ID: 1151310130

View in Genome Browser
Species Human (GRCh38)
Location 17:73287762-73287784
Sequence TGCAGTGGGAAGAGTGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 361}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151310130_1151310135 -8 Left 1151310130 17:73287762-73287784 CCAGACCCACTCTTCCCACTGCA 0: 1
1: 0
2: 2
3: 35
4: 361
Right 1151310135 17:73287777-73287799 CCACTGCAAAACTCAGATGCTGG 0: 1
1: 0
2: 0
3: 19
4: 170
1151310130_1151310136 -7 Left 1151310130 17:73287762-73287784 CCAGACCCACTCTTCCCACTGCA 0: 1
1: 0
2: 2
3: 35
4: 361
Right 1151310136 17:73287778-73287800 CACTGCAAAACTCAGATGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151310130 Original CRISPR TGCAGTGGGAAGAGTGGGTC TGG (reversed) Intronic
900169268 1:1258438-1258460 TGGAGTGGGAAGAGGGGGTGGGG - Intronic
900331361 1:2136277-2136299 TCATGTGGCAAGAGTGGGTCTGG + Intronic
900596679 1:3483202-3483224 TGCAGTGGGAAGAGGGTCTTTGG - Intergenic
900617049 1:3570225-3570247 TGAAGTGGGTTGAGTGGGTGGGG - Intronic
901432187 1:9223136-9223158 TTCTGTGGAAAGAGTGGGTGAGG - Intergenic
902281004 1:15374481-15374503 TGCTGTGGGCAGAATGGGGCGGG - Exonic
902552782 1:17229224-17229246 TGCACAGGGCAGGGTGGGTCAGG - Intronic
903182916 1:21614091-21614113 TGCAGTGGGAGGTGGGGGCCAGG + Intronic
903352681 1:22727426-22727448 TGAAGTGGGCAGGGTGGGACAGG - Intronic
903574378 1:24329294-24329316 TGCAGTGGGAACAGCAGGCCAGG - Intronic
904914022 1:33956786-33956808 TGCTGTGTGAAGAGTGGCTGTGG - Intronic
906211875 1:44016653-44016675 TCCTATGGGAAGAGTGGGTGAGG - Intronic
907115133 1:51961430-51961452 GGCAGTGGAAAGAGTGGGGAAGG + Intronic
907326648 1:53642716-53642738 TGCAGTGGGAAGGGTGTTGCAGG - Intronic
908656223 1:66391850-66391872 TGGAGTGGGAAGATTGCTTCAGG + Intergenic
912378803 1:109235298-109235320 TGCACCGGGATGAGTGGCTCCGG + Exonic
912799034 1:112709858-112709880 TGGAGTGGAAAGAGTGGGGGTGG + Intronic
915828600 1:159104292-159104314 TGCTGTGGGCAGTGTGGGTTTGG - Intronic
916017662 1:160764422-160764444 AGGGGTGGGGAGAGTGGGTCCGG + Intergenic
916490280 1:165296354-165296376 TACAGTGTGAAGAGTGAGGCAGG + Intronic
916498937 1:165369897-165369919 GTCAGCTGGAAGAGTGGGTCTGG - Intergenic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
916875437 1:168963743-168963765 TTTAGTGGGAAGAGTGTGGCAGG - Intergenic
917606378 1:176634440-176634462 TGGAGTGGGAGGAGTGGGGAGGG + Intronic
921749503 1:218776171-218776193 TGCAGTGGGAATTGTGGGAATGG + Intergenic
922467721 1:225855790-225855812 TGCAGTGGGATGGGTGGGGGCGG - Intronic
923387511 1:233479761-233479783 GGCAGAGGGTAGGGTGGGTCTGG + Intergenic
924237788 1:242013599-242013621 TGAGGTGGGAAGAGGGGGTAGGG + Intergenic
924261655 1:242237704-242237726 AGCAGAGGGAATAGGGGGTCTGG - Intronic
924800660 1:247327823-247327845 TACAGTGGAAAGAGAGTGTCTGG - Intronic
1063558802 10:7107283-7107305 TGCAGTAGAAAGAGTGGCTTGGG + Intergenic
1063662847 10:8045819-8045841 TGCAGTGGGAAACGTGTCTCCGG - Intergenic
1064537648 10:16374244-16374266 GGGAGTGGGGAGAGTGAGTCTGG - Intergenic
1064602474 10:17007618-17007640 TCCAGTGGGGAGGGTGGGGCAGG + Intronic
1066228104 10:33404357-33404379 TGCAATGGAAAGAGAGAGTCAGG - Intergenic
1067189048 10:44054488-44054510 AGCTATGGGAAGAGTGGGTCAGG - Intergenic
1067274244 10:44820175-44820197 TGGAGTGGGGAGGGTGGGTGAGG - Intergenic
1068064017 10:52105968-52105990 CTCAGTGGGAAGAGTGGGAGGGG - Intronic
1068774195 10:60853564-60853586 TGCAGTGGGAAGAGAGAGGGAGG + Intergenic
1068971985 10:62968604-62968626 TGCTGTTGGAAGGGTGGGTAAGG - Intergenic
1069621799 10:69841823-69841845 TGCAGTGGGAAGGGAGGATGAGG + Intronic
1069714958 10:70514755-70514777 TGCAGTGGGCAGAGTGCGCCTGG + Intronic
1070833034 10:79431981-79432003 TGGAGTGAGAAGGGAGGGTCGGG - Intronic
1071359494 10:84831914-84831936 TGCTGTGGGCAGAGTGTGTCTGG - Intergenic
1071555636 10:86599335-86599357 TGCAATCTGTAGAGTGGGTCTGG + Intergenic
1073328178 10:102654583-102654605 TGTAGAGGGAAGCATGGGTCAGG + Intronic
1073425581 10:103453714-103453736 TCCAGTGGGAAGAGAAGGCCCGG - Exonic
1074861799 10:117515488-117515510 AGCAGTGGGAAGTGTGGGCTGGG + Intergenic
1075940970 10:126389603-126389625 TGCAGTGGGAAGAGATGGTATGG - Intergenic
1077260768 11:1618793-1618815 TGCTGTGGGGTCAGTGGGTCCGG - Intergenic
1077264111 11:1640626-1640648 TGCAGGGGGAAGAGGGCATCGGG + Intergenic
1078142409 11:8701988-8702010 TGCAGAGAGGAGAGTGGGTGAGG - Intronic
1078558430 11:12350258-12350280 TGCAATGGGAAGGCTGTGTCTGG + Intronic
1079129416 11:17738613-17738635 TCCAGTGGGAGGAGAGGGCCAGG - Intronic
1079256277 11:18834187-18834209 TGCAGTGGGCAAAATGGGTGGGG + Intergenic
1079354430 11:19718051-19718073 TGCACTGGGAAGGGTGGGGGTGG - Intronic
1080794296 11:35549255-35549277 TGGAGTGGGAAGAGGGTTTCAGG - Intergenic
1080848232 11:36045065-36045087 TGGAGTGGCAAGAGGGGGTCAGG - Intronic
1082661739 11:55920426-55920448 TGCAGTGTGGAGAGTGGTTGGGG - Intergenic
1082918236 11:58463123-58463145 TCCAGTGGGAGAAGTGGGACTGG - Intergenic
1083137490 11:60692578-60692600 GGCAGTGGGAGCAGTGGGCCTGG - Intergenic
1083731474 11:64654674-64654696 TGCAGAGGGAACAGTGGACCAGG + Intronic
1084191992 11:67503641-67503663 GGCAGTGAGAAGAGTGGGCCAGG - Intronic
1084887260 11:72218868-72218890 TGGAGTAGGAAGAGTGGCTGAGG + Intronic
1085418803 11:76337980-76338002 TGGAGTGGGAGGAGGGGGGCAGG - Intergenic
1086750669 11:90489969-90489991 GACAATGGGAAGAATGGGTCTGG + Intergenic
1087757237 11:102067262-102067284 TGAAGTGAGAAGATTGAGTCTGG + Intronic
1090073952 11:123567550-123567572 GGAAGGGGGAAAAGTGGGTCAGG + Intronic
1090356902 11:126146553-126146575 TGCAGAGGGATGAGGGGGTGGGG - Intergenic
1090382125 11:126334786-126334808 TGCAGTGGGATGTCTGGATCTGG + Intronic
1090547685 11:127783163-127783185 TGCAGTGGGGAGGGTGGGGAGGG + Intergenic
1091632568 12:2173047-2173069 AGCAGTGGGATGAGTGTGTCCGG + Intronic
1092919783 12:13221222-13221244 TGAATTAGGAAGAGTGGTTCTGG - Intergenic
1093143537 12:15537827-15537849 TCCAGTGGAAGGATTGGGTCTGG + Intronic
1093416368 12:18925370-18925392 TGCAGTGGGAGGAGTGGCGGTGG - Intergenic
1094214160 12:27922885-27922907 TGGAGTGGGGAGAGAGGGTCAGG + Intergenic
1095523741 12:43099701-43099723 TGGAGTGGGAAGATTGGGGTGGG - Intergenic
1096219029 12:49816264-49816286 TGCAGGGGGCAGGGTGGCTCAGG - Intronic
1096670169 12:53193745-53193767 TGCAGTGGGGAGCCTGGGGCTGG + Exonic
1096828613 12:54297934-54297956 GCCAGTGGGCAGAGTGGGTGGGG + Intronic
1096973319 12:55684467-55684489 GGTAGTGGGGAGAGAGGGTCAGG - Exonic
1096975061 12:55695063-55695085 TGGGGTGGGAAGAGAGGCTCAGG - Intronic
1097030105 12:56083720-56083742 AGCAGAGGGAAGAGTGGCTGAGG - Intronic
1100077350 12:90801954-90801976 TTCAGTGTGGAGAGTGAGTCAGG - Intergenic
1101693956 12:107107094-107107116 TGCAGAGGCAAGAATGGCTCTGG - Intergenic
1101781577 12:107843404-107843426 GGCGGCGGGAAGGGTGGGTCTGG - Intergenic
1103190058 12:118993569-118993591 TGCAGTGGGAAGAGTGCATGTGG + Intronic
1103367073 12:120391034-120391056 TGCCATGGGAAGAGGGGGGCAGG - Intergenic
1103772623 12:123339836-123339858 AGAAGTGGGAATAGTAGGTCTGG - Intronic
1104042972 12:125142502-125142524 TGCAGCGGGAACGGTGGGGCTGG + Exonic
1104487396 12:129163446-129163468 TCTAGTGGGAAGAGAGGATCTGG - Intronic
1105759742 13:23503106-23503128 TCCTGTGTGCAGAGTGGGTCTGG + Intergenic
1106917668 13:34532343-34532365 TGAAATGGGATGAGTGGGACAGG + Intergenic
1107035997 13:35903016-35903038 TTCAGTGGGAAGAATGGGGCAGG + Intronic
1107342072 13:39418073-39418095 TGGAGTGGGAAGAGTAGATGTGG - Intronic
1107627793 13:42307654-42307676 TGAAGTGGGAGGAGTGGGCCAGG + Intronic
1107990074 13:45812004-45812026 TGCATCGGGGAGAGTGGGGCTGG - Intronic
1110259564 13:73470267-73470289 CTCAGTGGGAAGAGTGGGAGGGG + Intergenic
1110967053 13:81713276-81713298 TGGAGAGGGAAGAGTGGCACAGG - Intergenic
1112399826 13:99066827-99066849 TGCAGTGAGAATTGTGGGTCAGG - Intronic
1113022996 13:105909394-105909416 TGCAGTGGGAAGATTAGCTCTGG + Intergenic
1113874020 13:113583522-113583544 TGCACTTGGAAGAGCGGGGCCGG - Intergenic
1114899327 14:27037001-27037023 TGCAGTGGCAAGTGGGGGTTAGG + Intergenic
1118149332 14:63172894-63172916 AGGAGTTGGAAGAGTGAGTCAGG + Intergenic
1119228120 14:72959749-72959771 TGATGAGGGCAGAGTGGGTCTGG - Intergenic
1121322922 14:93003052-93003074 CGCAGGGGGAAGAGCGTGTCAGG + Intronic
1121880563 14:97496897-97496919 TGCAGGGTGAGAAGTGGGTCGGG + Intergenic
1122198700 14:100108841-100108863 TGCAGTGGGAATAGCAGGACAGG - Intronic
1122350547 14:101087438-101087460 TGCAGGGGTAAGGGTGGGTGAGG + Intergenic
1123000926 14:105293697-105293719 TGCAGAGAGAAGGGTGGGTGAGG - Intronic
1124254675 15:28131028-28131050 TGCAGTGTGGAGGGTGGGTGGGG - Intronic
1124349400 15:28944068-28944090 TGCAGAGTGGAGAGTGGGCCAGG - Intronic
1125724442 15:41861158-41861180 TGAGGTGGCAAGAATGGGTCAGG + Intronic
1126553659 15:49962389-49962411 TGCATTGGGAAGAATTGGCCTGG - Intronic
1126873029 15:53010012-53010034 TGTAATGGGAAGAGTGGGGTAGG + Intergenic
1126996643 15:54452270-54452292 AGCAGTGGCAGCAGTGGGTCAGG + Intronic
1129409284 15:75339941-75339963 TGCAGAGGGAAGAGGTGGGCAGG - Intronic
1129790173 15:78335898-78335920 TCCAGTGGGAAGTGTGGTTTTGG - Intergenic
1129973674 15:79803102-79803124 TGCAGTGGGTAGAGTGTGGCAGG - Intergenic
1130379109 15:83356746-83356768 GGCAGGAGGAAGCGTGGGTCTGG + Intergenic
1130948211 15:88565317-88565339 GGCAGTGGGAAGAGAGTATCTGG - Intergenic
1131847385 15:96502260-96502282 TCCAGTGGGAAGTGTGTGTGTGG + Intergenic
1132410949 15:101577971-101577993 GGGAGTGAGGAGAGTGGGTCCGG - Intergenic
1132980825 16:2738002-2738024 TACAGAGGGCAGAGTGGGTTGGG - Intergenic
1134616970 16:15659013-15659035 TCCAGAGGGATGAGTGGGTCGGG + Intronic
1134831081 16:17323419-17323441 TGGAGTGGGGAGAGTGGAGCCGG - Intronic
1135486775 16:22872608-22872630 TGCAGTGGGCTGGGTGGGGCTGG - Intronic
1136416081 16:30104677-30104699 TGCAGTGGAACCAGTGGGTCAGG + Intergenic
1136580755 16:31149581-31149603 GGAAGTGGGAAGATAGGGTCGGG - Intronic
1137692785 16:50441107-50441129 TGCAGTGGGAGAAGTGTGGCTGG + Intergenic
1138526850 16:57613675-57613697 AGCCGTGGAAAGAGTGGGCCTGG - Intronic
1139001346 16:62513987-62514009 TGCAGTGCGGAGAGTGAGACAGG - Intergenic
1139660325 16:68416390-68416412 TGTGGAGGGAAGAGTGGGACGGG - Intronic
1140447199 16:75039705-75039727 TCCAGTGGGAAGAGAGGGGTTGG + Intronic
1140690891 16:77482613-77482635 TGCAGTGAGAAAAGTGGTACTGG + Intergenic
1141143662 16:81514235-81514257 TGCAGTTGGAGGGGTGGGGCAGG + Intronic
1141572798 16:84944359-84944381 TGCTGTGGGAAGAATGGGTGGGG - Intergenic
1141675355 16:85514580-85514602 AGCAGGGTGAAGAGTGGGGCTGG - Intergenic
1141919740 16:87127808-87127830 TGGAGTGGCAAGAAAGGGTCTGG - Intronic
1142728440 17:1833362-1833384 GGCAGTGGGAAGAAAGGGACAGG + Intronic
1142862497 17:2771324-2771346 TGCTGGGGGAAGAGTGGGCAGGG - Intergenic
1142962339 17:3558649-3558671 TGAAGTGGGTGGAGTGAGTCAGG + Intergenic
1143139969 17:4736348-4736370 AACAGAGGGAAGAGTGAGTCAGG + Intronic
1143176265 17:4956891-4956913 TACAGCGGGAACAGTGGGCCTGG + Intronic
1143893564 17:10120140-10120162 TGGAGTGGGAAGAGATGGGCGGG - Intronic
1144077577 17:11733122-11733144 TGCAGTGGGAAGCGTGGAGCGGG + Intronic
1144294584 17:13861446-13861468 TGGAGTGGGAGGAGTGGGAAGGG + Intergenic
1144624474 17:16837783-16837805 TGCAGTGGGCAGGGTGGCTGTGG + Intergenic
1144881953 17:18434937-18434959 TGCAGTGGGCAGGGTGGCTGTGG - Intergenic
1145150280 17:20509449-20509471 TGCAGTGGGCAGGGTGGCTGTGG + Intergenic
1145377350 17:22363029-22363051 AGAAGTGGGAAGAGTGAGACAGG - Intergenic
1145831687 17:27921380-27921402 TGCTGTGTGAAGAGGGGGTGGGG - Intergenic
1146162207 17:30566090-30566112 TGCGGTGGGCAGGGTGGGTGTGG + Intergenic
1146657289 17:34642112-34642134 GACAGTGGGAAGCGTGGGGCTGG - Intergenic
1146690442 17:34871415-34871437 TACAGTGGTAAGTGTGGGTATGG - Intergenic
1147233622 17:39039193-39039215 TTTGGTGGGAAGAGTGGGTAGGG + Intergenic
1147550058 17:41435264-41435286 TGCAGTGCTAAATGTGGGTCTGG - Intergenic
1147578609 17:41616504-41616526 TGCATTGGGCAGGGTGGGTGTGG + Intergenic
1148114830 17:45169453-45169475 TCCAGTGGGGAGAGTGAGGCCGG + Exonic
1148362568 17:47024442-47024464 TTTGGTGGGAAGAGTGGGTAGGG + Intronic
1149496621 17:57122378-57122400 TGCAGGGAGAAGGGTGGGTGAGG + Intergenic
1149717682 17:58809478-58809500 TGAAGTGGGAGGATTGAGTCTGG - Intronic
1150004020 17:61458429-61458451 TGCAGGGGATAGAGTGGGTGGGG - Intronic
1150623129 17:66823170-66823192 TGCAGTGGGAAGATTGTAGCTGG + Intergenic
1151310130 17:73287762-73287784 TGCAGTGGGAAGAGTGGGTCTGG - Intronic
1151497942 17:74470492-74470514 TGCAGTGGGCAGAGGTGGTGGGG + Intronic
1151674740 17:75591611-75591633 TGCAGTGGGCACAGTGGCTCAGG + Intergenic
1155232349 18:23785598-23785620 TGCAGAGGGAAGTATAGGTCAGG - Intronic
1155707145 18:28830361-28830383 TGCAGTGGAAAGGGTGGTTTGGG + Intergenic
1158248479 18:55459051-55459073 TTCACTGGGAACAGTGGGTGGGG + Intronic
1158452688 18:57580976-57580998 TGCAGGGGCAAGAGTGGAACTGG + Intronic
1158476453 18:57784217-57784239 TGCAGGGGGAAGCCGGGGTCAGG + Intronic
1158614019 18:58969325-58969347 TCCAGTTGGAAGGGTGGTTCAGG + Intronic
1159494901 18:69190015-69190037 TGCAGTACGAAGTGGGGGTCAGG - Intergenic
1159982640 18:74804081-74804103 TGCAGTGGGAGGATTGGCTGAGG + Intronic
1160179202 18:76619728-76619750 TACTGTGGGAGGAGTGGGTCCGG + Intergenic
1160386312 18:78499071-78499093 TGTAAGGGAAAGAGTGGGTCTGG - Intergenic
1162367275 19:10257111-10257133 TGCTGTGGGAAGTGTGGGTCAGG - Intronic
1162564486 19:11437775-11437797 TGCTGTGTGCAGTGTGGGTCAGG + Intronic
1165720135 19:38073204-38073226 TTCAGTGGGAAGTGTGGCTGTGG + Intronic
1165939482 19:39407984-39408006 TGCAGTGGGCGAAGTGGGTGAGG - Exonic
1166315134 19:41985366-41985388 TGCAGTCGGGAGAGCGAGTCTGG + Exonic
1168085445 19:54042371-54042393 TGGAGGGGGAAGAGCAGGTCAGG + Intronic
926357226 2:12052174-12052196 GGCAGAGGGAAGTGTGGGTTTGG + Intergenic
928094371 2:28394564-28394586 GGCAGAGGGAAGAGGGGGTCGGG + Intronic
928494353 2:31816731-31816753 TGAGGTTGGAAAAGTGGGTCTGG - Intergenic
928927972 2:36597867-36597889 TGCAGGGGGACGAGTGAGTGCGG - Exonic
929457944 2:42079333-42079355 CGCAGTGGTAAGATTGGGGCTGG - Intergenic
930334257 2:50025545-50025567 GGCAGTGGGAAGAGTAAATCAGG + Intronic
932221416 2:70002325-70002347 TGCTGTGGTAAGACTGGGTAAGG + Intergenic
933149986 2:78902585-78902607 AGCAGTGGGAAGAGTGTGGAAGG + Intergenic
934875924 2:97920069-97920091 TGCACTGGGTAGAGTTGGCCAGG - Intronic
934960838 2:98671311-98671333 TGCAATGGGAAGAATGGTTGAGG - Intronic
935126714 2:100230871-100230893 TGCAGTTGGATGAGTGCCTCTGG - Intergenic
935689287 2:105715854-105715876 TGGAGTGGGTTGAGTGGGCCGGG - Intergenic
936710386 2:115124038-115124060 TGCAGTTGGAAGATTGAGCCTGG - Intronic
937065227 2:119012374-119012396 TGGACTAGGAAGAGTGGGACGGG + Intergenic
939148126 2:138441128-138441150 GGCTGTGGGTAGAGTGGGTTTGG - Intergenic
940477160 2:154177651-154177673 TGCAGTAGGAATAGTGGGCTAGG + Intronic
940991561 2:160102574-160102596 GGCAGTGGGAAGGTTGGGTGTGG + Intronic
941043435 2:160648328-160648350 TGCAGTGGGAAGTGAGGTTGAGG - Intergenic
945119068 2:206440355-206440377 ACCAGTGAGAAGACTGGGTCTGG - Intergenic
945291910 2:208135297-208135319 TGGAGGGGGAAGCGTGGGTGGGG - Intergenic
946716231 2:222556966-222556988 TGCAGTGGGGAGGGTGGATGGGG - Intronic
948144231 2:235696446-235696468 TTCAGTGTGAAGGGCGGGTCGGG + Intronic
948356869 2:237385003-237385025 AGCAGGGGGAAGAGTGGTCCAGG - Intronic
948438200 2:237967679-237967701 TGCAGCGGGAAGAGTAAGTATGG + Intronic
948945320 2:241216365-241216387 TGGGGTGGGAACAGAGGGTCGGG + Intronic
949020308 2:241737375-241737397 TGCAGTGGGAGGAGAGGAGCAGG - Intronic
1169066763 20:2698234-2698256 GGCAGTGGGAAGAGGGGATAGGG + Intronic
1169229004 20:3874625-3874647 TGGAGTTGGAAGAGGGGGTGTGG + Exonic
1169512824 20:6283638-6283660 GGCAGTAGGAAGATTGTGTCAGG + Intergenic
1170087480 20:12550873-12550895 TGCAGTGGGAAGGTTGAATCAGG - Intergenic
1170144629 20:13159449-13159471 TGCAGTGGGAATATTGGCTTGGG + Intronic
1170553298 20:17495366-17495388 TGCAGTGGGAACAGGGGCTAGGG - Intronic
1170708448 20:18767190-18767212 TTCAGTAGGAAGAGTTGGCCAGG + Intergenic
1171526145 20:25813075-25813097 AGAAGTGGGAAGAGTGAGCCAGG + Intronic
1171550682 20:26042810-26042832 AGAAGTGGGAAGAGTGAGCCAGG - Intergenic
1172084082 20:32365053-32365075 TACAGGAAGAAGAGTGGGTCTGG + Intronic
1172758983 20:37308653-37308675 TGCAGTGGGAAGTGGGGGACAGG + Intronic
1172777449 20:37415729-37415751 TGCAGTGGAAAGAGTTGGGTGGG - Intergenic
1172984841 20:38976751-38976773 TGCAGAGGGAAGAGGGGAACAGG - Intronic
1174749003 20:53093311-53093333 TGGAGGGGGAAGAGTGGAGCAGG - Intronic
1175185227 20:57175429-57175451 TGCAGAGGGATGAGTGTGTTGGG - Intronic
1175954123 20:62599590-62599612 TGCAGGGTGAACTGTGGGTCTGG + Intergenic
1176701896 21:10063551-10063573 TGTGGTGAGAAGAGTGGGTGGGG - Intergenic
1176916504 21:14632126-14632148 TTCAGTGGAGAGAGTGGTTCTGG + Intronic
1177313936 21:19432078-19432100 AGCTGTGGGAAGAGAGGCTCAGG - Intergenic
1178109288 21:29354414-29354436 TGGAGTGGGAAGAGTGGAATGGG + Intronic
1179435923 21:41362049-41362071 TGCAGCGGTAAGAGCGGGGCCGG + Exonic
1179944878 21:44666413-44666435 TGCACTGGGAGCAGCGGGTCTGG + Exonic
1179946522 21:44681800-44681822 TGCACTGGGAGCAGCGGGTCTGG + Exonic
1180671046 22:17553346-17553368 TAAAGTGGGAAGGGTGGGTGGGG + Exonic
1180723959 22:17930843-17930865 CGCAGTGTGGAGAGTGGGGCAGG - Intronic
1182281622 22:29220718-29220740 TGCAGTGGGACGAGGGGGGCTGG - Intronic
1183408006 22:37639864-37639886 TGCCGGGGTAAGAGTGGGGCTGG - Intronic
1184184290 22:42854069-42854091 TGGAGCGGGAAGAGTGGCTCTGG - Intronic
1184189255 22:42884101-42884123 TGGAGTTGGCAGAGTGGGCCCGG + Intronic
1184876571 22:47279582-47279604 TGCAGTGGGCAGTGGGCGTCTGG + Intergenic
950813601 3:15674438-15674460 TGCTGTGGGGAGAGTAGGTCTGG + Intronic
950824486 3:15803048-15803070 TGCAGTTGGAGAAGTGGGTATGG + Intronic
952553200 3:34502283-34502305 TTCAGAGTGGAGAGTGGGTCAGG + Intergenic
953170787 3:40505674-40505696 TGCAGTGGGAAAAGTGGGTGTGG - Intergenic
953822674 3:46221950-46221972 AGCAGTGGCAAGAGAGGGGCTGG - Intronic
953970487 3:47343531-47343553 TGCAGTGGGGAGAGAGGCACAGG - Intronic
954137033 3:48586640-48586662 TTCAGTGGGAACAGTGGGGAGGG + Exonic
954139464 3:48597370-48597392 TACAGTGGGATGTGTGGGGCTGG - Intergenic
954160627 3:48719049-48719071 TGCTGGGGGCAGAGTGGGGCAGG - Intronic
954451048 3:50571922-50571944 AGGAGTGGCAAGAGTGGGGCCGG + Intronic
954756783 3:52844910-52844932 TGCAGTGTGGAGCCTGGGTCGGG - Exonic
954798125 3:53171902-53171924 AGCTGTGGGAAGAATGGGTAGGG + Intronic
955543295 3:60000835-60000857 AGAAGTGGGAAGAGTGGGCGGGG - Intronic
955896949 3:63710477-63710499 TGCAGTGGGAAATGTGGCACTGG + Intergenic
956809659 3:72852472-72852494 TGAAGTGGGAAGAGTGCTTGAGG - Intronic
957653215 3:83035679-83035701 TGCAGAGGTAAGAGTGATTCTGG + Intergenic
959563713 3:107813006-107813028 TGCAGTGGGAATAGTGTGGGAGG - Intergenic
960326652 3:116304546-116304568 TGAGCTGGGAAGCGTGGGTCAGG + Intronic
961369770 3:126422300-126422322 TGCAGTGTGAGGCGTGGGTCTGG + Intronic
961403441 3:126663150-126663172 TGCAGTGGGCACACTGGGGCTGG - Intergenic
961657472 3:128451263-128451285 GGCAGTGGGAACAGTGGTGCGGG + Intergenic
963466020 3:145684551-145684573 TGCGTTGCGAAGGGTGGGTCCGG - Intergenic
966296243 3:178427307-178427329 AGCAGTGGCAGCAGTGGGTCAGG + Intronic
967871155 3:194230689-194230711 TGCAGAGGGAGGAATGGGTATGG + Intergenic
967959980 3:194912717-194912739 AGCAGTGGGAAGAGCTGTTCAGG - Intergenic
968963470 4:3757629-3757651 TGCAGGGTGGAGAGTGGCTCAGG + Intergenic
969315926 4:6381275-6381297 TGCAGAGGGAAGAGGAGGGCAGG - Intronic
970721304 4:18992547-18992569 TGCACTGGGAGGAGTGCGTACGG + Intergenic
972773383 4:42219090-42219112 TGCAGTGGCAAGAGATGGTTTGG - Intergenic
973884976 4:55311798-55311820 TGCAGTGGGAAGAGGGTATCTGG - Intergenic
973976326 4:56266441-56266463 GGCAGTGGGAAGAAGGGGACAGG - Intronic
974866841 4:67591603-67591625 AGTAGTGGGAAGATTGAGTCAGG + Intronic
975386932 4:73769043-73769065 TGGAGGGGCAAGAGTGGGACTGG - Intergenic
975991496 4:80263962-80263984 TGCAGTGGGGAATGTGGGGCGGG - Intergenic
978923707 4:114217348-114217370 TGCAGTGGGCAGTGGGGGTTGGG - Intergenic
979466867 4:121049439-121049461 TCCTGTGGGAAGTGGGGGTCAGG + Intronic
981658943 4:147144075-147144097 GGCTGTGGGAAGAGTGGGGTTGG + Intergenic
981750949 4:148091905-148091927 TGCAGTGGGAATAGTAGTTTGGG - Intronic
981952112 4:150422534-150422556 TGCAGAGGATAGTGTGGGTCAGG - Intronic
982210759 4:153033628-153033650 TGAATGGGGAAGAGAGGGTCAGG - Intergenic
982313627 4:154010107-154010129 TGATCTGGGAAGAGTGGGTGGGG - Intergenic
983013009 4:162572809-162572831 TGAAGTGGGAAAACGGGGTCAGG + Intergenic
983654759 4:170071657-170071679 TGCTGTGTGAAGAGTGTGACTGG + Intronic
986336287 5:6758340-6758362 TGCGGTGGGCAGGGTGGGGCTGG + Intergenic
986505121 5:8441689-8441711 TGAAGTGAGAAGAGTGGGAGGGG + Intergenic
987470287 5:18319658-18319680 TGCATTGGGACGAGTGGTTTCGG - Intergenic
990396527 5:55385553-55385575 TGAAGTGGGAAGAGTGAGGAAGG + Intronic
991090603 5:62690546-62690568 TGCTGGGGGAAGAGTGGGGCAGG - Intergenic
992488337 5:77216847-77216869 AGCAGGGTGGAGAGTGGGTCTGG + Intronic
992700186 5:79334166-79334188 TGCAGTGGGAAGGGAGGGCATGG - Intergenic
993048355 5:82894979-82895001 AGCAGAGGGATGAGTGGGTGGGG - Intergenic
997588720 5:135060148-135060170 AACAGAGGGATGAGTGGGTCTGG + Intronic
997878838 5:137572121-137572143 TGCAGCGGGAAGAGAGGCTGTGG - Intronic
998369636 5:141652478-141652500 TGCTGTGTGAACAGTGGGTTGGG - Intergenic
999047938 5:148489810-148489832 TGCAGTGGGCAGAGAGGGAAGGG - Intronic
999114290 5:149148875-149148897 TGAAGTGTGAAGTGTGGGGCTGG - Intronic
999244876 5:150148779-150148801 TCCAGTGGGGAGAGCGGGTATGG + Intronic
999280431 5:150361769-150361791 TGCAGTGGGTAGAGAGTGGCAGG + Intronic
999399448 5:151253199-151253221 TGCATCGGGAAGGGTGGGTCAGG - Exonic
999978851 5:156939563-156939585 GGCAGTTGAAAGTGTGGGTCTGG - Intronic
1001118540 5:168959654-168959676 TGACGTGGGAAGAGGGCGTCTGG + Intronic
1001763695 5:174227865-174227887 AGGAGTGGGAAGAGAGGGCCGGG + Intronic
1002833705 6:847362-847384 TGCAGTGGAGACAGTGGGACTGG + Intergenic
1004476413 6:15977311-15977333 TGGAGTGGGGAGGGTGGGCCTGG + Intergenic
1004903964 6:20219220-20219242 TGGAGTGGGAGGAGTGGGGATGG + Intergenic
1011610821 6:89148272-89148294 TGAAGTTAGAAGAGTGGGCCGGG - Intronic
1012029683 6:94042603-94042625 TGGAGAGGGAAGAATGGGTTTGG - Intergenic
1012545110 6:100410642-100410664 TGGAGTGGGTAGAGTGAGGCAGG + Intronic
1012839914 6:104316981-104317003 TGCTGTGGGAGGACTTGGTCAGG - Intergenic
1014433252 6:121393893-121393915 TGCAGTTGGAAGACTGGGTTTGG - Intergenic
1015541316 6:134317172-134317194 TGCATTGGGAGGAGGGGGTTGGG - Intronic
1017770922 6:157644115-157644137 GCCAGTGGGAAGACTGAGTCAGG - Intronic
1018698199 6:166406783-166406805 TGCATTGGGAAGTGGGAGTCAGG + Intergenic
1018931859 6:168245245-168245267 TACAGTGGCAAGAGTGGGGATGG - Intergenic
1019319676 7:409889-409911 GGGAGTGGGATGAGTGGGCCGGG - Intergenic
1019567472 7:1691600-1691622 GGCTGTGGGAGCAGTGGGTCGGG - Intronic
1021944853 7:25716601-25716623 TTCAGTGGGTAAAGTAGGTCAGG - Intergenic
1022325321 7:29325676-29325698 TGCAGTTGCAGGAGTGGGTGTGG + Intronic
1022333736 7:29403307-29403329 TTCACTGAGAAGAGTGGGTGGGG + Intronic
1022938654 7:35208445-35208467 AGCAGTGGTAAGAATGGGCCAGG + Intronic
1023749894 7:43362394-43362416 CGCAGTGGGAAGAGAGGGAGAGG + Intronic
1023985038 7:45089179-45089201 TGCTGTGGAAAGGGTGGGACCGG - Intergenic
1024509868 7:50195596-50195618 TGCAGGTGGAGGTGTGGGTCTGG + Intergenic
1024574339 7:50752047-50752069 TGCGCTGGGAAGCTTGGGTCAGG - Intronic
1024735791 7:52303002-52303024 TGCAGTGGGAAGGGTGGTGGTGG + Intergenic
1024916742 7:54509798-54509820 TGGTGTGGGAAGAGTGGGGGCGG - Intergenic
1025299531 7:57807063-57807085 AGAAGTGGGAAGAGTGAGCCAGG - Intergenic
1025807553 7:64849620-64849642 TGCAGTGGGAAGTGGGGGTGTGG + Intergenic
1026689403 7:72539061-72539083 GACACTGGGAAGAGTGGGACAGG + Intergenic
1026896956 7:74014835-74014857 TGTAGTGGGAAGGGGGTGTCTGG + Intergenic
1026994393 7:74606248-74606270 TGGAGTGGAAAAAGTGGGCCCGG - Intergenic
1027539183 7:79446166-79446188 TGCAGTGGGAGGAGGGGGGAGGG + Intronic
1027950074 7:84804131-84804153 TCCTGTGGGAGGAGTGGGCCTGG + Intergenic
1028101289 7:86823960-86823982 TGCAGTGGGGAGAGAGAGCCTGG + Intronic
1029792483 7:102859590-102859612 TGGAGTGGGAAGAGTGGAGTGGG + Intronic
1031083272 7:117278482-117278504 GGCTGTAGGAAGAGAGGGTCAGG - Intronic
1031594453 7:123632587-123632609 CTCAGGGGGAAGGGTGGGTCAGG - Intronic
1031983638 7:128148004-128148026 TGCAGTGGGATGGGTGGGAGAGG + Intergenic
1032706422 7:134424158-134424180 TGCAGTGGGCAGATTAGATCAGG + Intergenic
1032710193 7:134454499-134454521 TGCAGAGGGAAGAGAGGGAGGGG - Intronic
1034761404 7:153675336-153675358 TGCTGTGTGAACAGGGGGTCTGG - Intergenic
1035389973 7:158497299-158497321 TGCAGTGGGCAGGGTGGGGCTGG - Intronic
1035459837 7:159031871-159031893 TGCAATGAGAAGAGATGGTCAGG + Intronic
1035695318 8:1591524-1591546 TGGAGTGGGAGGAGGGGGTTAGG - Intronic
1036149266 8:6283061-6283083 TTCAGTGGGGAGAGAGGGTGAGG - Intergenic
1036638166 8:10565433-10565455 GGGAGTGGGAAGAGTGGGGTGGG - Intergenic
1037506244 8:19532497-19532519 TGGAGTGGGAAGACTGGTTAGGG - Intronic
1037682683 8:21110562-21110584 TGCTGTGGGAATACTGGGCCTGG + Intergenic
1038366744 8:26943788-26943810 TGGGGTGGGAAGAGTGGGAGTGG - Intergenic
1039101998 8:33951101-33951123 AGCAGTGGGAATGGTGGGCCAGG + Intergenic
1043485965 8:80699831-80699853 TCCAGTGGGCAGAGTGGGTGGGG - Intronic
1045913884 8:107443289-107443311 TGCAGTGGAAAGATTGTGACCGG + Intronic
1046178580 8:110611618-110611640 TGATGTAGGAAGAGTGGGTGAGG + Intergenic
1047868062 8:129051064-129051086 TGATCTGGGAAGAGTGGGCCAGG + Intergenic
1048122229 8:131594853-131594875 TGGAGTGGGGAGAGTGGGGAGGG - Intergenic
1048841898 8:138573987-138574009 TGCTGTGTGAAAACTGGGTCAGG + Intergenic
1048852819 8:138660527-138660549 GGGTGTGGGTAGAGTGGGTCAGG - Intronic
1049163302 8:141111407-141111429 TGCTGTGGGAGGAGGGGCTCAGG - Intergenic
1049323564 8:142010268-142010290 TGCTGTGGGAAGAGGAGGACAGG + Intergenic
1049441617 8:142612315-142612337 GGCATTGGGGAGAGTGGGCCGGG - Intronic
1050459646 9:5866756-5866778 AGCTGTGGGAAGAGAGGGTGGGG + Intergenic
1053010499 9:34630212-34630234 AGCAGTGGGCTGAGGGGGTCTGG - Intergenic
1053045440 9:34912219-34912241 TGAAGTAGGAAGAGTGTGTGTGG + Intergenic
1053199224 9:36141526-36141548 TGGAGAGGGCAGAGTGAGTCAGG + Intronic
1053794050 9:41708965-41708987 AGAAGTGGGAAGAGTGAGCCAGG + Intergenic
1054151121 9:61605862-61605884 AGAAGTGGGAAGAGTGAGCCAGG - Intergenic
1054182460 9:61921004-61921026 AGAAGTGGGAAGAGTGAGCCAGG + Intergenic
1054470900 9:65536974-65536996 AGAAGTGGGAAGAGTGAGCCAGG - Intergenic
1054656049 9:67667475-67667497 AGAAGTGGGAAGAGTGAGCCAGG - Intergenic
1057545688 9:96019416-96019438 GGCAGTGGGAAGAGAGGGCAGGG - Intergenic
1057878532 9:98775922-98775944 AGCCGTGGGCAGATTGGGTCAGG + Intronic
1058594515 9:106601201-106601223 AGCAGTGGGAGGACTGGGTTGGG + Intergenic
1058961648 9:109997788-109997810 TGGAGTGGGGAGGGTGGGACGGG + Intronic
1059691956 9:116693963-116693985 GGAAGTGGGAAAAGTGGTTCTGG + Intronic
1060672936 9:125486331-125486353 TGCAGGGGGTAGAATGGGTTGGG + Intronic
1060706375 9:125805395-125805417 TGCAGTGGGAAGCGTGTGAAGGG + Intronic
1061609247 9:131735400-131735422 TGCAGTGGGGAGGGATGGTCAGG - Intronic
1062186568 9:135221591-135221613 TCCAGTGGGGACAGTGGGTCTGG + Intergenic
1062541600 9:137044074-137044096 TGCAGTGTGCAGTGTGGGGCTGG - Intronic
1062547329 9:137069650-137069672 TGCTGTGGCAGGAGAGGGTCTGG + Intronic
1188987832 X:36783783-36783805 TGCAGTGGTATAAGTGGGCCAGG + Intergenic
1189466836 X:41283982-41284004 TGCAGTTGGAAAGGTGGGCCTGG - Intergenic
1190061581 X:47215057-47215079 GGCAGTGGCAAGAGGGGTTCAGG - Exonic
1191943644 X:66505404-66505426 TGGAGTGGTTACAGTGGGTCTGG + Intergenic
1192148150 X:68695243-68695265 CGCAGTGGGAAGAGTGTGATGGG + Intronic
1192338038 X:70238282-70238304 TGTAGTGGGAGGTGTGGGTGAGG + Exonic
1192709743 X:73567432-73567454 AGCAGTGGGAAGTGTGAGTGGGG - Intronic
1193895119 X:87104400-87104422 TTGAGTGGGAAGAGTGGGAATGG - Intergenic
1194038066 X:88904187-88904209 TGCAGGGGGAAGAGTGGCAGGGG - Intergenic
1194456511 X:94110113-94110135 TGTAGGAGGAACAGTGGGTCTGG - Intergenic
1195960262 X:110378804-110378826 AGCAGTGGGCAGCGGGGGTCGGG - Intronic
1196784213 X:119407993-119408015 TGCACGGGGAAGACTGGGGCAGG - Intronic
1197203895 X:123773143-123773165 TTCAGGAGGAAGAGTGTGTCAGG + Intergenic
1197711732 X:129676479-129676501 TACAGGAGGAGGAGTGGGTCTGG - Intergenic
1198079450 X:133225399-133225421 TGAGGTGGGAAGGGTGGGTGTGG + Intergenic
1199459745 X:148071525-148071547 TGCAGTGGCATCATTGGGTCTGG + Intergenic
1199590959 X:149468130-149468152 TCCTGTGAGAAGAGTGGCTCAGG + Intergenic
1199985746 X:152948910-152948932 TGAAGTGGGCAGAGTGGAGCAGG + Intronic
1199996027 X:153027460-153027482 TGCATTGGAAAGAGTGTGTACGG - Intergenic
1200104789 X:153706205-153706227 TGCAGTGGGAGGAGTATGCCCGG - Intronic