ID: 1151310825

View in Genome Browser
Species Human (GRCh38)
Location 17:73291554-73291576
Sequence CTATGGTTTGGGAGGCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151310813_1151310825 6 Left 1151310813 17:73291525-73291547 CCAGAGGCCTGGGCAGGTCCTGG 0: 1
1: 0
2: 5
3: 77
4: 550
Right 1151310825 17:73291554-73291576 CTATGGTTTGGGAGGCCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 172
1151310818_1151310825 -1 Left 1151310818 17:73291532-73291554 CCTGGGCAGGTCCTGGGGGCAGC 0: 1
1: 0
2: 7
3: 69
4: 610
Right 1151310825 17:73291554-73291576 CTATGGTTTGGGAGGCCACAGGG 0: 1
1: 0
2: 1
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151310825 Original CRISPR CTATGGTTTGGGAGGCCACA GGG Intronic
900847286 1:5114062-5114084 ACATGGCTGGGGAGGCCACATGG + Intergenic
900897627 1:5494795-5494817 CTCTGGGTTGGGAGGCCACACGG - Intergenic
905412318 1:37779166-37779188 TGAAGGCTTGGGAGGCCACAAGG - Intergenic
906326742 1:44850905-44850927 CTGTGGCTTTGGAGGCCAAAAGG + Exonic
906533630 1:46539002-46539024 CTCTGGTTAGGGAGGCCTCATGG + Intergenic
906676356 1:47696507-47696529 CTTTGGCTTGGCAGGCCATAAGG + Intergenic
908059221 1:60328913-60328935 AGAGGGTTTGGGAGCCCACAGGG - Intergenic
908559662 1:65292954-65292976 CTGTAGGATGGGAGGCCACATGG - Intronic
909933101 1:81520691-81520713 GCATGGTTGGGGAGGCCTCAGGG - Intronic
910970892 1:92854719-92854741 CTCAAGTTTGGGAGGCCACTTGG + Intronic
914866113 1:151430680-151430702 ATATTGGTTGTGAGGCCACAGGG + Exonic
915643692 1:157251375-157251397 ATATGTTGTGGGAGGCCACGAGG - Intergenic
916758012 1:167791657-167791679 TTTTGGTGTGAGAGGCCACAGGG - Exonic
917248218 1:173027747-173027769 ACATGGCTTGGGAGGCCTCAGGG - Intergenic
917542951 1:175933269-175933291 CAACACTTTGGGAGGCCACAGGG - Intergenic
920845299 1:209588566-209588588 CTTTGGGTAGGTAGGCCACATGG + Intronic
923238711 1:232059954-232059976 TGATGCTTTGGGAGGACACAGGG + Intergenic
1065128643 10:22598548-22598570 GTCTGGTTTGAGAGGTCACAGGG - Intronic
1066258485 10:33705147-33705169 CTATGGTTTGGCAAGCTAGATGG - Intergenic
1066681086 10:37937516-37937538 CTATAGGTGGAGAGGCCACAGGG - Intergenic
1066707731 10:38199929-38199951 CTATGGTTTGGTAGACCAACTGG - Intergenic
1066981974 10:42424779-42424801 CTATGGTTTGGTAGACCAACTGG + Intergenic
1069546499 10:69333075-69333097 GTATGGTATGTGAGGCCAGAAGG + Intronic
1073356662 10:102860435-102860457 ATATGGTTTGTGTGGCCACAGGG + Intronic
1074057805 10:109938469-109938491 CTAGGGTGTGGGAGGCAGCATGG - Intergenic
1074489488 10:113926570-113926592 CTGTGCTCTGGGAGGCCACAAGG - Intergenic
1077461454 11:2712801-2712823 CTCTGGGTTGGGAGCACACATGG + Intronic
1084036720 11:66515751-66515773 CCAGGGTTTGGGAGGCTCCAGGG + Intronic
1088154798 11:106790258-106790280 CTATGGTGGTGGTGGCCACAGGG - Intronic
1090741611 11:129667048-129667070 CTTTGGTCTGTGGGGCCACAGGG + Intergenic
1091309446 11:134562209-134562231 CTAGGGTTGATGAGGCCACAGGG + Intergenic
1091505601 12:1064639-1064661 CAATGCTTTGGGAGGCCAGGCGG - Intronic
1091889279 12:4040188-4040210 CTGTGGTTTGGCAGGATACAGGG - Intergenic
1093640906 12:21526334-21526356 GTAGAGTTTGGGAGTCCACAGGG - Exonic
1095992495 12:48045875-48045897 CTTTGGTCTGAGAGACCACATGG + Intronic
1097333451 12:58356716-58356738 CTATGGTTAGGGATTCCACAGGG + Intergenic
1098998499 12:77149393-77149415 CCATTGTTTGGGAGTACACAAGG + Intergenic
1099016022 12:77345249-77345271 CTCTGGATGTGGAGGCCACATGG + Intergenic
1102413284 12:112738816-112738838 CTTTGGTTTGGAAGGCAAAAGGG - Intronic
1109336643 13:61003252-61003274 CTATGGTAGTGGTGGCCACAAGG - Intergenic
1112299793 13:98219579-98219601 CAATACTTTGGGAGGCCAAACGG - Intronic
1112659498 13:101491481-101491503 TTACAATTTGGGAGGCCACAGGG - Intronic
1113905966 13:113819320-113819342 CTGTGGCTTTGAAGGCCACAGGG - Intergenic
1114487504 14:23071657-23071679 TTATCCTTTGGCAGGCCACAGGG + Intronic
1114805318 14:25828675-25828697 ATATATTTTGTGAGGCCACATGG + Intergenic
1115011212 14:28547394-28547416 CAATAGTTTGGGAGGAGACAGGG - Intergenic
1119941046 14:78641932-78641954 CTTTTATGTGGGAGGCCACAGGG - Intronic
1126753188 15:51898218-51898240 CCCTGATTTGGGAGTCCACATGG - Intronic
1126934935 15:53696337-53696359 CTAGGGTTTTGGAGTTCACAGGG - Intronic
1132469124 16:92136-92158 CCATGGTTCAGGTGGCCACAGGG - Intronic
1134281624 16:12821958-12821980 GAATGGTTGGGGAGGCCTCAGGG + Intergenic
1136275613 16:29177740-29177762 GCATGGCCTGGGAGGCCACAGGG - Intergenic
1137042354 16:35624753-35624775 CTTTTGTTTGGGAGGCCATCAGG - Intergenic
1137249868 16:46733559-46733581 CTAGGGTTTGTGAGCCCAGATGG + Intronic
1138294683 16:55876168-55876190 CTGAGCTTTGGGAAGCCACAGGG - Intronic
1138537561 16:57668036-57668058 CTAGGGGCTGGGTGGCCACAGGG - Intergenic
1139144334 16:64306690-64306712 CTCTGGTTTAGGAGACAACAGGG + Intergenic
1139642231 16:68300347-68300369 CTATGGTTTGGAAAGGCATACGG + Exonic
1141227317 16:82130181-82130203 CTGTGGTGGCGGAGGCCACAGGG - Intergenic
1142441658 16:90102370-90102392 TTTTTGTTTGCGAGGCCACAGGG - Intergenic
1143058593 17:4180930-4180952 CTATGGCTGGGGAGACCAGATGG - Intronic
1143477438 17:7210977-7210999 CTCAGGATTGGGAGGCAACATGG + Intronic
1143588376 17:7864085-7864107 CTAAGTTTAGGGAGGCCACATGG + Intronic
1143751673 17:9032688-9032710 CTTTGGGTTGGGCGGCCCCAGGG + Intronic
1145064863 17:19755514-19755536 CACTGGTTTTGGTGGCCACAGGG + Intergenic
1145747763 17:27332811-27332833 CCTTGGCTTGGCAGGCCACAGGG - Intergenic
1149156429 17:53635635-53635657 CTATGGGTTGGGAGGTCATGAGG - Intergenic
1149980684 17:61308993-61309015 CTCTGCTGGGGGAGGCCACATGG - Intronic
1151310825 17:73291554-73291576 CTATGGTTTGGGAGGCCACAGGG + Intronic
1151686905 17:75652799-75652821 CTTTGGTTTGGAAAGCCCCAGGG - Intronic
1153103753 18:1504101-1504123 CTTTGGTATGCGAAGCCACAGGG + Intergenic
1153951157 18:10058930-10058952 TTCAGGTTTGGGAGGCCACCAGG - Intergenic
1153993574 18:10420930-10420952 CTATTGTTGAGGAGGTCACAAGG - Intergenic
1156170671 18:34481358-34481380 CAATGCTTTGGGAGGCCAAGAGG + Intergenic
1159998010 18:74985815-74985837 CTAAGGTTAGGAAGGCCACGGGG - Intronic
1160295117 18:77630527-77630549 ATAAGGTTTGGGAGGGCCCAGGG - Intergenic
1160307422 18:77753204-77753226 TTAGGGTTAGGGTGGCCACAAGG - Intergenic
1162740399 19:12770649-12770671 TTGTGTTTTGGGGGGCCACAGGG + Intronic
1164008692 19:21176944-21176966 CAGTGCTTTGGGAGGCCAAAGGG - Intronic
1166295092 19:41885043-41885065 CCATGGGTTGGGGGGCCACATGG - Intronic
926392101 2:12403838-12403860 CCATGGCTGGGGAGGCCTCATGG - Intergenic
926445874 2:12942370-12942392 CCATGGCTGGGGAGGCCTCATGG + Intergenic
931777129 2:65550422-65550444 CTATGGAGTGGGAGGCTACCCGG - Intergenic
933746752 2:85577439-85577461 CTCTTGTTTGGGAAGCCACTGGG + Intronic
934144027 2:89074361-89074383 ATATGGCTGGGGAGGCCTCACGG - Intergenic
934225217 2:90126197-90126219 ATATGGCTGGGGAGGCCTCACGG + Intergenic
935390486 2:102547039-102547061 CTCTGGTTTCTGAGGCTACACGG + Intergenic
936006194 2:108891510-108891532 CTAGGGATTGGGATGCCAAATGG + Intergenic
938979430 2:136511779-136511801 CTATTGTTTGGGAAGTCACCTGG + Intergenic
939436316 2:142181923-142181945 ATATGGCTTGGGAGGCCAAGGGG - Intergenic
939754511 2:146093527-146093549 TTAAGATTTGGGAGGGCACAGGG - Intergenic
940503735 2:154527148-154527170 CTACGGTGGGGGTGGCCACAGGG - Intergenic
940753809 2:157658987-157659009 TTTTGGTTTTGTAGGCCACAGGG + Intergenic
942506302 2:176645030-176645052 CTGTGGTTGGGGAGGCCAGTTGG + Intergenic
946200212 2:218067260-218067282 ATATGGATTGGGAGGGCAGAAGG - Intronic
946677071 2:222171434-222171456 GCATGGCTTGGGAGGCCTCAGGG - Intergenic
948530827 2:238602869-238602891 CTTTGGTTTGGGCCTCCACAAGG - Intergenic
948656080 2:239477257-239477279 GTTTGGTTTGGAAGGCAACAGGG + Intergenic
1169361654 20:4955000-4955022 CATTGTTTTGGGAGGCCAGAAGG + Intronic
1170299992 20:14872824-14872846 GTATGGCTGGGGAGGCCTCAGGG + Intronic
1172920126 20:38473778-38473800 TTTTGGTCTGGGATGCCACATGG - Intronic
1174078566 20:47955140-47955162 CTTTGGTTTAGGGGCCCACAGGG - Intergenic
1174097472 20:48100717-48100739 CTATGATTTGGGAGGGAATATGG + Intergenic
1174477503 20:50806613-50806635 CTAGAGGTTGAGAGGCCACATGG - Intronic
1175182082 20:57155786-57155808 CCATGGTGTGAGAGGCCCCAGGG + Intergenic
1175444142 20:59008558-59008580 CTATAGTCAGGGAGGCCAGAGGG - Intergenic
1176372628 21:6071599-6071621 CTATGGTTGCAGAGGCCACAAGG - Intergenic
1179750848 21:43466646-43466668 CTATGGTTGCAGAGGCCACAAGG + Intergenic
1182517120 22:30865198-30865220 CTCTGGCTGAGGAGGCCACAGGG - Intronic
1182938332 22:34248519-34248541 CTATGGTTAGCAAGGTCACAAGG + Intergenic
1183649059 22:39144068-39144090 CTAGGGATTGGGAGGCGGCAGGG - Intronic
1184240600 22:43209625-43209647 CTGAGGTTTGGGGGACCACACGG - Intronic
1184677155 22:46050013-46050035 CCATGGTTTGGCAGGACAAAGGG - Exonic
1185191800 22:49442383-49442405 CAACATTTTGGGAGGCCACAGGG - Intronic
950174819 3:10865680-10865702 CCATGTCTTGGGAAGCCACAGGG - Intronic
952266680 3:31794000-31794022 TTGTGGTTTGAGAGGCCCCAGGG + Intronic
954320779 3:49830767-49830789 TTATGGCTTGAGAAGCCACAGGG - Intronic
954693552 3:52408768-52408790 CTTTGGTGTGTGAGGGCACAAGG - Intronic
954884699 3:53862254-53862276 CTCTAGATTGGGAGGCCATAAGG + Intronic
955405201 3:58621497-58621519 CCATGGTTGGGGAGGGCACTGGG + Intronic
959368406 3:105492058-105492080 GTATGGCTGGGGAGGCCTCAGGG + Intronic
960087589 3:113607536-113607558 GCATGGCCTGGGAGGCCACAGGG - Intronic
960494241 3:118355643-118355665 CTAAGGTTTGGGAGGGCAAATGG + Intergenic
961237419 3:125379161-125379183 CTATGGTTTAGAGGGGCACAAGG + Intergenic
961237568 3:125380725-125380747 CTGTGGTTTGGAGGGACACAGGG + Intergenic
963331951 3:143924450-143924472 CTATGGTGGGAGAGGCCAAATGG - Intergenic
963969447 3:151413538-151413560 CAAAGGTTTGGGAGGGCAGACGG + Intronic
965483410 3:169248323-169248345 CTTTGCTTTAGGAGGACACAAGG - Intronic
966627683 3:182036324-182036346 ATATTGGTTTGGAGGCCACATGG - Intergenic
968361914 3:198153337-198153359 TTTTTGTTTGCGAGGCCACAGGG - Intergenic
968440424 4:621175-621197 CCGTGGTTTGGGAAGCCACATGG - Intergenic
969613300 4:8238650-8238672 CTGGGACTTGGGAGGCCACAGGG - Intronic
969986970 4:11222504-11222526 TTATGGGATGGGAGGACACATGG + Intergenic
970341320 4:15110165-15110187 CAATTGTGTGGGAGGCCACAAGG + Intergenic
975467958 4:74731602-74731624 CTAGGCTTGGGGAGGCCTCATGG - Intergenic
979703584 4:123694638-123694660 GCATGGCTTGGGAGGCCTCAGGG + Intergenic
988105622 5:26742753-26742775 CTATGGTTTGGGAGGGCATTAGG - Intergenic
988832972 5:35005147-35005169 ATATGATTTGAGAGGCCAGAGGG + Intronic
998513526 5:142733308-142733330 CTGGAGGTTGGGAGGCCACATGG - Intergenic
1000195610 5:158954679-158954701 CTGAGGTCAGGGAGGCCACAGGG - Intronic
1003501889 6:6710053-6710075 TTATGGTTTGAAAAGCCACACGG - Intergenic
1004989887 6:21125337-21125359 TTATGGCTGGGGAGGCCTCAGGG - Intronic
1006046873 6:31306257-31306279 CTATGGTGTGGGGGGCAACCAGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1010296656 6:74206579-74206601 CTATGGTTTTGGTGGCCCCCTGG + Intergenic
1010525301 6:76894050-76894072 CTATGCCTTGGAAAGCCACAGGG - Intergenic
1015613528 6:135051308-135051330 CTTTGGTTTTAGAGGGCACATGG - Intronic
1015658341 6:135545307-135545329 TTATGGCTTTGCAGGCCACATGG - Intergenic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1017527556 6:155255118-155255140 CTATGGTTGGGCAGAACACAAGG - Intronic
1018447825 6:163874477-163874499 CCATGGGTGGGGAGGCCTCAAGG + Intergenic
1018523425 6:164679189-164679211 CCATGGCTGGGGAGGCCTCAGGG + Intergenic
1018883125 6:167904893-167904915 ATATGGGTTGGGAAGCCACCAGG - Intronic
1019002997 6:168771006-168771028 CTATGGTGGGAGAGGCCAAATGG + Intergenic
1019649200 7:2147512-2147534 CGCTGGTCTGGGAGGCCAAAGGG - Intronic
1020427788 7:8089568-8089590 ATATGGTCTGGTAGGCCATATGG + Intronic
1022414216 7:30164277-30164299 CTCTGATTTGGCAGGGCACAGGG - Intergenic
1026302713 7:69111786-69111808 CTATGGCTGGGGAGGCCTCAGGG + Intergenic
1027363596 7:77434139-77434161 CTATGGTGTGGTTGTCCACATGG + Intergenic
1028563285 7:92199135-92199157 CTTAGGTTTGGGAGTCAACAGGG + Exonic
1029446816 7:100617960-100617982 CTAAGGCTTGGGATGCCACAGGG - Intergenic
1029513188 7:101009582-101009604 CAATGCTTTGGGAGGCCAATGGG + Intronic
1029634332 7:101773894-101773916 CTATGGTCTGGGTGGCCTCAGGG - Intergenic
1031236710 7:119186936-119186958 CTATGGTGGGGAAGGCCAAATGG + Intergenic
1031911244 7:127519019-127519041 ACATGGTTTGGGAGGCAACAAGG - Intergenic
1032641894 7:133779177-133779199 TTTTGTTTTGGTAGGCCACAGGG + Intronic
1037921775 8:22811666-22811688 CTCTGGTTCAGGAGGTCACAGGG + Intronic
1038845813 8:31228769-31228791 CTGTGCTTTGGGAGGCCAAGGGG - Intergenic
1040294698 8:46143120-46143142 ACATGGTGTGGGGGGCCACAGGG - Intergenic
1041251964 8:55943341-55943363 CTGTACTTTGGGAGGTCACAAGG + Intronic
1045505234 8:102773548-102773570 CTATTGCTGGGGAGACCACATGG - Intergenic
1047888179 8:129276576-129276598 CTATGGGAGGGGAGGCCATAAGG - Intergenic
1049342276 8:142119485-142119507 CCATGGGTTGGGAGGCTGCAGGG + Intergenic
1051242569 9:15075362-15075384 CCATGGCTGGGGAGGCCTCAGGG + Intergenic
1055685016 9:78763523-78763545 CTAAGGTATAGGACGCCACATGG + Intergenic
1058397401 9:104570221-104570243 ATATGGTTTTGAATGCCACATGG - Intergenic
1059214304 9:112546610-112546632 GTTCAGTTTGGGAGGCCACATGG - Intronic
1059331512 9:113538558-113538580 TTCAGGTTTGGGAGGCCAGAGGG + Intronic
1060374311 9:123105038-123105060 GTAGGGTGTGGCAGGCCACATGG + Intergenic
1060992923 9:127858968-127858990 CTCAGGTTTGCAAGGCCACAGGG + Intergenic
1061641169 9:131957502-131957524 CAATGCTTTGGGAGGCCAAAGGG - Intronic
1062073293 9:134570898-134570920 CTGTGGTTTTGGAGCCCCCAGGG + Intergenic
1062746632 9:138217158-138217180 TTTTTGTTTGCGAGGCCACAGGG - Intergenic
1186307258 X:8275518-8275540 CTGGGGTTTGAGAGACCACATGG - Intergenic
1188031680 X:25270657-25270679 ATATGGTGTTGGAGGCCACGAGG + Intergenic
1188780450 X:34277766-34277788 CTTTGGTGTGGGAGATCACAGGG - Intergenic
1190227923 X:48560270-48560292 CGCTGGTTTTGGTGGCCACAGGG + Exonic
1190374292 X:49774399-49774421 CTATGGTGTTGGTAGCCACAGGG - Intergenic
1193398288 X:81012095-81012117 ATAAGGTTTGGGAGGGGACAGGG + Intergenic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic
1199426568 X:147708573-147708595 CTATGGTTAGGATGTCCACATGG - Intergenic