ID: 1151306078

View in Genome Browser
Species Human (GRCh38)
Location 17:73263379-73263401
Sequence GCTAATGTCCCCTCCTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151306078_1151306085 11 Left 1151306078 17:73263379-73263401 CCCATCAAGGAGGGGACATTAGC No data
Right 1151306085 17:73263413-73263435 TAATGCGATGGAGGCATGAGGGG No data
1151306078_1151306089 29 Left 1151306078 17:73263379-73263401 CCCATCAAGGAGGGGACATTAGC No data
Right 1151306089 17:73263431-73263453 AGGGGCCCAGCAGGGCAGGAAGG No data
1151306078_1151306087 21 Left 1151306078 17:73263379-73263401 CCCATCAAGGAGGGGACATTAGC No data
Right 1151306087 17:73263423-73263445 GAGGCATGAGGGGCCCAGCAGGG No data
1151306078_1151306086 20 Left 1151306078 17:73263379-73263401 CCCATCAAGGAGGGGACATTAGC No data
Right 1151306086 17:73263422-73263444 GGAGGCATGAGGGGCCCAGCAGG No data
1151306078_1151306084 10 Left 1151306078 17:73263379-73263401 CCCATCAAGGAGGGGACATTAGC No data
Right 1151306084 17:73263412-73263434 ATAATGCGATGGAGGCATGAGGG No data
1151306078_1151306083 9 Left 1151306078 17:73263379-73263401 CCCATCAAGGAGGGGACATTAGC No data
Right 1151306083 17:73263411-73263433 AATAATGCGATGGAGGCATGAGG No data
1151306078_1151306081 -1 Left 1151306078 17:73263379-73263401 CCCATCAAGGAGGGGACATTAGC No data
Right 1151306081 17:73263401-73263423 CCATTCACACAATAATGCGATGG No data
1151306078_1151306082 2 Left 1151306078 17:73263379-73263401 CCCATCAAGGAGGGGACATTAGC No data
Right 1151306082 17:73263404-73263426 TTCACACAATAATGCGATGGAGG No data
1151306078_1151306090 30 Left 1151306078 17:73263379-73263401 CCCATCAAGGAGGGGACATTAGC No data
Right 1151306090 17:73263432-73263454 GGGGCCCAGCAGGGCAGGAAGGG No data
1151306078_1151306088 25 Left 1151306078 17:73263379-73263401 CCCATCAAGGAGGGGACATTAGC No data
Right 1151306088 17:73263427-73263449 CATGAGGGGCCCAGCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151306078 Original CRISPR GCTAATGTCCCCTCCTTGAT GGG (reversed) Intergenic
No off target data available for this crispr