ID: 1151306070

View in Genome Browser
Species Human (GRCh38)
Location 17:73263360-73263382
Sequence TGGGGCCATCTCTGAGGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151306070_1151306084 29 Left 1151306070 17:73263360-73263382 CCCTATCCTCAGAGATGGCCCCA No data
Right 1151306084 17:73263412-73263434 ATAATGCGATGGAGGCATGAGGG No data
1151306070_1151306082 21 Left 1151306070 17:73263360-73263382 CCCTATCCTCAGAGATGGCCCCA No data
Right 1151306082 17:73263404-73263426 TTCACACAATAATGCGATGGAGG No data
1151306070_1151306083 28 Left 1151306070 17:73263360-73263382 CCCTATCCTCAGAGATGGCCCCA No data
Right 1151306083 17:73263411-73263433 AATAATGCGATGGAGGCATGAGG No data
1151306070_1151306085 30 Left 1151306070 17:73263360-73263382 CCCTATCCTCAGAGATGGCCCCA No data
Right 1151306085 17:73263413-73263435 TAATGCGATGGAGGCATGAGGGG No data
1151306070_1151306081 18 Left 1151306070 17:73263360-73263382 CCCTATCCTCAGAGATGGCCCCA No data
Right 1151306081 17:73263401-73263423 CCATTCACACAATAATGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151306070 Original CRISPR TGGGGCCATCTCTGAGGATA GGG (reversed) Intergenic
No off target data available for this crispr