ID: 1151300525

View in Genome Browser
Species Human (GRCh38)
Location 17:73221643-73221665
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151300520_1151300525 -8 Left 1151300520 17:73221628-73221650 CCTGTAATCCTAATACTTTGGAA 0: 6
1: 290
2: 6616
3: 71763
4: 365108
Right 1151300525 17:73221643-73221665 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151300525 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr