ID: 1151298278

View in Genome Browser
Species Human (GRCh38)
Location 17:73201959-73201981
Sequence CTGAAGGAACTGATTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151298278_1151298282 10 Left 1151298278 17:73201959-73201981 CCAACCTCAATCAGTTCCTTCAG 0: 1
1: 0
2: 2
3: 21
4: 189
Right 1151298282 17:73201992-73202014 AAAACAATTCTGATTTCATACGG 0: 1
1: 1
2: 5
3: 77
4: 691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151298278 Original CRISPR CTGAAGGAACTGATTGAGGT TGG (reversed) Intronic
900856923 1:5193566-5193588 CTGAAGGGAGTGATTTAGGTTGG - Intergenic
901160164 1:7171229-7171251 CTGATGGAAATGATAGATGTGGG - Intronic
901821360 1:11831961-11831983 CTAAAGGAACGTATTTAGGTTGG - Intronic
902693537 1:18125504-18125526 CTGAATGAACTGATTAAAGCTGG + Intronic
902734884 1:18394024-18394046 CTGAAGGGACTGTGTGATGTTGG - Intergenic
902826873 1:18980861-18980883 CAGAAGGAAATGAGTGTGGTAGG + Intergenic
903437249 1:23359847-23359869 CAGCAGGAACTGGTTGGGGTGGG + Exonic
904904803 1:33887517-33887539 TGGAAGGAGCTGATAGAGGTTGG - Intronic
905004917 1:34701779-34701801 CTCAAGGACAGGATTGAGGTGGG + Intergenic
906320151 1:44810590-44810612 CTGGAGGAACTGAGAGAGGTGGG + Exonic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
909586176 1:77291280-77291302 CTGAAGGATATGATTAGGGTTGG - Intronic
910053609 1:83005747-83005769 CTGGAGATGCTGATTGAGGTTGG + Intergenic
910820234 1:91337964-91337986 CAGAAGGAAGTCATTGAGGGTGG + Intronic
911268579 1:95773637-95773659 CTGAAGGAAAATATTGAAGTGGG + Intergenic
911491959 1:98580757-98580779 CTGAAGTCATTGATTTAGGTAGG + Intergenic
914038120 1:144022593-144022615 GTGAAGGAAGTGATGGAGGGAGG - Intergenic
917855277 1:179094570-179094592 CTGAAGGGGCTGGGTGAGGTTGG - Intronic
917911686 1:179654345-179654367 CTGAAGGAAGAAAATGAGGTAGG + Exonic
918110574 1:181451950-181451972 CTCAATGAACTAATTGGGGTAGG + Intronic
919718516 1:200806673-200806695 CTGAAGAAACTGGTGGAGGGAGG + Intronic
919820760 1:201470375-201470397 CTGGAGGAACTGATCAAGATGGG - Intergenic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
920872709 1:209807185-209807207 CTGTAGTAACTGATGGAGTTGGG - Intergenic
921681597 1:218039488-218039510 CTGAGGGATCAGATGGAGGTTGG + Intergenic
923128179 1:231050653-231050675 CTGAAGGACCTGCCTGAGGCTGG + Intergenic
923192336 1:231631410-231631432 CTGAAGGACCTGCCTGAGGCGGG - Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
1063388504 10:5632534-5632556 CTGAAGTAAATGATTGATGGAGG - Intergenic
1065320676 10:24506184-24506206 CTGCAGGAACAGATCCAGGTGGG + Intronic
1065654297 10:27931492-27931514 CTGAAGGACCTGATTGAGCTGGG - Intronic
1066484776 10:35832900-35832922 CTGAATGAACTGAATGAAGGAGG + Intergenic
1067305377 10:45059443-45059465 CTGAATGAACTGACTGAAGGAGG + Intergenic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1073061973 10:100738604-100738626 TTGAAGAAACTGATGGAGGGAGG - Intronic
1073994391 10:109299144-109299166 CTGAAGGAACAGAGTGATGTTGG - Intergenic
1077868412 11:6241364-6241386 CTGAAGGAAGGGATGGAGGCAGG + Intronic
1079120470 11:17680485-17680507 CTGAAGGCACAGACTGAGATTGG - Intergenic
1081330994 11:41799880-41799902 CAGAAGGAAATGGTTGAGATAGG + Intergenic
1083957424 11:65992644-65992666 CTAAGGGTACTGATGGAGGTAGG - Intergenic
1086553761 11:88085212-88085234 GTGAAAGAAGTGAATGAGGTTGG - Intergenic
1088649722 11:111946718-111946740 CAGCAGGAACTCATTGAAGTCGG + Intronic
1090033952 11:123231903-123231925 CTGAAGTGACTGATGGAGGCAGG - Intergenic
1090167910 11:124570900-124570922 GTCAAGGAACTGATTGTGGAGGG - Exonic
1090340915 11:126019425-126019447 CTGAAGGAACTGAGGGAGTGAGG + Intronic
1090423560 11:126591970-126591992 CTGAAGGATGTGATAGGGGTGGG - Intronic
1091061910 11:132471530-132471552 CTGGAGGACCTGATTCAAGTTGG + Intronic
1092655563 12:10680835-10680857 CTGAAGGAAGTGATGGTGGTGGG - Intergenic
1096644427 12:53022766-53022788 CTGAAAGAACTGATAGATGCAGG + Intronic
1098913600 12:76235181-76235203 GTGAAGGCGCTGATAGAGGTTGG - Intergenic
1101710934 12:107265014-107265036 CTGAAGGGAGTTCTTGAGGTTGG + Intergenic
1101874528 12:108589715-108589737 GTGAAGGGACAGATTGATGTGGG - Intergenic
1102734209 12:115143731-115143753 CTGAAGGAAGTGAATGAACTAGG + Intergenic
1105480685 13:20773112-20773134 AGGAAGGAACTGTTTGAGGCAGG - Intronic
1105626587 13:22118625-22118647 AGGCAGGTACTGATTGAGGTTGG + Intergenic
1109104795 13:58237263-58237285 CTGAAGGATCTGCTTAAGGTTGG + Intergenic
1113561975 13:111288507-111288529 CTGAAGGAACCTGTTGTGGTAGG + Intronic
1114128810 14:19764392-19764414 CTGAAGGGACTGAGAGAGGGAGG + Intronic
1116019862 14:39447262-39447284 TTGAAGGAATTGAGTGAGGAAGG + Intergenic
1116977352 14:51131083-51131105 CAAAAGGAATGGATTGAGGTGGG - Intergenic
1119278313 14:73381017-73381039 TTAAAAGAACTAATTGAGGTCGG - Intronic
1119417167 14:74479650-74479672 TTGAAGGAACTGAATTTGGTGGG - Intronic
1119555319 14:75548227-75548249 CTGAAGGAGCTCAATCAGGTGGG - Intergenic
1119884965 14:78132486-78132508 CTGATGGAACCTATTGAGGGTGG + Intergenic
1121915067 14:97831311-97831333 CTAAAGGACTTGATGGAGGTTGG + Intergenic
1123571758 15:21618604-21618626 CTGAAGGGACTGAGAGAGGGAGG + Intergenic
1123608374 15:22061200-22061222 CTGAAGGGACTGAGAGAGGGAGG + Intergenic
1126312995 15:47337939-47337961 CCTAAGGACCTGATGGAGGTCGG + Intronic
1127280506 15:57486805-57486827 CTGAAGCTACTGATTTTGGTTGG + Intronic
1128617202 15:69119570-69119592 CTGAAGGGAATGGTTGAGATCGG + Intergenic
1128680841 15:69650240-69650262 CTGGAGGATCTGCTGGAGGTTGG - Intergenic
1128862268 15:71083781-71083803 ATGAATGGACTGATTGAGCTAGG + Intergenic
1132408456 15:101559580-101559602 CTGAAGGCACTGCTTCAGGTGGG + Intergenic
1202980613 15_KI270727v1_random:352999-353021 CTGAAGGGACTGAGAGAGGGAGG + Intergenic
1132783378 16:1641165-1641187 CTGAATGAACTCATTCAGGTTGG + Exonic
1135960403 16:26990142-26990164 CTGAAGGAAGGCAGTGAGGTGGG - Intergenic
1138457370 16:57129133-57129155 CTGGAGGAACTGGCAGAGGTGGG + Intronic
1142174909 16:88640686-88640708 CTCAAGGCACTGCTTGAGGAAGG - Intergenic
1144599026 17:16597033-16597055 TGGAAGGAACTGATTGTGTTTGG - Intergenic
1145109361 17:20148617-20148639 CTCAAGGCACTGATTGAGAGTGG - Intronic
1145185181 17:20787751-20787773 CTGAGAGCACTGATTCAGGTGGG - Intergenic
1145832933 17:27931943-27931965 CTGAAGGACCTAATTTTGGTGGG + Intergenic
1147393475 17:40123271-40123293 CAGAAGGATCTGTTTGAGGCAGG - Exonic
1149230744 17:54531295-54531317 CGAAAGGAAATGATTGGGGTGGG + Intergenic
1151298278 17:73201959-73201981 CTGAAGGAACTGATTGAGGTTGG - Intronic
1151453845 17:74214679-74214701 CACAAGGAACTGATACAGGTGGG - Intronic
1152056760 17:78034671-78034693 ATGAAGAAAATGTTTGAGGTCGG + Intronic
1152684418 17:81687078-81687100 CTGAAGGACCTGCTGAAGGTGGG + Exonic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153381211 18:4441456-4441478 CTGGAAGAACTCATTGAAGTAGG + Intronic
1154303441 18:13214323-13214345 CCAAAGGAAGTGAATGAGGTTGG + Intergenic
1156167337 18:34438438-34438460 CTGAAGGGAATGGTTGAGGGTGG - Intergenic
1156659595 18:39331125-39331147 CTGAATGAACTGATCGAAGTTGG - Intergenic
1156811497 18:41257953-41257975 CTGGAGGACCTGATTCAGTTGGG - Intergenic
1157507219 18:48236624-48236646 CTAAAGCAAAAGATTGAGGTGGG + Intronic
1157754569 18:50206376-50206398 CAGAAAGAAGGGATTGAGGTCGG - Intergenic
1158730214 18:60014436-60014458 CTGAGTGAATTGATTGGGGTGGG + Intergenic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161741985 19:6026934-6026956 CTGAAGGACCTGATGGAGGTGGG + Intronic
1162340880 19:10091115-10091137 GTGAAGTCACTGATTGAGTTGGG + Intronic
1163588663 19:18177870-18177892 CTGAGGGAGCTGGTTGAGGAAGG - Exonic
1164843673 19:31413622-31413644 CTGCAGGATCTGATTGTGTTTGG - Intergenic
1165309738 19:35022894-35022916 CTGCAGGATCTGTGTGAGGTAGG + Exonic
1165508892 19:36254609-36254631 CTGAAGGAAGTGCTTGGGCTAGG - Intergenic
1165839393 19:38778837-38778859 CTGAATGGGCTGATTGGGGTGGG + Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167197494 19:48040625-48040647 GAGATGGAACTGATTGAGCTCGG - Exonic
1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG + Exonic
925589187 2:5493322-5493344 CTGAAGGAAATACTGGAGGTGGG - Intergenic
926118731 2:10229461-10229483 CTGAATGATCTGATTCAAGTGGG + Intergenic
926245954 2:11122677-11122699 CTGATGGATTTGATCGAGGTGGG - Intergenic
927527133 2:23755204-23755226 CTGAAGGGAATGTTTTAGGTTGG - Intronic
927967228 2:27278382-27278404 ATGAAAGAAATGATTGGGGTTGG + Intronic
933782604 2:85812613-85812635 CTGAAGGCACTGGTTGGGGGTGG - Intergenic
934124050 2:88869202-88869224 CAGAGGGCAGTGATTGAGGTGGG - Intergenic
934720249 2:96569541-96569563 CTGAATGAACTGATGGGGGATGG + Intergenic
937535142 2:122877046-122877068 CTGAAGGAACAGATAGATGTGGG + Intergenic
943701571 2:190993645-190993667 CTGAAGGAAAGGAATGAGATAGG + Intronic
945194282 2:207223832-207223854 CTGAAGAAAATGAGTGAAGTGGG - Intergenic
947638824 2:231694499-231694521 CAGAAGGAACTGGTGGAGGTGGG - Intergenic
948749299 2:240121619-240121641 GTGAAGGAACAGACTGTGGTGGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1173071847 20:39775706-39775728 TTGGAAGAACTGAATGAGGTAGG - Intergenic
1173189396 20:40864641-40864663 CTGAAGGAAGGGATGGAGGGAGG + Intergenic
1174198726 20:48791994-48792016 CAGAAGGCACAGATTGGGGTTGG + Intronic
1175524190 20:59622310-59622332 ATGAAGGGACTGACAGAGGTTGG - Intronic
1178081754 21:29073501-29073523 CTGAAGGAAAGGAATGAGGTGGG - Intronic
1178736153 21:35153920-35153942 CTGAAGGAAATGCCTGAAGTCGG - Intronic
1179606650 21:42520555-42520577 TGGAAGGAACTGAGTGAGGTTGG + Intronic
1180007873 21:45031610-45031632 CTGAAGGAACGGAGAGAGGGAGG + Intergenic
1182653969 22:31874859-31874881 CTCAAGGAGCTGGTTGAGGCAGG - Intronic
1182801478 22:33035093-33035115 CTGAAGGAAAGGAGTGGGGTGGG + Intronic
1183364479 22:37399808-37399830 CTGGAGCAAGTGAGTGAGGTGGG - Intronic
950568465 3:13785820-13785842 CTGAAGGCACTCATTTAGTTGGG + Intergenic
952512396 3:34070508-34070530 CTGAAGCATTTGTTTGAGGTTGG - Intergenic
952595525 3:35013423-35013445 CTTAAAGAACTGACTGAGATAGG - Intergenic
954389467 3:50261044-50261066 CTGAAGGGACTCCATGAGGTTGG + Intergenic
954772729 3:52987180-52987202 CTGAAGGACCTGTCTGAGGCTGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956437294 3:69246360-69246382 ATGAAAGAACTGATTGAGCCAGG + Intronic
958704327 3:97634677-97634699 CTGAATCCAGTGATTGAGGTAGG + Intronic
959392499 3:105793404-105793426 CATAAGGAACTGATGGAGGAAGG + Intronic
961717856 3:128870932-128870954 TGGAAGGAGCTGATTGAGGTTGG - Intergenic
962414493 3:135169631-135169653 CTGAAGGCTCTGATGGAGGGAGG + Intronic
964305122 3:155331724-155331746 CTGATGGTACTGATAGAGATGGG - Intergenic
966961570 3:184944991-184945013 CTGTAGGCACTCATTGAAGTAGG - Intronic
967189642 3:186974302-186974324 CTGCAGGAACCGACTGAGCTTGG + Intronic
970286509 4:14522801-14522823 ATCAAGGAACTGAGTGAGCTGGG - Intergenic
974339436 4:60596016-60596038 CTGAAGGAAAAGATTGGGGAAGG - Intergenic
975597091 4:76058341-76058363 CTGAATGAATTGCTTGAGTTTGG + Intronic
977914694 4:102578390-102578412 CTGAAGGAACTGAATGACTCAGG - Intronic
980328310 4:131377239-131377261 CTGAAGGATCTTGTTGAGGATGG + Intergenic
981401828 4:144322265-144322287 CTGAAGCAAGTGCTTGAGCTGGG - Intergenic
984145141 4:176051293-176051315 CTCAAGGAACTGATATAGGAAGG - Intergenic
987168185 5:15222746-15222768 CTGAAGGAACTGATAGTTGGAGG + Intergenic
988077112 5:26367240-26367262 CTGTAGGCACTAATTGTGGTTGG + Intergenic
988245705 5:28677793-28677815 CTAAAGTTACTGATTGAGTTAGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
990032331 5:51276886-51276908 GTGATGGAACTGATTCTGGTTGG - Intergenic
990372974 5:55139714-55139736 CTGATGAAACTGAATGAGGCAGG + Intronic
991989318 5:72321398-72321420 CAGAGGGAACTGTTAGAGGTGGG + Intronic
992762667 5:79964863-79964885 CTCAAGGAAGAGATTGAGGCTGG - Intergenic
993937451 5:94021733-94021755 CTTAAGGAACTCATTAAAGTAGG + Intronic
996849683 5:127938123-127938145 CATAAGAAACTGATTCAGGTGGG - Intergenic
997729457 5:136156595-136156617 CTGAAGGAACTGATGAAGAAAGG + Intronic
998361343 5:141590612-141590634 CTGAGGGAACTCTTTGAGTTTGG - Intronic
1001475682 5:172048990-172049012 CTGAAGGACCTGAGGGAGGGAGG - Intronic
1002422220 5:179154619-179154641 CTGAAGGAACCAATTGAAGGAGG - Intronic
1002563728 5:180098884-180098906 CCCAAGGAACTGCTTGGGGTGGG + Intergenic
1003038878 6:2669240-2669262 CTGCTGGAACTGCTTGAGGAGGG - Intronic
1003935118 6:10968243-10968265 CTGAAGAAACTGCTAGAGGAGGG + Intronic
1005525249 6:26641276-26641298 GAGAAAGAACTGAATGAGGTGGG + Intronic
1008368768 6:50711105-50711127 CTAAAGAAACTCATTGAGGCAGG - Intergenic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1013996613 6:116316040-116316062 CTGAAGGAATTTAGTGAGTTTGG + Intronic
1018405106 6:163472395-163472417 CAGAAGGAGGTGATGGAGGTGGG + Intronic
1021696537 7:23281775-23281797 CTGAAGGACCTGCCTGAGGCTGG - Intergenic
1022298189 7:29077147-29077169 CTGGAGGAGCTGATTGAAGCTGG - Intronic
1022588109 7:31634954-31634976 CTGAAGGAACTGGGTGGGGTGGG + Intronic
1023086918 7:36579940-36579962 CTGAAGGAATTGATTGATTTTGG + Intronic
1025768579 7:64482354-64482376 CTGAAGGAACTCTTTGGGTTGGG + Intergenic
1026237470 7:68539963-68539985 ATGAATGAACAGATTGTGGTAGG - Intergenic
1030844717 7:114394799-114394821 CTGAAGGAACTGTTCGAGACTGG + Intronic
1034050353 7:147977448-147977470 CTGAAGGAACTGCTTCAAATAGG + Intronic
1034502753 7:151461469-151461491 CTCTAGGAAGTCATTGAGGTAGG + Intergenic
1038238264 8:25783439-25783461 CTGAAGGAAGTGATAGGGTTGGG + Intergenic
1039015723 8:33146766-33146788 CTGAATGTACTGATTTAGTTAGG - Intergenic
1041298644 8:56388468-56388490 CTGAAGGAAATGTTTGGGGTAGG + Intergenic
1041411890 8:57565172-57565194 CTGAAGAAACTGCTTGATGGTGG + Intergenic
1041761067 8:61366993-61367015 CTGAAGGAACTAAGTCAGGTAGG - Intronic
1041843477 8:62298722-62298744 CTGGAGGAACAGATTTAGGTTGG - Intronic
1042604853 8:70535196-70535218 CTGAGGTAAGTGACTGAGGTGGG - Intergenic
1044145572 8:88709680-88709702 CTGAAGGTACTGACTGAGCAAGG + Intergenic
1044830696 8:96244917-96244939 CTGAAGGATCTGTTTGGTGTTGG - Intronic
1044921376 8:97172927-97172949 CTAAAGGAACAGTTTGAGTTAGG - Intergenic
1046485223 8:114878863-114878885 TTGAATGAACTGATTGATGATGG - Intergenic
1047262172 8:123273640-123273662 CTGAGCGCACTGACTGAGGTTGG - Intronic
1047921950 8:129644448-129644470 CTGAATGAAGTGATTGTGGCTGG - Intergenic
1048718123 8:137291194-137291216 CTGAAGGAGCAGATTGAAGTAGG - Intergenic
1049079616 8:140431476-140431498 ATGAAGGAAATATTTGAGGTGGG - Intronic
1049760835 8:144331407-144331429 CAGCAGGGACTGGTTGAGGTGGG + Exonic
1053185815 9:36015406-36015428 CTCAAGGAACAGACTGAGATAGG + Intergenic
1055327793 9:75150118-75150140 GTGAAGGAACTGGTTGAAGGTGG + Intergenic
1057001490 9:91513907-91513929 GGGAAGGGACAGATTGAGGTGGG + Intergenic
1057344052 9:94231987-94232009 CTGAAGAAACAAAGTGAGGTGGG + Intergenic
1057635999 9:96767520-96767542 TTTAAGGAACTAAATGAGGTGGG + Intronic
1059404957 9:114093800-114093822 CTTAATGAACTGCTTGAGGCTGG - Intronic
1185882136 X:3750925-3750947 GAGAAGGAACTGATACAGGTGGG - Intergenic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1190759659 X:53428774-53428796 CTGAAGGAAGTCAGGGAGGTTGG - Intronic
1194686945 X:96931883-96931905 ATGAAAGAACTGCTTCAGGTGGG - Intronic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1200782836 Y:7232281-7232303 GAGAAGGAACTGATACAGGTGGG + Intergenic