ID: 1151306083

View in Genome Browser
Species Human (GRCh38)
Location 17:73263411-73263433
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151306079_1151306083 8 Left 1151306079 17:73263380-73263402 CCATCAAGGAGGGGACATTAGCC No data
Right 1151306083 17:73263411-73263433 AATAATGCGATGGAGGCATGAGG No data
1151306078_1151306083 9 Left 1151306078 17:73263379-73263401 CCCATCAAGGAGGGGACATTAGC No data
Right 1151306083 17:73263411-73263433 AATAATGCGATGGAGGCATGAGG No data
1151306070_1151306083 28 Left 1151306070 17:73263360-73263382 CCCTATCCTCAGAGATGGCCCCA No data
Right 1151306083 17:73263411-73263433 AATAATGCGATGGAGGCATGAGG No data
1151306072_1151306083 22 Left 1151306072 17:73263366-73263388 CCTCAGAGATGGCCCCATCAAGG No data
Right 1151306083 17:73263411-73263433 AATAATGCGATGGAGGCATGAGG No data
1151306077_1151306083 10 Left 1151306077 17:73263378-73263400 CCCCATCAAGGAGGGGACATTAG No data
Right 1151306083 17:73263411-73263433 AATAATGCGATGGAGGCATGAGG No data
1151306071_1151306083 27 Left 1151306071 17:73263361-73263383 CCTATCCTCAGAGATGGCCCCAT No data
Right 1151306083 17:73263411-73263433 AATAATGCGATGGAGGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151306083 Original CRISPR AATAATGCGATGGAGGCATG AGG Intergenic
No off target data available for this crispr