ID: 1151306031

View in Genome Browser
Species Human (GRCh38)
Location 17:73263106-73263128
Sequence GTAGAAACCCTGGCTTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151306027_1151306031 -6 Left 1151306027 17:73263089-73263111 CCAAGGGGGTCCCTGGGGTAGAA No data
Right 1151306031 17:73263106-73263128 GTAGAAACCCTGGCTTCTCTTGG No data
1151306019_1151306031 13 Left 1151306019 17:73263070-73263092 CCAGGGCTAGAGGGTGGGGCCAA No data
Right 1151306031 17:73263106-73263128 GTAGAAACCCTGGCTTCTCTTGG No data
1151306014_1151306031 20 Left 1151306014 17:73263063-73263085 CCCAGCTCCAGGGCTAGAGGGTG No data
Right 1151306031 17:73263106-73263128 GTAGAAACCCTGGCTTCTCTTGG No data
1151306015_1151306031 19 Left 1151306015 17:73263064-73263086 CCAGCTCCAGGGCTAGAGGGTGG No data
Right 1151306031 17:73263106-73263128 GTAGAAACCCTGGCTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151306031 Original CRISPR GTAGAAACCCTGGCTTCTCT TGG Intergenic
No off target data available for this crispr