGCAGAGCTTGGAAGG + Intronic
1077200853 11:1306808-1306830 CCCCAGGGGCCGAGGATGGAGGG - Intronic
1079121661 11:17689588-17689610 GGGCAAGGGCAGAGGCAAGAGGG - Intergenic
1079236296 11:18693112-18693134 CCCCAAGCCCAGAGGCTAACCGG + Intronic
1081139022 11:39474819-39474841 CCCCGAGTGCAGAGGCTCAAAGG + Intergenic
1081182326 11:39999051-39999073 CCCAATGAACAGAGGCTAGAAGG - Intergenic
1083000162 11:59283961-59283983 CCCCAGGGGAAAAGGCTTGAAGG - Intergenic
1083625368 11:64069477-64069499 CCCCAGAGCCAGAGGCTAAAGGG - Intronic
1086324314 11:85682745-85682767 TCCCATGGGCAGAGGCCGGACGG - Intronic
1087903283 11:103666663-103666685 GCACAAGGACAGAGGATAGAGGG - Intergenic
1088626088 11:111731686-111731708 CCACACTGGCAGAGGCTGGAAGG + Intronic
1091873164 12:3912034-3912056 CCCCATGTGCAGAAGCTTGAGGG + Intergenic
1092880560 12:12884819-12884841 GACCAAGGGGAGAGGCTGGAAGG + Intergenic
1094586682 12:31783400-31783422 TCCCTAGGGCAAAGGCAAGATGG - Intergenic
1098003172 12:65967442-65967464 GCCCAAGGGCAGAGAGAAGACGG + Intergenic
1101820904 12:108183721-108183743 CCCCGAGGTCAGAGGTCAGAGGG + Intronic
1102491040 12:113289775-113289797 CCTCAAGAGCAGATCCTAGATGG + Intronic
1104673425 12:130696038-130696060 CACCAAGGGGAGATGCTACATGG + Intronic
1104990710 12:132622389-132622411 CCCCAAGGAACGAGGCCAGAAGG - Intergenic
1105057122 12:133112230-133112252 CTCCATGGGCAGAGGGTGGAGGG - Exonic
1105284789 13:18995089-18995111 CCAGAAGGCCAGAGGGTAGAAGG + Intergenic
1105474707 13:20720110-20720132 CACGAAGGGCAGAGGCTTGAGGG - Intronic
1112171464 13:96977051-96977073 CCACAAGGGCAGAGTTTAAAAGG - Intergenic
1113949820 13:114065725-114065747 CCCAGAGGTCAGAGGCTGGAGGG + Intronic
1114533436 14:23409276-23409298 CCCCAGGAGCAGAGGGTAGCAGG - Intergenic
1115005190 14:28474056-28474078 GACCAAGGGAATAGGCTAGATGG - Intergenic
1116388779 14:44365862-44365884 CCCCAAGGGCACAGGCAAGATGG + Intergenic
1120861070 14:89255527-89255549 CCAGAATGCCAGAGGCTAGATGG + Intronic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121416755 14:93784641-93784663 GCCCAAGGCCAGAGGAGAGAGGG - Intronic
1121566259 14:94912074-94912096 GCCCAAGAGCTGAGGATAGAAGG + Intergenic
1121813571 14:96912481-96912503 CCCCAATGTAAGAGGCAAGAAGG - Intronic
1121950100 14:98164128-98164150 CCCCCAGGGCAGAGGGTACCAGG - Intergenic
1122549758 14:102543597-102543619 GGCTGAGGGCAGAGGCTAGAGGG - Intergenic
1122775356 14:104114548-104114570 CCCCTTGGGGAGAGGCCAGAGGG + Exonic
1123039476 14:105484522-105484544 CCCCCAGAGCACAGGGTAGATGG + Intergenic
1123100095 14:105791859-105791881 CTCCAAGGGCAGAGGCTGTGGGG - Intergenic
1123183312 14:106489890-106489912 CCCCAAGGGCATAGGGTGAAGGG + Intergenic
1124418062 15:29490868-29490890 CCCCAAGGGCTGAGGAGAGCAGG - Intronic
1126172760 15:45707933-45707955 GACCAAGGGCAGAGGCTGGCAGG - Intergenic
1126954800 15:53920963-53920985 GACCAAGGGAAGAGGCTAGAGGG + Intergenic
1127505240 15:59591662-59591684 CCAAAAAAGCAGAGGCTAGAAGG - Intergenic
1127860825 15:62993042-62993064 CCTCAAGGGCAGAGGCCATAAGG - Intergenic
1128084683 15:64877697-64877719 ACCCAAGGCCACAGGCTGGAAGG - Intronic
1129328837 15:74816453-74816475 CCCCAAGGACAGAGCCTACATGG - Exonic
1129985725 15:79918461-79918483 GCCCAAGGCCAGGGGCCAGATGG - Intronic
1130412991 15:83662908-83662930 CCCAGAGGGCAGAGGGTTGAGGG - Intronic
1130885186 15:88086927-88086949 CTGGAAGGGCAGAGCCTAGAAGG - Intronic
1131468141 15:92672352-92672374 CACTAAGGGCAGAGGCTATTTGG + Intronic
1132461530 16:57716-57738 CCCTAAAGGCTGAGGCTGGAGGG - Intergenic
1133028399 16:2998439-2998461 CACTGGGGGCAGAGGCTAGAAGG - Intergenic
1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG + Intronic
1134332190 16:13261177-13261199 CCTCATGGGCATAGGCAAGATGG - Intergenic
1134909279 16:18009464-18009486 GCCCATGGACAGAGGCTAGAAGG - Intergenic
1136081119 16:27853219-27853241 CCCCCAGGGCAGAGGGCACAGGG - Intronic
1136990729 16:35149918-35149940 CCACAAGGCCAAAGGCTGGAAGG - Intergenic
1138347100 16:56326746-56326768 CTCCATGGGCAGAGGCAGGAGGG + Intronic
1138507887 16:57487087-57487109 CCCGAAGGGCAGAGGTGAGGGGG - Intronic
1139371499 16:66472040-66472062 GGCAAAGGGCAGAGGCTGGAAGG - Intronic
1139404581 16:66707859-66707881 CAGCAAGGGCAGAGGCCAGGAGG + Intergenic
1140209656 16:72960194-72960216 CCTGAAGGGCAGAGGCAAGGGGG + Exonic
1141592852 16:85080096-85080118 CCCAGAGGGCAGAGGGCAGAGGG + Intronic
1142247954 16:88978408-88978430 CCCCCAGGACTGAGGCTGGAGGG + Intergenic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1142782310 17:2190718-2190740 CTCCCAGGGCAGCAGCTAGAAGG + Intronic
1143628499 17:8124027-8124049 CCCCAAGGTGAGAGGCGGGAGGG - Exonic
1144201638 17:12947410-12947432 CCCCTAGGTCAGAGGCCAGAGGG - Intronic
1144727430 17:17508829-17508851 CCACATGGGCAGAGGCTATTGGG + Intronic
1147136000 17:38434507-38434529 ACCCAAGGGCCGAGGCCTGAGGG + Intronic
1147219862 17:38922175-38922197 CCCCAAGGGCTCTGGCTAGTGGG - Intergenic
1147770868 17:42867089-42867111 CCCCAAGGGCAGAGGGGTCAGGG - Intergenic
1147845944 17:43403906-43403928 CTCCCAGGGCAGAGGATAGGAGG + Intergenic
1148661659 17:49338809-49338831 CCCCAAGGGCAGAGAAGAAAAGG + Intronic
1149654316 17:58302333-58302355 GCCCCAGGGCAGAAGCGAGAAGG - Exonic
1151294100 17:73171106-73171128 CCCCAAGGGCAGAGGCTAGAAGG - Intergenic
1151309017 17:73282179-73282201 CCCCAAGGGAAGAAGAGAGAGGG - Intergenic
1151768805 17:76146384-76146406 CTCCCAGGGGAGAGGCGAGATGG - Intronic
1151953622 17:77369639-77369661 TCCCAAGGGCAGGGCCCAGATGG - Intronic
1152512822 17:80801970-80801992 CCCCACGGGCAGAGGGAAGACGG + Intronic
1157411349 18:47465766-47465788 CCCCAAGGGGCTAGGCTAGTGGG + Intergenic
1158221106 18:55151675-55151697 CCCCAAAGTCAGAGACTAGATGG + Intergenic
1160754770 19:751489-751511 CCCCATGGTCAGAGGCCAGAGGG + Intronic
1161001615 19:1913746-1913768 CCCAAAGGGCTGATGCTAGTCGG + Intronic
1162125512 19:8497755-8497777 CCCCAAGGGCAGAGGTTTGTTGG - Exonic
1162736093 19:12747947-12747969 CAGCCAGGGCAGAGGGTAGAAGG - Intronic
1163686979 19:18717333-18717355 CACCAAGGACAGAGGCCACAAGG - Intronic
1164782113 19:30901216-30901238 TCCTAGGGGCAGAGGGTAGAGGG - Intergenic
1165105506 19:33467530-33467552 CACCCAGGGCAAAGGCAAGATGG + Intronic
1165698696 19:37920905-37920927 CCCCACAGGCAGGTGCTAGAGGG - Intronic
1165819810 19:38667284-38667306 CCCCAAGGCCAGAGGCTTGGCGG - Intronic
1166147735 19:40848838-40848860 CCCCAAGGGTGGAGGAGAGAGGG + Intronic
1166569770 19:43786554-43786576 CCCAAAGGGCTGAGATTAGAGGG + Intergenic
1166766540 19:45254553-45254575 CCCCAAGGTCACAGGGCAGATGG - Intronic
1167172773 19:47844313-47844335 CCCAAGAGGCAGAGGCTGGAGGG - Intergenic
1167493901 19:49806976-49806998 CCCCAAGCACAGAGGGGAGAGGG + Exonic
1168277424 19:55285348-55285370 CCATAGGGGCAGAGGCTGGAGGG + Intronic
1168721755 19:58558303-58558325 CACCAAGGGCAGCAGCAAGAAGG - Exonic
925172532 2:1759298-1759320 GCCCAAGGGCTGAGGAGAGAAGG - Intergenic
925475466 2:4209157-4209179 TCCCAAGGGCAGAACCAAGAAGG + Intergenic
926317247 2:11719659-11719681 ACCCCAGGGCAGATGCCAGACGG - Intronic
927053531 2:19351047-19351069 CCCCAAAGCCAGAGGCCAGGAGG + Intergenic
928241734 2:29592440-29592462 CCCCAAGAGCTCAGGCGAGAGGG - Intronic
929450078 2:42030935-42030957 GCCCAGGGACAGAGGCTTGAGGG - Intergenic
933328028 2:80863466-80863488 CCCCAGGGGCAGACACTGGAGGG - Intergenic
935123710 2:100203807-100203829 CTCAGAGGGCAGAGGCAAGACGG - Intergenic
936007982 2:108907007-108907029 AGCCAGGGGCACAGGCTAGAGGG + Intronic
936632445 2:114218178-114218200 ACCCAAGGACAGAGGTCAGAAGG - Intergenic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
939355712 2:141099435-141099457 CCCAAAGCACAGAGACTAGATGG + Intronic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
940519857 2:154731151-154731173 CACCAAGAGCAAAGGCTTGAAGG + Intronic
941027543 2:160475274-160475296 CCCCCAGGTCACAGGATAGAGGG - Intronic
942383531 2:175418641-175418663 TCCCAAGGCCAGAGGCAAGAGGG + Intergenic
945950442 2:216034400-216034422 TCCCAAGGGAATAGCCTAGATGG - Intronic
947551480 2:231049812-231049834 CACCCAGGGCAGAGGCTGGGAGG - Intergenic
948173898 2:235928401-235928423 CCCCAAGGGCCAAGGAGAGAGGG + Intronic
1169513057 20:6285732-6285754 CCCTAAGGGCAGAGGGCATATGG + Intergenic
1170363852 20:15578644-15578666 TCCAGAGGGCAGTGGCTAGAAGG + Intronic
1171086460 20:22242573-22242595 CCCCACTGCCAGAGGCCAGAAGG - Intergenic
1171231573 20:23491243-23491265 CACCAAGGGCTGAGGCCACAAGG + Exonic
1172102289 20:32492411-32492433 GCCCAGGGGCAGTGACTAGAGGG + Intronic
1172624341 20:36338652-36338674 CCCCAAGGACAGAGGCCAGTCGG - Intronic
1173972129 20:47161217-47161239 CCCCATGTGCAGAGGCTACTGGG - Intronic
1175669698 20:60891296-60891318 GCCCTAGGGCAGAGGTCAGAGGG + Intergenic
1175899787 20:62355436-62355458 CCCCAAGGGCTGAAGCTATGAGG - Intronic
1179033810 21:37742878-37742900 CCCCAAGTGCAGAGAAGAGATGG - Intronic
1185270766 22:49928580-49928602 GACCAAGGGCAGAGGCCAGAGGG + Intergenic
950171234 3:10840273-10840295 CCCCAAGGGCAAAAGCCAGGAGG - Intronic
952049807 3:29370883-29370905 CCTACATGGCAGAGGCTAGAGGG + Intronic
952902623 3:38120214-38120236 CTCAGAGGTCAGAGGCTAGAAGG - Intronic
954634863 3:52065865-52065887 CTCCTAGGGCTCAGGCTAGAGGG - Intergenic
954808343 3:53232945-53232967 CCCCACCGGCAGAGGCCAGACGG + Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
954980322 3:54739933-54739955 CCGCAAGGGCAGAGACCATATGG + Intronic
955407841 3:58636517-58636539 CCCCCAGGGCAGATGCTGAATGG - Intronic
956319853 3:67984693-67984715 CCACAGAGGCAGAGACTAGAAGG - Intergenic
956420888 3:69085415-69085437 CACCAAGGGCTGAGACTTGAGGG + Intronic
958468773 3:94492495-94492517 CCCCAAAAGCAGTGCCTAGAGGG + Intergenic
961779611 3:129314058-129314080 CCCCAAGGGCAGTGGAAACAGGG - Intergenic
961794220 3:129398009-129398031 CCCTAGGGTCACAGGCTAGAAGG + Intergenic
962583453 3:136818914-136818936 CTCCAAGGGCGTAAGCTAGAGGG + Intronic
967078464 3:186026486-186026508 CCCCACGGGTAGAGGGGAGAGGG - Intergenic
968659042 4:1791516-1791538 CCCCAGGGGAAGGGGCAAGACGG + Intergenic
968927586 4:3557902-3557924 CCCCAGGGGCAGGGGCCAGGGGG - Intergenic
969251711 4:5972696-5972718 CCCCACAGGCAGAGCCTGGAGGG + Intronic
969274773 4:6127858-6127880 AGCTAAGGGCAGAGGTTAGACGG - Intronic
970911264 4:21278743-21278765 CCCCAAGGGCAGAGGGGAGATGG + Intronic
972829187 4:42794361-42794383 CACCAAGGACAGAGTATAGAGGG - Intergenic
975611351 4:76206738-76206760 CCCGCAGGGCTGAGGCCAGAAGG + Intronic
978323230 4:107521568-107521590 CCACAAGGGCAGAGCCTGTATGG - Intergenic
984840122 4:184060387-184060409 CCCCCAGGGCTGAGCCTGGAAGG - Intergenic
984875407 4:184363337-184363359 CCCCAAGGGCAGATGTTACCAGG + Intergenic
985496297 5:208512-208534 CCACATGGGCAAAGGCTGGATGG + Intronic
986150905 5:5129743-5129765 CAGCAAGGGCAGAGGGCAGATGG - Intergenic
991621457 5:68549704-68549726 CCCCCACAGCAGAGGCTGGATGG + Intergenic
992493854 5:77272147-77272169 TGCCGAGGGCAGAGGCTTGAGGG + Intronic
993424791 5:87749558-87749580 CCCTACTGGCAGAGGCTATAAGG + Intergenic
995101523 5:108313078-108313100 ACCCAAGAGCAGAAGTTAGAAGG - Intronic
995120742 5:108533035-108533057 CCTCTAGGGCAGGGGCAAGAAGG + Intergenic
997352526 5:133241150-133241172 CCCAAAGGGCAGAGCCCAGGAGG - Intronic
998159621 5:139806110-139806132 TTCCAAGGGCTGAGGCTAGTGGG + Intronic
1001570135 5:172725456-172725478 CCCAAAGGGCAAAGGTTAGGCGG + Intergenic
1001982308 5:176045701-176045723 CCTCAAGGGCAAAGGCCACACGG - Intergenic
1002235153 5:177798356-177798378 CCTCAAGGGCAAAGGCCACACGG + Intergenic
1003006472 6:2387176-2387198 CCCCCAGAGCAGAGGCTCTAGGG - Intergenic
1003734310 6:8860704-8860726 CTCCAAGGGCACAGGGGAGAAGG - Intergenic
1005261939 6:24070429-24070451 CCCAAAGGGTAGGGGCTAAAAGG + Intergenic
1006581150 6:35078671-35078693 CCGCACGGGCTGAGGCTACAGGG - Intronic
1006641948 6:35494289-35494311 CCCCAAGGGCTGAGGCTTTAGGG + Intronic
1006945308 6:37780491-37780513 CCCCCAGGCCAGAGGCCAAATGG + Intergenic
1007078073 6:39080459-39080481 ACCCATGGGGAGAGGCTAGCTGG + Intronic
1007237148 6:40398953-40398975 CCCCACAGGCAGAGGCAAGCAGG - Intronic
1007511350 6:42376477-42376499 CCAGAAGGGCAGAGGGGAGAGGG + Intronic
1007787816 6:44291494-44291516 CCCCAAGGGCAGGGGTCAGAAGG - Intronic
1007950116 6:45864531-45864553 CCCAAAGGGCAGGGGTTACAGGG + Intergenic
1008542684 6:52558918-52558940 CTCCAAGGTCTGAGGCTAGAAGG - Intronic
1009646448 6:66408958-66408980 TCACAAGGGAAGAGGCTGGATGG + Intergenic
1011154105 6:84310344-84310366 TCCCAAGAGCATAGGCTGGATGG - Intergenic
1011653209 6:89526067-89526089 ACCCATGGGCAGAGGGTAGAGGG - Intronic
1012442156 6:99270641-99270663 CCGGAAGGGCAGAGGGTTGAGGG - Intergenic
1013487071 6:110607327-110607349 CCCCGAGGGAAGAGGGGAGAGGG + Intergenic
1016510012 6:144831783-144831805 ACCCAAGGGCAGATGGCAGATGG - Intronic
1017622653 6:156315143-156315165 CCCCTAGGACTGAGGCTGGAAGG + Intergenic
1018479236 6:164173551-164173573 CCCCTAGGGCAGAGGCATGAAGG + Intergenic
1018683199 6:166281859-166281881 CCCCAGGTGCAGAGGCAGGAGGG - Intergenic
1018802777 6:167236374-167236396 CCCCCAGGGCAGCGGGTGGAGGG + Intergenic
1018808178 6:167277348-167277370 CCCCATGGTCAGAGGCCAGCTGG - Intronic
1019074316 6:169375385-169375407 ACCCAAGGGCAGAAGGCAGAGGG + Intergenic
1019453162 7:1110079-1110101 CCCCAAGCGCAGAGGCGAGCGGG + Intronic
1019526528 7:1482969-1482991 CCCCGAGGGCAGGGGCTGGATGG - Intronic
1020899701 7:13989823-13989845 CCCCTAGGGCAGAGGGGCGAGGG - Exonic
1021845099 7:24756700-24756722 CCCCGAGGGGAAAGACTAGAGGG - Intronic
1022514022 7:30964144-30964166 GCCCAGTGGCAGAGGCCAGAGGG - Intronic
1023213165 7:37830295-37830317 CTGCAATGGCAGAGGGTAGAAGG + Intronic
1023216504 7:37868654-37868676 CCACAAGGGCTGGGGCTTGAAGG + Intronic
1024272532 7:47653560-47653582 CCCCAAGGCCAGAGGGTCCAAGG - Intergenic
1026257670 7:68726569-68726591 CCTCAAGGGAAGAGGCTACTTGG + Intergenic
1026564922 7:71481780-71481802 ACCCAAGGTCAGAGGCAATAAGG + Intronic
1026828382 7:73597351-73597373 CCCCAAGGGTAGAAGCTCTATGG + Exonic
1028655602 7:93203039-93203061 GGCCAAGGGAAGAGGCAAGAGGG - Intronic
1033975427 7:147094716-147094738 GGCCATGGGCAGAGGCTGGAAGG - Intronic
1034386930 7:150747902-150747924 CCCCAAGTACAGAGAATAGAGGG + Intronic
1036084615 8:5599936-5599958 TCCCAAGGGCAGATCCTAGCTGG - Intergenic
1037393234 8:18416427-18416449 CCCAGAGGGCAGAGGCTAGGGGG - Intergenic
1037599623 8:20383020-20383042 CACCAAGTGCAGAGGCTCAAAGG - Intergenic
1037774582 8:21824993-21825015 CCACATGGGCAGAGCCTTGAGGG - Intergenic
1039231163 8:35449857-35449879 CCCAAAGGCCAAAGACTAGAAGG - Intronic
1039669474 8:39580410-39580432 AGGCAAGGGCAGAGGCTACAAGG + Intergenic
1041406137 8:57501520-57501542 CCCCAAAGGGAGAGGGTATAAGG + Intergenic
1043944195 8:86231367-86231389 CCCCAGGGGCAGAGGGAAGGAGG + Intronic
1046875862 8:119253954-119253976 CCCCAAGATAAGAGTCTAGATGG - Intergenic
1048046526 8:130778142-130778164 CCCCAAGAAGAGAGGCTAGTAGG - Intergenic
1048651266 8:136481011-136481033 ACGCAAGGGCAGAAGCCAGAAGG - Intergenic
1049078876 8:140425173-140425195 CCCCAAGAGCAGAGGCCAGAAGG + Intronic
1049179211 8:141212448-141212470 CCCCAAGGGCAGAGGCCACCAGG + Exonic
1049437985 8:142596416-142596438 CCCCTAGGGCAGGGGCTACCAGG - Intergenic
1049446810 8:142635031-142635053 CCCCTTAGGCAGAGGCCAGATGG - Intergenic
1051555597 9:18379105-18379127 CACCAAGGTGAGGGGCTAGAAGG + Intergenic
1052324415 9:27202061-27202083 TCTAAAGGGCACAGGCTAGAAGG - Intronic
1052965714 9:34339159-34339181 TCCCAAAGGTAGAGGCCAGAGGG + Exonic
1053426691 9:38014778-38014800 CAGCAAAGGCAGAGCCTAGAAGG + Intronic
1053802443 9:41772981-41773003 CCCCAGGGGCAGAGGCCAGGGGG - Intergenic
1054142795 9:61542089-61542111 CCCCAGGGGCAGAGGCCAGGGGG + Intergenic
1054190752 9:61984327-61984349 CCCCAGGGGCAGAGGCCAGGGGG - Intergenic
1054647622 9:67603390-67603412 CCCCAGGGGCAGAGGCCAGGGGG + Intergenic
1055443374 9:76358476-76358498 CCTCAAAGGAAGAGGCAAGAGGG - Intronic
1055496767 9:76862429-76862451 CCACAAGGTCAGAGGATACAAGG - Intronic
1057239963 9:93399657-93399679 CCCCAAGGGCAGGTGCAAGAAGG - Intergenic
1057568939 9:96189123-96189145 CCCCATGGCCACAGGCTAGTTGG - Intergenic
1057602038 9:96466860-96466882 CCGCTAGTGCAGAGGCTTGAGGG + Intronic
1059392344 9:114007153-114007175 CCCCAAGGGCACAGCCGGGAGGG - Intronic
1059689412 9:116670345-116670367 CCACAAGGGCAGGAGGTAGAAGG + Intronic
1061149549 9:128821048-128821070 GCCCATGGGCAGAGGAGAGATGG - Exonic
1061256959 9:129459076-129459098 CCCCGGGGGCAGGGGCTATAGGG - Intergenic
1061764878 9:132875356-132875378 CCCCATGAGCAGAGGCATGAGGG + Intronic
1062192031 9:135253076-135253098 GCACAAAGGCAGAGGCTGGAGGG + Intergenic
1185446654 X:261380-261402 CCCCAAGGTCAAAGGATAGCAGG - Intergenic
1186263328 X:7804611-7804633 CCCCAAGGTGAAAGGCTGGAAGG + Intergenic
1188004126 X:25005657-25005679 CCCTGAGGCCAGAGGCTACAGGG - Intronic
1188450461 X:30303119-30303141 GACCAAGGGCTGAGCCTAGATGG + Intergenic
1192343013 X:70279804-70279826 CAGCATGGGCAAAGGCTAGAAGG + Intronic
1195577693 X:106468806-106468828 CCACAGGGGCAGAGCCTGGATGG + Intergenic
1195664910 X:107420359-107420381 CCCCTTAGGCAGAGGCCAGAAGG - Intergenic
1197446072 X:126553002-126553024 CTGCAAGGGCAGAGTCTAGGAGG + Intergenic
1198594214 X:138218420-138218442 CTTCAAGGTCAGGGGCTAGAGGG + Intergenic
1200074082 X:153542692-153542714 CCCCAAGCGGAGAGGCTTGCAGG + Intronic
1200239775 X:154487279-154487301 CCCAAAGGGCAAAGAGTAGAAGG + Intergenic
1200807757 Y:7449550-7449572 TCCCAAGTGCAGAGGAAAGAGGG - Intergenic
1201257539 Y:12124033-12124055 GCCCAAGGGCAGGGTCTATATGG + Intergenic