ID: 1151298168

View in Genome Browser
Species Human (GRCh38)
Location 17:73201132-73201154
Sequence CTCCATCTCCAGTAGCTCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151298168 Original CRISPR CTCCATCTCCAGTAGCTCCA AGG Exonic
900660148 1:3778097-3778119 CTCCAGCCCCAGTACCCCCAGGG + Intergenic
900989222 1:6090401-6090423 CTCCAGCTGCAGTCGCTCCAGGG - Exonic
901038602 1:6350793-6350815 CTGCTTCTCTAGCAGCTCCAAGG + Intronic
902273915 1:15325824-15325846 TTCCCTCTCCTGTATCTCCAAGG + Intronic
905029164 1:34869983-34870005 CTCCACCTCCAGCTGCTCCAAGG - Intronic
905824960 1:41020430-41020452 CGGCATCTCCAGCCGCTCCAGGG + Exonic
906520363 1:46463487-46463509 CTTTATCTCCAGAACCTCCAAGG + Intergenic
908676994 1:66615757-66615779 TTCCATCTCCAGTCCCTCCCTGG - Intronic
908800667 1:67876937-67876959 CACCATCACCAGTAGCTTGATGG - Intergenic
911097419 1:94065921-94065943 CTCCATTTCCCTTAGCTCTATGG - Intronic
912496232 1:110093891-110093913 CCCAATCTCCAGAAACTCCAAGG - Intergenic
915369598 1:155337490-155337512 CTCCCTCTCCACTAGCTCCAAGG + Exonic
915801275 1:158795574-158795596 CTCCATCTCCAGTGGCATCTGGG + Intergenic
916037748 1:160936013-160936035 GTCCACCACCAGAAGCTCCAGGG - Intergenic
918283318 1:183026523-183026545 CCCCAACTCCAGTTACTCCATGG + Intronic
918476281 1:184928376-184928398 CCCCAACTCCACTGGCTCCAAGG + Intronic
919790250 1:201285896-201285918 CTACCTCTCCAGAAACTCCAAGG + Intronic
923739217 1:236640429-236640451 CTAAATCTCCCGCAGCTCCAAGG - Intergenic
1063365233 10:5486594-5486616 CTCCAGCTCCACCAGCTTCAAGG - Intergenic
1067737913 10:48873219-48873241 GTCCATCACCAGTAGCCTCATGG + Intronic
1068414257 10:56697285-56697307 CTGCTTCTCAAGTAGCTACATGG + Intergenic
1069845068 10:71365338-71365360 CTCCTTCCCCAATAGCTGCAAGG - Intergenic
1072441497 10:95460041-95460063 CTCCATCTCCTGTCCCTCCTTGG - Intronic
1075437356 10:122454856-122454878 CTCCTTCTCCACCAACTCCAGGG - Exonic
1075782463 10:125026278-125026300 CTCCCTCTTTAGCAGCTCCATGG + Exonic
1076136630 10:128049593-128049615 CTCCTCCTCCAGGTGCTCCACGG - Exonic
1076367861 10:129933915-129933937 CTCCCCCTCCAGCAGCTTCACGG + Intronic
1077246490 11:1541804-1541826 CTCCATCCCCAGCACCCCCATGG + Intergenic
1078909566 11:15718299-15718321 CCCCAGCTCCAGGAGCTGCAGGG + Intergenic
1079250234 11:18781613-18781635 CTCCAACTTTATTAGCTCCAGGG + Intronic
1080282621 11:30575791-30575813 ATCCACCTCCAGTTACTCCACGG - Intronic
1080987011 11:37480719-37480741 CTTCATATCCATTAGCTCAAGGG - Intergenic
1081004173 11:37713222-37713244 CTCAATGTATAGTAGCTCCATGG - Intergenic
1084698171 11:70768729-70768751 CTCCATCTCCAGGCTCCCCATGG - Intronic
1087978545 11:104581602-104581624 TTACATCTCAAGTAGCTCCGAGG + Intergenic
1088659320 11:112029697-112029719 CTGAATCTCCAGTACTTCCAGGG + Intronic
1089519258 11:119052796-119052818 CTCCATCTCCAGGCCCCCCAGGG + Exonic
1091673915 12:2473981-2474003 CTCCATCTCAAGAACATCCAGGG + Intronic
1092057104 12:5516642-5516664 TTCAGTCTCCAGGAGCTCCAAGG + Intronic
1092763325 12:11829165-11829187 CTCCAGCTTCTGCAGCTCCAGGG + Intronic
1092786129 12:12028720-12028742 CTTCATCTCCAGAACCTTCATGG - Intergenic
1093582979 12:20805566-20805588 CTTCAGCTCCATCAGCTCCATGG + Intergenic
1093935349 12:24994800-24994822 CTCCTTCTCCAGTACATGCATGG - Intronic
1095765646 12:45891810-45891832 CTCCATGTTCAGTTGCTGCATGG - Exonic
1095954265 12:47797475-47797497 TTCCGTCTCCAGGGGCTCCAGGG + Exonic
1096498248 12:52050976-52050998 CTCACTCTCCAGTTGCTCCCGGG - Intronic
1098030428 12:66248065-66248087 ATCCTTCTTCAGAAGCTCCAGGG + Exonic
1101239509 12:102824334-102824356 CTCCATCTCCGGGGGCTCCGCGG + Intergenic
1103850259 12:123928391-123928413 CGCCGTCTCCAGCAGCTGCAGGG - Exonic
1104582088 12:130018401-130018423 CACCATTACCATTAGCTCCAGGG - Intergenic
1106240685 13:27910401-27910423 CTCCATCTTCAATAGCGCCTGGG - Intergenic
1106278743 13:28242802-28242824 CTCCCTCTCCAGTTGTTCCCAGG + Intronic
1106783196 13:33080464-33080486 CTCCATCACCAGGAGCGCAATGG + Intergenic
1107819427 13:44272857-44272879 TTCCAAGTCCAGTACCTCCAGGG + Intergenic
1108153127 13:47557282-47557304 CTCTCTCTCCAGTTTCTCCAGGG + Intergenic
1110582647 13:77149777-77149799 CTCCACCTCCACTAGCTACCAGG + Intronic
1110584643 13:77174426-77174448 CTCCATCTCCATTGGCTGTACGG + Exonic
1112133797 13:96553071-96553093 CACTATCTCCAGTCACTCCAAGG - Intronic
1114043380 14:18700726-18700748 ATCCATCTTCAGTTGCTACATGG - Intergenic
1114047669 14:18891171-18891193 ATCCATCTTCAGTTGCTACATGG - Intergenic
1114114854 14:19510473-19510495 ATCCATCTTCAGTTGCTACATGG + Intergenic
1114116547 14:19628236-19628258 ATCCATCTTCAGTTGCTACATGG + Intergenic
1118766099 14:68910141-68910163 CTCCTCCTTCAGTAGCTGCAGGG - Intronic
1120565821 14:86055460-86055482 CTAAATCTCCAGAATCTCCAGGG - Intergenic
1122259083 14:100501960-100501982 CTCACTCTCCAGGAGCCCCAGGG + Intronic
1122757027 14:103989820-103989842 CTCCTTCTCCAGTCCCTCCAGGG - Intronic
1202833173 14_GL000009v2_random:58288-58310 CTGCATCCCCAGTACCACCATGG + Intergenic
1123774648 15:23566346-23566368 CTGCTCCTCCAGCAGCTCCACGG - Exonic
1124858931 15:33418940-33418962 CTTTATTTCCAGAAGCTCCAAGG + Intronic
1125424780 15:39537746-39537768 CTCCATGGGCAGCAGCTCCATGG + Intergenic
1126121035 15:45251848-45251870 CTCCACCTCCAGAGGCTCAAGGG + Intergenic
1126377964 15:48015129-48015151 TTCCAACTCCAGTAGCTATAAGG + Intergenic
1128790002 15:70426227-70426249 GGCCATCTCCAGCAGCACCATGG + Intergenic
1129313028 15:74725592-74725614 CTCCATCTCAGCTCGCTCCAGGG - Exonic
1131649307 15:94381603-94381625 CGCCATCAGCAGTTGCTCCAGGG - Intronic
1131667257 15:94583900-94583922 CTCCAAATCCATTAGCTCCTGGG + Intergenic
1132896778 16:2233003-2233025 CTCCAGCTCCAGAACCTTCAAGG - Exonic
1135782146 16:25313668-25313690 CCCAAGCTCCAGTAGATCCAGGG - Intergenic
1136557215 16:31014488-31014510 CTGGTTCTCCAGTGGCTCCACGG + Intergenic
1137379072 16:47981137-47981159 GAGCATCTCCAGTTGCTCCAGGG + Intergenic
1137395376 16:48113377-48113399 CTCCAGCTCCAGGAGCTCCCGGG + Intronic
1137756101 16:50903589-50903611 GCCCACCTCCACTAGCTCCAGGG - Intergenic
1138427775 16:56947673-56947695 CCCTATCTCCTGTAGCTGCAGGG + Intergenic
1139582252 16:67880582-67880604 CTCCACTTCCTGCAGCTCCAGGG - Exonic
1142172925 16:88632233-88632255 CTTCCCCTCCAGCAGCTCCACGG - Intergenic
1142267016 16:89068728-89068750 CTCCTTCTCTACTAGCTGCATGG - Intergenic
1146306480 17:31733492-31733514 CTCCATGCACAGTGGCTCCAGGG + Intergenic
1147611345 17:41803426-41803448 CTCCATCTAGAGTAGCGCCACGG + Exonic
1147768902 17:42854541-42854563 CTCCATCTCCAGCAGCTTCCGGG - Exonic
1148115150 17:45171084-45171106 TTCCATCCCCAGCAGCTCCTGGG - Intergenic
1148596790 17:48862890-48862912 CTGCATCTGCTGTTGCTCCAAGG - Exonic
1148785848 17:50145895-50145917 CTCCATCCCCAGGAGCCCCTCGG + Intronic
1151298168 17:73201132-73201154 CTCCATCTCCAGTAGCTCCAAGG + Exonic
1151549537 17:74814207-74814229 CGCCATCACCAGCATCTCCAAGG - Intronic
1152130226 17:78471993-78472015 ATCCAGCTTCAGTAGCACCATGG - Intronic
1152305841 17:79519715-79519737 CTCAATCTCCAGCCACTCCAAGG - Intergenic
1152411544 17:80126589-80126611 CTTCCTTTCCAGAAGCTCCAGGG + Intergenic
1153641035 18:7157405-7157427 CTCCATCTCCATTACTTCCTGGG + Intergenic
1155014150 18:21815642-21815664 CTTCATCTCCAAAAGCTGCATGG - Exonic
1158027209 18:52914533-52914555 CTCCATGTCCAAAAGCTCCTTGG + Intronic
1159703938 18:71663540-71663562 CTCCACCTCCATCACCTCCATGG - Intergenic
1160423171 18:78762898-78762920 CTCCATATCCAGGAGGTCAAGGG + Intergenic
1160810069 19:1009409-1009431 CTCCAGCTCCTGCAGCTCCCCGG - Exonic
1164900022 19:31910458-31910480 CTCCAGCCCCAGCAGCTGCATGG + Intergenic
1165256490 19:34579664-34579686 CTCCCTGTCCAGGAGCTCTAGGG - Intergenic
1165765232 19:38346376-38346398 CTCCATCTCATTTAGGTCCAAGG - Intronic
1166205024 19:41264206-41264228 CTTCCTCCCCAGTAGCTCCTAGG + Intronic
926540378 2:14170900-14170922 TACCAGCTCCAGTAGCTCCCTGG - Intergenic
929549530 2:42880559-42880581 CTCAATCTCCAGCAGCTGTAGGG - Intergenic
931812706 2:65870186-65870208 CTTCAGCTCCAGTGCCTCCATGG + Intergenic
933601548 2:84337181-84337203 CTCCATCTCCATGAGTTCAATGG - Intergenic
933688192 2:85159623-85159645 TCCCATCTCCAGTAGGTCAAAGG - Intronic
935709906 2:105889157-105889179 CTCCATCTCCATCAGATGCAGGG + Intronic
936670756 2:114653352-114653374 TTCCTTCTCCAGAGGCTCCAGGG - Intronic
937375800 2:121334931-121334953 CTGTGTCTCCAGGAGCTCCAGGG + Intergenic
937588235 2:123582599-123582621 CTCCATCTCCACCTGCTCCCTGG + Intergenic
938425043 2:131179690-131179712 ATCCATCTTCAGTTGCTACATGG - Intronic
942659231 2:178246495-178246517 CTCCATGTCCAGTAGCTACCTGG + Intronic
942785262 2:179693774-179693796 CTCCATCTCCTTCAGCCCCAGGG + Intronic
944115890 2:196185656-196185678 CCCCAATTCCAGTATCTCCATGG + Intergenic
946010251 2:216558715-216558737 CTCCACCACCAGCAGCTACAAGG + Intronic
946386094 2:219385451-219385473 CTCCATCTCCACTATGTCCTTGG + Exonic
946418452 2:219552113-219552135 CTCCACTTCCAGTAGAGCCAGGG + Exonic
946427815 2:219608706-219608728 CTGGAGCTCCAGTCGCTCCAAGG - Exonic
947044605 2:225967254-225967276 CTCCCTCTTCAGTCGCTCCTTGG - Intergenic
948023993 2:234762091-234762113 CTGCATCTCCACCAGCTCCTGGG + Intergenic
1169710184 20:8552379-8552401 CTCCATGTCCAGTTGCACCGTGG + Intronic
1170698919 20:18685547-18685569 CTCCAGCTTCAGTGGCTCCATGG + Intronic
1171096952 20:22341456-22341478 CTCCCTCTCCATGAGCTCCCAGG + Intergenic
1171292341 20:23989536-23989558 CTCCAGCTCCTGCAGCTCCACGG + Intergenic
1174338189 20:49879230-49879252 GGCCATCTCCACTAGCTGCAGGG - Intronic
1174406167 20:50304719-50304741 ACCCAGCTCCAGCAGCTCCAAGG - Intergenic
1174666414 20:52262000-52262022 CTCCACCTCCAGTCCATCCAGGG - Intergenic
1175276369 20:57773898-57773920 CCCCAGCTCCAGGAGCTCCAGGG - Intergenic
1176061382 20:63174371-63174393 TTCCACCCCCAGGAGCTCCAGGG - Intergenic
1176186429 20:63782438-63782460 CTGCATCCCCTGGAGCTCCAGGG - Intronic
1178784250 21:35637812-35637834 CTCCATCTCCCCCAGCCCCAGGG + Intronic
1178849050 21:36197933-36197955 CTCCACCTCCTGTACCTCCTGGG - Intronic
1179996121 21:44975259-44975281 CACCAGCTCCAGGAGCTACAAGG - Intronic
1180466202 22:15613843-15613865 ATCCATCTTCAGTTGCTACATGG - Intergenic
1180823409 22:18847297-18847319 CTCCAGCTCCTACAGCTCCACGG + Exonic
1181123833 22:20690396-20690418 CTCCAGCTCCTACAGCTCCACGG + Intergenic
1181189333 22:21127249-21127271 CTCCAGCTCCTACAGCTCCACGG - Exonic
1181209865 22:21283246-21283268 CTCCAGCTCCTACAGCTCCACGG + Intergenic
1181393113 22:22598412-22598434 CTCTATGTCCAGCAGCTCCCAGG + Intergenic
1181399650 22:22643698-22643720 CTCCAGCTCCTACAGCTCCACGG - Intergenic
1181649766 22:24252370-24252392 CTCCAGCTCCTACAGCTCCACGG + Intergenic
1181707608 22:24658376-24658398 CTCCAGCTCCTACAGCTCCACGG - Intergenic
1182000944 22:26919333-26919355 CTCCATCTTCACTGACTCCATGG + Intergenic
1182835133 22:33335658-33335680 CTCCCTCCCCACTAGCTCCTAGG + Intronic
1183235643 22:36614869-36614891 CTCCATGTGCAGTAAGTCCACGG - Intronic
1183346405 22:37310769-37310791 CGCCAGCTCAAGCAGCTCCAGGG + Intronic
1203217081 22_KI270731v1_random:12187-12209 CTCCAGCTCCTACAGCTCCATGG - Intergenic
1203273550 22_KI270734v1_random:73203-73225 CTCCAGCTCCTACAGCTCCACGG + Intergenic
950081056 3:10222429-10222451 CTCCATCTCCATTTGCTGGAGGG + Intronic
950587074 3:13900743-13900765 CTTCCTCTCCAGTAGCTGCTAGG + Intergenic
950739690 3:15040464-15040486 CTCAGTCTCCAGGAGCCCCATGG + Intronic
950866672 3:16195342-16195364 CTCCATCTCCAGAAACTCTGGGG + Intronic
954132230 3:48566668-48566690 CTCTCTCGCCAGGAGCTCCAGGG + Exonic
954359888 3:50115958-50115980 CTCTCTCTCCCTTAGCTCCAAGG - Exonic
954894769 3:53965975-53965997 TTTCATCTCCAGTAGAACCAGGG + Intergenic
955326784 3:58014682-58014704 CCCTGCCTCCAGTAGCTCCATGG + Intronic
956716370 3:72083732-72083754 CTTCACTTCCAGTAGCTCAAGGG + Intergenic
959807080 3:110568252-110568274 CTCAATCTCCAGCACCTTCAGGG - Intergenic
960974137 3:123159081-123159103 CTATATTTCCAATAGCTCCAGGG + Intronic
962290953 3:134135925-134135947 CTAAATCTCCAGTAGTCCCATGG + Intronic
962592847 3:136908242-136908264 TTCCTTCACCAGTAGCTGCAGGG + Intronic
964385944 3:156147993-156148015 CTGGATCTGCAGTATCTCCAGGG - Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967291930 3:187929694-187929716 CTCCACCTCCAGATGTTCCATGG - Intergenic
967685488 3:192411099-192411121 ATCCATTTTCAGTAGCTTCAGGG - Intronic
968224771 3:196966868-196966890 CTGCATCTCCAGTAGCCTCCTGG + Intronic
969471154 4:7390016-7390038 CTGCATTTCCAGGAGCTCCCGGG + Intronic
969475733 4:7421653-7421675 CTCCCTCTCCAGTGGCTCCGGGG + Intronic
970318820 4:14855663-14855685 CTTCATTTCCAGTAACTCTATGG + Intergenic
974285715 4:59864739-59864761 CTCCACATCCATTGGCTCCAAGG + Intergenic
975630763 4:76399925-76399947 CTCCTTCTCCCATAGCTCAATGG - Intronic
976362874 4:84201038-84201060 CTTTATCTCCAGAAGCTCTAGGG + Intergenic
978978193 4:114907223-114907245 CTCCATCTACAGTGAATCCAAGG - Intronic
981954721 4:150455857-150455879 CTCTATCTCCATTAGTTCAATGG + Intronic
982765764 4:159346828-159346850 AGACCTCTCCAGTAGCTCCAAGG + Exonic
986645640 5:9913726-9913748 CTCCCTCTCCTGTAGCTCAGTGG + Intergenic
986693633 5:10333532-10333554 CTCCATCTCCAGTCGTTCTGGGG - Intergenic
987708641 5:21483747-21483769 CTCCAGCTCCTACAGCTCCACGG - Intergenic
988064618 5:26218605-26218627 CCCCAAGTCCAGTGGCTCCAGGG - Intergenic
988750969 5:34190398-34190420 CTCCAGCTCCTACAGCTCCACGG + Intergenic
989255583 5:39362916-39362938 CCCCAGCTCCAGCAGCTGCACGG - Intronic
990087413 5:51995740-51995762 CTTCCTCTCCAGTAGTTCCTCGG - Intergenic
990109982 5:52310748-52310770 CTCCATCCACTATAGCTCCATGG + Intergenic
991736111 5:69632322-69632344 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991739241 5:69653610-69653632 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991758957 5:69902821-69902843 CTCCAGCTCCTACAGCTCCACGG - Intergenic
991788379 5:70215301-70215323 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991790816 5:70233351-70233373 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991812611 5:70487961-70487983 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991815568 5:70508438-70508460 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991818702 5:70529727-70529749 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991838186 5:70777887-70777909 CTCCAGCTCCTACAGCTCCACGG - Intergenic
991880826 5:71215665-71215687 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991883263 5:71233686-71233708 CTCCAGCTCCTACAGCTCCACGG + Intergenic
994420700 5:99524773-99524795 CTCCAGCTCCTACAGCTCCACGG - Intergenic
994420770 5:99525097-99525119 CTCCAGCTCCTATAGCTCCGTGG - Intergenic
994486273 5:100389217-100389239 CTCCAGCTCCTATAGCTCCGTGG + Intergenic
994486343 5:100389541-100389563 CTCCAGCTCCTACAGCTCCACGG + Intergenic
994661257 5:102656940-102656962 CTCAGTCTCCACCAGCTCCAAGG - Intergenic
994679909 5:102873458-102873480 ATCCAACTCCAGGAGCCCCATGG + Intronic
997865993 5:137463467-137463489 CTCTATCTCCATTAGTTCAATGG - Intronic
998214310 5:140225788-140225810 CTCTATCTCCAGTAGATTCACGG - Intronic
999323132 5:150626876-150626898 CTCTCTCTCCAGGTGCTCCATGG - Intronic
1000171632 5:158708108-158708130 CTCCAACTGCAGCAGCTCCTCGG - Exonic
1001758367 5:174187731-174187753 CTCCAGCTCCAGCTGCTCAACGG + Intronic
1002351503 5:178586742-178586764 CTGCATCTCCAGTTGTGCCATGG + Intronic
1002467609 5:179415485-179415507 CCCCACCTCCAGAAGCTCCTGGG - Intergenic
1003127321 6:3365522-3365544 CTCCATCTCCAGCACCTAAATGG - Intronic
1004376766 6:15097296-15097318 CTCCATCTCCCGGAGCCCCAGGG + Intergenic
1005127760 6:22467904-22467926 CTCCATCTCCATTTGATCTATGG - Intergenic
1005549118 6:26897027-26897049 CTCCAGCTCCTACAGCTCCACGG + Intergenic
1006090256 6:31624503-31624525 CACCATCTCCATGTGCTCCATGG - Exonic
1006121570 6:31809917-31809939 CTCCTTCTCCAGAATTTCCAAGG + Exonic
1007540322 6:42636684-42636706 CTCTATCTCTAGTAACTCCAAGG - Intronic
1007928280 6:45667832-45667854 CCCCATCTTCAGTGCCTCCATGG - Intergenic
1009019861 6:57938137-57938159 CTCCAGCTCCTACAGCTCCACGG + Intergenic
1010054656 6:71551369-71551391 CACTTGCTCCAGTAGCTCCAGGG - Intergenic
1018066424 6:160127724-160127746 CTCCAGCTCCAGGAGCTCACTGG + Intronic
1018955467 6:168407187-168407209 CTTCATCTCCTGTAGCTACAGGG - Intergenic
1019348656 7:542987-543009 CTCCACCTCCAGTTGGTCAAAGG - Intergenic
1019557594 7:1640502-1640524 TTCCAACGCCAGTGGCTCCAAGG - Intergenic
1020914758 7:14178597-14178619 CTCCAACTCCATGATCTCCAAGG - Intronic
1022097215 7:27148420-27148442 CTCCTTCTCCGCTAGCACCAGGG + Intronic
1023955509 7:44884312-44884334 CTCCCTCTCCACTAGCTCACTGG + Exonic
1025740512 7:64192318-64192340 CTCGCTCTCCAGGAGCTCCGGGG - Intronic
1027947892 7:84774068-84774090 CTCTATTTCCAGCAGCTCTAGGG + Intergenic
1028734873 7:94197303-94197325 CTCTTTCTCCAGTATCTGCATGG - Intergenic
1029464440 7:100716502-100716524 CTCTCTCTCCAGAAGCCCCAGGG + Intergenic
1030088982 7:105840672-105840694 CTGCATCTCCAACGGCTCCAGGG + Intronic
1030990915 7:116298919-116298941 CTCCATCTCCATGAGTTCAATGG - Intronic
1032341732 7:131080134-131080156 CTCCATCTCCAGAATGTCCTGGG - Intergenic
1032497364 7:132372575-132372597 CTCTATCTTCATTACCTCCAAGG + Intronic
1033318562 7:140318729-140318751 CTCCATCTCCTCTACCACCAAGG + Intronic
1035167149 7:156998627-156998649 CTCTATCTCCATGAGTTCCATGG - Intronic
1035603370 8:912531-912553 CTCCATGTCCAGGAACTTCATGG - Intergenic
1035768487 8:2127440-2127462 CTCCACCTCCAGAAGCTCTGGGG + Intronic
1037935114 8:22910192-22910214 CTTCATCTCCAGTTACTCCTGGG - Intronic
1039536179 8:38315496-38315518 CTGCATCTGCAGTAGCTGAAGGG + Exonic
1043473676 8:80585367-80585389 CTCCATCTCTAAATGCTCCATGG - Intergenic
1044925825 8:97208075-97208097 CTCCATTTCCAGTGGGGCCAAGG - Intergenic
1045488337 8:102651537-102651559 CTCCACCTGCAGTATCTGCAGGG - Exonic
1046705687 8:117448975-117448997 CTCCCTCTCCAGTTTCTGCAAGG - Intergenic
1050754314 9:8981460-8981482 ATCCAAATCCAGTGGCTCCATGG - Intronic
1051327296 9:15986632-15986654 CTCCATCTCCAGCAGGTGCCAGG - Intronic
1052101328 9:24449190-24449212 CTTTATCTCCTGTAGCTGCAGGG - Intergenic
1052224416 9:26067883-26067905 CTCTATCTCCACTTGCTACAGGG - Intergenic
1055907901 9:81315057-81315079 CTCAATCTCCATTGACTCCATGG + Intergenic
1057454773 9:95198136-95198158 TTCCATCTCCACTAGCTGCTGGG - Intronic
1058624905 9:106924863-106924885 CTCCAACTTCAGGGGCTCCATGG + Exonic
1060528618 9:124334574-124334596 CTCCCTCTGCTGGAGCTCCAAGG - Intronic
1061169773 9:128945920-128945942 CTCCATCTTCGGTAGCACCATGG - Exonic
1061802436 9:133119946-133119968 CTGCGTCTCCAGTCGCTTCATGG - Intronic
1062192043 9:135253122-135253144 CTCCAGCTCCAGGAGCTCCCAGG - Intergenic
1186603485 X:11064301-11064323 CCCCATCCCCAGTAGGTCTAGGG + Intergenic
1187244659 X:17543158-17543180 CAACATCACCAGTAGCACCAGGG - Intronic
1188741554 X:33789463-33789485 CTCTATCTCCATGAGCTCAAAGG + Intergenic
1191673651 X:63772292-63772314 ATCCAACTCCAATAGCTGCATGG + Intronic
1192211120 X:69128727-69128749 CTCCACGGCCAGTAGCTCCGGGG - Intergenic
1192576375 X:72246309-72246331 CTCCATCTCCACTGCCACCACGG + Intronic
1195065890 X:101237744-101237766 CTCCTTCTCCTGTTGCACCAGGG - Exonic
1195113715 X:101674297-101674319 CTCCAGCCCCAGTAGTGCCATGG - Intergenic
1199970767 X:152859056-152859078 CACCATCTCCAGTGACTCCAAGG - Intronic
1200133218 X:153862590-153862612 CTCCCTCTCCAGCAGGCCCATGG - Exonic