ID: 1151309875

View in Genome Browser
Species Human (GRCh38)
Location 17:73286406-73286428
Sequence GAGATGATCAGCGCCCCGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 46}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151309875_1151309883 9 Left 1151309875 17:73286406-73286428 CCCAGCGGGGCGCTGATCATCTC 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1151309883 17:73286438-73286460 GTCCGCTCGGGAACGGCGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 27
1151309875_1151309880 -3 Left 1151309875 17:73286406-73286428 CCCAGCGGGGCGCTGATCATCTC 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1151309880 17:73286426-73286448 CTCGGCCGTGAGGTCCGCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 105
1151309875_1151309879 -4 Left 1151309875 17:73286406-73286428 CCCAGCGGGGCGCTGATCATCTC 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1151309879 17:73286425-73286447 TCTCGGCCGTGAGGTCCGCTCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1151309875_1151309885 24 Left 1151309875 17:73286406-73286428 CCCAGCGGGGCGCTGATCATCTC 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1151309885 17:73286453-73286475 GCGCTTGGAGTGCACCGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 157
1151309875_1151309882 2 Left 1151309875 17:73286406-73286428 CCCAGCGGGGCGCTGATCATCTC 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1151309882 17:73286431-73286453 CCGTGAGGTCCGCTCGGGAACGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151309875 Original CRISPR GAGATGATCAGCGCCCCGCT GGG (reversed) Exonic
900377000 1:2359435-2359457 CAGATGCTCTGGGCCCCGCTGGG + Intronic
900853463 1:5162289-5162311 GAGAATCTCAGCTCCCCGCTAGG - Intergenic
902937259 1:19773272-19773294 GAGATGATTAGGGCTCCCCTTGG + Intronic
907940109 1:59079373-59079395 GCAATGCTCAGCGCCCTGCTTGG + Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
921217725 1:212951431-212951453 GAGGGGATCAGCGCCCCGCGGGG - Exonic
1065852223 10:29800304-29800326 GAGATGAACAGCTCCCTGCGTGG + Intergenic
1083844054 11:65320980-65321002 GACATGATCAGCCCACCGCTGGG + Exonic
1089825513 11:121272482-121272504 CAGATGATCCTCCCCCCGCTTGG - Intergenic
1090125461 11:124078859-124078881 GGGAAGATCAGAGTCCCGCTTGG + Intergenic
1104237009 12:126948672-126948694 CAGGTGATCCGCTCCCCGCTTGG - Intergenic
1109706097 13:66094560-66094582 CAGATGATCTGCCCCCCACTTGG - Intergenic
1114332555 14:21652113-21652135 GAGATGATCAGCTTTCTGCTGGG + Intergenic
1119734525 14:76973470-76973492 CAGATGATCAGGGCCCCGCCTGG - Intergenic
1146216185 17:30979974-30979996 GGGAGGATCAGCCCCCCGCCTGG - Intronic
1146669861 17:34729671-34729693 TAGATGCTCAGCGCCCCTCCAGG + Intergenic
1146931577 17:36781965-36781987 GAGATGCTGAGCGCCCTGCCTGG - Intergenic
1151309875 17:73286406-73286428 GAGATGATCAGCGCCCCGCTGGG - Exonic
1163007749 19:14407053-14407075 GTGATGGTCAGCGCCCTGCGAGG - Exonic
1163768676 19:19177842-19177864 GAGAAGAGCAGAGCCCGGCTTGG - Intronic
1166697771 19:44863607-44863629 CAAATGATCAGCTCCCCCCTTGG - Intronic
925403346 2:3590796-3590818 GGGGGGATCAGCCCCCCGCTCGG - Intergenic
928157367 2:28888823-28888845 CAGATGATCCGCGCCCACCTTGG - Intergenic
929030550 2:37646481-37646503 GATATGATCAGTCCCCCGCTTGG - Exonic
932378320 2:71258337-71258359 GAGATGACCACAGCCCCGGTCGG - Intergenic
933516042 2:83303381-83303403 AAGGTGATCAGGGCCCAGCTTGG - Intergenic
937901490 2:127022949-127022971 GAGATTATCAGCGCACGGCAGGG + Intergenic
940643512 2:156368929-156368951 GGGAGGATCAGCCCCCCGCCTGG + Intergenic
948682580 2:239645975-239645997 GAGATGCCCAGCGCCCTGCAAGG - Intergenic
948682974 2:239648839-239648861 GTTAAGATCAGCTCCCCGCTGGG - Intergenic
1171370762 20:24660840-24660862 GAGATGACCAGCCCCTGGCTGGG - Intronic
1175376128 20:58525155-58525177 GAGATGAACAGCGTCCAGCATGG + Intergenic
1177839736 21:26222469-26222491 GAGGTGATCAGAGCACAGCTTGG + Intergenic
1183394966 22:37566455-37566477 GACATGATCAGCCACCCACTCGG + Exonic
954250381 3:49362834-49362856 GAGATGCTCAGCACCACTCTTGG - Intronic
956749832 3:72336805-72336827 GAGATGAACAGCTCTCCCCTCGG + Intergenic
963586741 3:147201115-147201137 CAGATGATCCGCCCCCAGCTTGG + Intergenic
963911408 3:150820589-150820611 GGGGGGATCAGCCCCCCGCTTGG - Intergenic
965061974 3:163795690-163795712 CAGATGATCTGTGCCACGCTTGG + Intergenic
969511729 4:7621917-7621939 GAGATGATCACTGCCTGGCTTGG + Intronic
971660834 4:29413367-29413389 GAGATCATCAGTGGCCAGCTTGG + Intergenic
985506800 5:286091-286113 GAGAACATCAGCTCCCCCCTGGG - Intronic
1001766169 5:174248896-174248918 CAGATGATCCGCGCCCCCCTCGG - Intergenic
1003601562 6:7522142-7522164 GAGATGTTCACAGCCCCTCTAGG - Intergenic
1015338757 6:132073312-132073334 AAGATGATCAGGGCACAGCTTGG + Intergenic
1021717202 7:23470809-23470831 GTGACCGTCAGCGCCCCGCTTGG - Intergenic
1022093493 7:27123551-27123573 GAGAAGTTCTGCGCTCCGCTGGG + Intronic
1027908396 7:84215421-84215443 TAGATGATCCGCCCCCCCCTTGG + Intronic
1032489686 7:132314816-132314838 GGCATGATCAGAGCCCTGCTGGG - Intronic
1061480079 9:130893501-130893523 GAGAAGACCAGCGGCCCGTTAGG - Exonic
1185631457 X:1518624-1518646 AAGATGATCAGGGCCCAGCAAGG - Intronic
1193164585 X:78265559-78265581 GGGGGGATCAGCGCCCCGCCTGG - Intergenic