ID: 1151314168

View in Genome Browser
Species Human (GRCh38)
Location 17:73311688-73311710
Sequence TAGGGTCCCAGGCACCGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151314155_1151314168 25 Left 1151314155 17:73311640-73311662 CCTCCTCCTCCACACATCCCGCT 0: 1
1: 0
2: 2
3: 67
4: 598
Right 1151314168 17:73311688-73311710 TAGGGTCCCAGGCACCGCGGTGG 0: 1
1: 0
2: 0
3: 11
4: 153
1151314161_1151314168 8 Left 1151314161 17:73311657-73311679 CCCGCTCTGCCAGGACACTAGGT 0: 1
1: 0
2: 1
3: 14
4: 137
Right 1151314168 17:73311688-73311710 TAGGGTCCCAGGCACCGCGGTGG 0: 1
1: 0
2: 0
3: 11
4: 153
1151314159_1151314168 16 Left 1151314159 17:73311649-73311671 CCACACATCCCGCTCTGCCAGGA 0: 1
1: 0
2: 1
3: 16
4: 222
Right 1151314168 17:73311688-73311710 TAGGGTCCCAGGCACCGCGGTGG 0: 1
1: 0
2: 0
3: 11
4: 153
1151314163_1151314168 -1 Left 1151314163 17:73311666-73311688 CCAGGACACTAGGTGCGCAGCTT 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1151314168 17:73311688-73311710 TAGGGTCCCAGGCACCGCGGTGG 0: 1
1: 0
2: 0
3: 11
4: 153
1151314157_1151314168 19 Left 1151314157 17:73311646-73311668 CCTCCACACATCCCGCTCTGCCA 0: 1
1: 0
2: 1
3: 21
4: 222
Right 1151314168 17:73311688-73311710 TAGGGTCCCAGGCACCGCGGTGG 0: 1
1: 0
2: 0
3: 11
4: 153
1151314156_1151314168 22 Left 1151314156 17:73311643-73311665 CCTCCTCCACACATCCCGCTCTG 0: 1
1: 0
2: 1
3: 36
4: 364
Right 1151314168 17:73311688-73311710 TAGGGTCCCAGGCACCGCGGTGG 0: 1
1: 0
2: 0
3: 11
4: 153
1151314154_1151314168 28 Left 1151314154 17:73311637-73311659 CCACCTCCTCCTCCACACATCCC 0: 1
1: 1
2: 28
3: 282
4: 2220
Right 1151314168 17:73311688-73311710 TAGGGTCCCAGGCACCGCGGTGG 0: 1
1: 0
2: 0
3: 11
4: 153
1151314162_1151314168 7 Left 1151314162 17:73311658-73311680 CCGCTCTGCCAGGACACTAGGTG 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1151314168 17:73311688-73311710 TAGGGTCCCAGGCACCGCGGTGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151314168 Original CRISPR TAGGGTCCCAGGCACCGCGG TGG Intronic
900398796 1:2464435-2464457 CAGGCTCCCAGGCACCCCTGAGG - Intronic
900558523 1:3291974-3291996 GAGGGTGCCAGGCACCGGGTAGG - Intronic
901061971 1:6475733-6475755 TAGGATCCCAAGCACCCTGGAGG + Intronic
903779033 1:25810034-25810056 CTGGGTCCCAGGCACAGAGGTGG - Intronic
904822151 1:33252655-33252677 TAGGGTCCCAGGCTCTGGAGAGG - Intergenic
908598310 1:65711568-65711590 TGGGGTTCCAGGCACCACTGGGG + Intergenic
913021481 1:114792359-114792381 TGGGGTTCCAGGCACCACTGGGG + Intergenic
914944719 1:152053684-152053706 TGGGGTCCAAGGCCCCGGGGAGG - Intergenic
915479472 1:156175184-156175206 CAGGGTCCCAGGCACAGTGGGGG - Exonic
917232843 1:172856290-172856312 TGGGGTTCCAGGTACCACGGGGG + Intergenic
918159991 1:181889495-181889517 TGGGGTTCCAGGCACCACTGGGG - Intergenic
1063443134 10:6089337-6089359 GAGGGTCTCAGTCCCCGCGGCGG + Exonic
1066984788 10:42455177-42455199 TAGGGCCCCAGGGACCGCTATGG - Intergenic
1067090959 10:43265764-43265786 TAGAGTCCAGGGCACCGAGGTGG + Intronic
1068369656 10:56096056-56096078 TGGGGTTCCAGGCACTGCTGGGG + Intergenic
1069590983 10:69641703-69641725 CTGGGTCCCAGGCACCAGGGAGG + Intergenic
1070682681 10:78459871-78459893 TATGGTCCCAGGCACAGCCCTGG + Intergenic
1070999701 10:80817989-80818011 TGGGGTTCCAGGCACCACTGGGG - Intergenic
1074317494 10:112372705-112372727 TAGGGGCCAAGGCACTGCAGGGG + Intergenic
1074769712 10:116725318-116725340 TAGGGTCCCAGGCCTCACGCTGG + Intronic
1074786664 10:116848154-116848176 CAGGGCCCCAGGCTCCGTGGTGG + Intergenic
1075093740 10:119457806-119457828 TATGGTCCCAGCTACCTCGGAGG - Intronic
1077043434 11:534464-534486 TTGGGGCCCAGGGACCGCTGTGG - Intronic
1077428343 11:2498707-2498729 TGGGGTTCCAGGCACCACTGGGG + Intronic
1080077621 11:28170252-28170274 TAGGTTACCAGGCACAGCAGAGG - Intronic
1081637036 11:44727773-44727795 TGGGGTCCCTGGCAGCGGGGCGG + Intronic
1082903630 11:58283309-58283331 TAGTGTTCCAGGCACCACTGGGG + Intergenic
1083303132 11:61749111-61749133 TTGGGTCCCAAGCAGCGCTGGGG - Intergenic
1084321797 11:68377406-68377428 GAAGGTCCCAGGCACCGTGCAGG + Intronic
1084480884 11:69419402-69419424 CAGGGTCCCAGGCACAGCTCCGG + Intergenic
1086129168 11:83383111-83383133 TGGGGTCCCAGGCACCACTGCGG - Intergenic
1091119552 11:133045382-133045404 AAGGGACCCACGCACCCCGGAGG + Intronic
1091973813 12:4809692-4809714 CCGGGTCTCAGGCACCGCTGGGG + Exonic
1093610494 12:21149819-21149841 TGGTGTCCCAGGCACCACTGGGG - Intronic
1095295124 12:40518795-40518817 TTGTGTTCCAGGCACCTCGGAGG + Intronic
1095537000 12:43261015-43261037 GAGGGTCCCAGGCACCTCTCTGG - Intergenic
1097497808 12:60364229-60364251 TAGGGAGCCAGGCACTGGGGAGG + Intergenic
1099343672 12:81471265-81471287 TATGGTCCCAGCCACCTTGGAGG - Intronic
1106336621 13:28789208-28789230 TGGGGTTCCAGGCACCACTGGGG + Intergenic
1106400902 13:29428966-29428988 TAGGGGGACAGGCACCGAGGTGG - Intronic
1113308465 13:109104918-109104940 GAAGGTCCCAGGCACCATGGAGG - Intronic
1113762588 13:112859804-112859826 TAACGTGCCAGGCACCGGGGTGG - Intronic
1115339050 14:32272825-32272847 TGGGGTTCCAGGCACCACTGGGG - Intergenic
1115376757 14:32685140-32685162 TATGGTCCCAGCCACCTAGGAGG + Intronic
1116304686 14:43237061-43237083 TAGGGCCCCAGCCAGCACGGTGG + Intergenic
1119532539 14:75373125-75373147 TGGGGTGCCAGGCACCGTGGAGG + Intergenic
1120338604 14:83190324-83190346 TGGAGTTCCAGGCACCGCTGGGG + Intergenic
1123906392 15:24925698-24925720 TATGGTCCCAGCCACTGGGGAGG - Intronic
1124474708 15:30022909-30022931 TGGGGTTCCAGGCACCACTGGGG + Intergenic
1125626880 15:41116134-41116156 TGGGGTCCCAGGAGCCGCGGAGG - Exonic
1129383525 15:75183020-75183042 TTGGGTCCCAGGCACAGGGCAGG + Intergenic
1134594947 16:15488719-15488741 TGTGGTCCCAGGTACCCCGGAGG + Intronic
1136536915 16:30904835-30904857 CAGAGTCCCAGGCACCGCTCTGG - Intergenic
1136993286 16:35170253-35170275 CGGGGTCCCGGGCCCCGCGGCGG - Intergenic
1138558503 16:57786646-57786668 TAGAGCCCCAGGCTCCGAGGTGG - Intronic
1140037230 16:71380675-71380697 TGGGGTCCCAGAAACCGTGGCGG - Intronic
1140349425 16:74247914-74247936 TAGGATTCCAGGCACAGCTGAGG - Intergenic
1142064055 16:88050276-88050298 TGTGGTCCCAGCCACCGGGGAGG - Intronic
1142623599 17:1179545-1179567 TCGGGACCCAGGCACCGGGCTGG - Intronic
1143038924 17:4017914-4017936 TACGGTCCCTGGCTCAGCGGTGG - Exonic
1144999630 17:19294783-19294805 GAGGGCCCCAGGTACTGCGGTGG + Intronic
1144999739 17:19295809-19295831 GAGGGCCCCAGGTGCCGCGGTGG + Intronic
1146453256 17:32991168-32991190 TAGGTGCCCAGGCACAGTGGTGG - Intronic
1147315606 17:39618675-39618697 TAGGGTGCCAGTCCCCGCCGGGG - Intergenic
1150476865 17:65482304-65482326 TAGTTTCCCAGGCACCTCTGTGG + Intergenic
1151314168 17:73311688-73311710 TAGGGTCCCAGGCACCGCGGTGG + Intronic
1152472173 17:80495823-80495845 GAGGGTCCCAGCCACCTCAGTGG + Intergenic
1154101580 18:11479454-11479476 TGGGGTTCCAGGCACCACTGGGG + Intergenic
1160140118 18:76313652-76313674 TGTGGTCCCAGGCACTGGGGAGG + Intergenic
1160879776 19:1314139-1314161 GAGGGTCCCAGGGACCTGGGGGG - Intergenic
1162411564 19:10509253-10509275 TATGGTCCCAGACACTGGGGAGG - Intergenic
1162785687 19:13033290-13033312 AAGGGACCCAGGCACCTGGGGGG - Intronic
1165269862 19:34696774-34696796 TGGGGTTCCAGGCACCACTGTGG - Intergenic
1166308873 19:41951322-41951344 TAGGGTCCCAGGGCCGGAGGTGG - Intergenic
1167096662 19:47378129-47378151 TTGGGTCCCAGGGAACGTGGAGG + Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
1168721777 19:58558407-58558429 CGGGGTCCCGGGCCCCGCGGCGG - Exonic
927201311 2:20579641-20579663 CAGGGTCCCAGGCAGCTCAGTGG - Intronic
931998731 2:67863957-67863979 TAGTGTGCCAGGCACCACAGTGG + Intergenic
937158955 2:119742090-119742112 TAGGGCCCCAGGCACCAAGGGGG - Intergenic
937893266 2:126956716-126956738 TGGCGTTCCAGGCACCGCTGGGG - Intergenic
940124815 2:150311411-150311433 TGGGGTTCCAGGCACCACTGGGG - Intergenic
941239423 2:163017645-163017667 TGGGGTTCCAGGCACCGCTGGGG + Intergenic
943009334 2:182427540-182427562 TAGGCTCCCAGGCACTTTGGAGG - Intronic
943147721 2:184066180-184066202 TGGGGTTCCAGGCACCACTGGGG + Intergenic
944764316 2:202849250-202849272 TGGGGTTCCAGGCACCACTGGGG - Intronic
948043977 2:234928607-234928629 CAGGGTCCTAGGCTCCGTGGCGG - Intergenic
948567783 2:238897509-238897531 TAGGGAACCAGGCACCAGGGTGG - Intronic
1171812130 20:29753429-29753451 TAGGGCCCCAGCCAGGGCGGAGG + Intergenic
1178749166 21:35284199-35284221 CAGGGTCCCAGGCAGGGCAGGGG - Intronic
1179712392 21:43270862-43270884 GAGTTTCCCAGGCACCGCGGCGG - Intergenic
1180150096 21:45942991-45943013 TGGGGAGCCAGGCACCGGGGAGG + Intergenic
1181354036 22:22287987-22288009 TGGGGTCCCAGCCACCTGGGAGG - Intergenic
1182124062 22:27803902-27803924 CAGGGTCCTAGGCCCCGGGGCGG - Intergenic
1183264851 22:36818850-36818872 CTGGGTCCCAGGCACCAGGGAGG - Intronic
1183459451 22:37941107-37941129 TAGGGTCCCAGGGTCCAGGGAGG + Exonic
1183722198 22:39569007-39569029 TAGGATCCCAGGGACCCCAGTGG + Intergenic
1184504956 22:44894990-44895012 TAGTGCCTCGGGCACCGCGGGGG + Intronic
950096938 3:10335987-10336009 AAGGGTCCCAGCCACCGAAGAGG - Intronic
950205173 3:11074479-11074501 TAGGGACCCAGGCACCAGGTTGG + Intergenic
951415161 3:22414561-22414583 TGGGGTTCCAGGCACCACTGGGG + Intergenic
953414436 3:42707516-42707538 CAGGGTCCCAGGAGCCGCAGTGG + Intronic
959345608 3:105191191-105191213 TGGGGTTCCAGGCACCACTGGGG + Intergenic
962825520 3:139096789-139096811 TTGGGCCCCAGGCACCATGGTGG - Intronic
963312606 3:143725026-143725048 TAGGGGCCCAGGCAGTGGGGGGG - Intronic
964399647 3:156285620-156285642 TGTGGTCCCAGGCACCCAGGAGG - Intronic
967969325 3:194987591-194987613 TAGGGTCCCAGGGGCCTCAGAGG + Intergenic
968757001 4:2421933-2421955 TAGAGTCCCAGCTACCCCGGAGG + Intronic
969496215 4:7527729-7527751 GAGGGCCCCAGGCTCAGCGGAGG - Intronic
971943227 4:33241595-33241617 TGGGGTCCCAGGCACCACTGAGG + Intergenic
972260995 4:37408146-37408168 TGGGGTTCCAGGCACCACTGGGG - Intronic
973629073 4:52802076-52802098 TGGGGTTCCAGGCACCACTGGGG - Intergenic
975562969 4:75724734-75724756 TTGGGGCCCAGGCCCTGCGGAGG + Exonic
975660985 4:76689194-76689216 TAAGGACCCAAGGACCGCGGAGG + Intronic
976642585 4:87354520-87354542 TATGGTCCCAGGGACTGGGGAGG + Intronic
977897848 4:102384346-102384368 TGGGGTTCCAGGCACCACTGGGG + Intronic
979119790 4:116883377-116883399 TGGGGTTCCAGGCACCACTGGGG + Intergenic
985317378 4:188672591-188672613 TGGGGTTCCAGGCACCACTGGGG - Intergenic
986358512 5:6952214-6952236 TGGGGTTCCAGGCACCACTGGGG - Intergenic
986449542 5:7850906-7850928 TTGGGGTCCAGGCGCCGCGGCGG + Exonic
986547661 5:8916519-8916541 TAGGATCCCAGGCATTGTGGAGG + Intergenic
986547679 5:8916809-8916831 TAGGGTCCCAGGCATTGCAGAGG + Intergenic
988774948 5:34469213-34469235 TGGGGTTCCAGGCACCACTGGGG - Intergenic
990231329 5:53716100-53716122 CAGGGTTCCAGGCACCACTGGGG - Intergenic
991110775 5:62896858-62896880 TGGGGTTCCAGGCACCACTGGGG + Intergenic
995301887 5:110594424-110594446 TGGGGTTCCAGGCACCACTGGGG - Intronic
996426653 5:123320350-123320372 TAGGGTTCCAGGCACCACTAGGG + Intergenic
998270349 5:140700770-140700792 TAGGGGCCCAGACACGGCGACGG + Intronic
999602560 5:153283017-153283039 TGGGGTTCCAGGCACCACTGGGG - Intergenic
1002152875 5:177250055-177250077 TAGGGTCTCAGTCACCCAGGTGG - Intronic
1002508774 5:179699077-179699099 TAGCCTCCCGGGGACCGCGGGGG - Exonic
1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG + Intronic
1017166303 6:151411357-151411379 TAGGGTGCCAGGGACTGGGGTGG + Intronic
1019512986 7:1427409-1427431 TAGAGTCCCAGCCACTTCGGAGG + Intergenic
1019711273 7:2519366-2519388 TGGGCTCCGACGCACCGCGGGGG - Intronic
1019999183 7:4745197-4745219 TAGGAAGGCAGGCACCGCGGGGG - Intronic
1023672891 7:42598232-42598254 TATGGTCCCAGGTACTCCGGAGG + Intergenic
1025683689 7:63699577-63699599 GAGGGTCCCAAGCTCCACGGTGG + Intergenic
1029494574 7:100890021-100890043 GAGGGGCGAAGGCACCGCGGGGG + Exonic
1034351227 7:150416067-150416089 TATAGTCCCAGGGACTGCGGAGG + Intergenic
1034446730 7:151117483-151117505 AAGGGCTCCAGGCACAGCGGTGG - Intronic
1034474581 7:151275190-151275212 TCCGGGCCCAGGCACCGAGGGGG - Intronic
1034564559 7:151902714-151902736 TAGGGTCAGAGGCACAGTGGGGG - Intergenic
1042627194 8:70770934-70770956 TGGGGTTCCAGGCACCACTGGGG + Intronic
1043036707 8:75208345-75208367 TAGGGTTCCAGGTACCACTGGGG + Intergenic
1045166336 8:99609970-99609992 TAGGGTCTCTGGGACCTCGGGGG + Intronic
1045217755 8:100165532-100165554 TGTGGTCCCCGGCACCGTGGAGG - Intronic
1054727321 9:68665475-68665497 TAGTGTCCCAGGCACTGAGCTGG - Intergenic
1055823920 9:80301303-80301325 TGGGGTTCCAGGCACCACTGGGG + Intergenic
1060518083 9:124278402-124278424 TAGTGTCCCAGGCATTGAGGAGG + Intronic
1062323978 9:136003838-136003860 TGGGGTCCCAGGCAGCCAGGCGG + Intergenic
1186810311 X:13181742-13181764 TAGGGTTCCAGGCACCACTGGGG - Intergenic
1190127995 X:47723032-47723054 CCGGGTCCCAGGCACTGCCGTGG - Intergenic
1191097463 X:56688634-56688656 TGGGGTTCCAGGCACCACTGAGG + Intergenic
1191115373 X:56846852-56846874 TGGGGTTCCAGGCACTGCTGGGG - Intergenic
1191802679 X:65098849-65098871 TGGGGTTCCAGGCACCACTGGGG - Intergenic
1192030674 X:67509307-67509329 TGGGGTTCCAGGCACCACTGGGG - Intergenic
1192953206 X:76039637-76039659 TGGGGTTCCAGGCACCACTGAGG + Intergenic
1193113801 X:77756369-77756391 TGGGGTTCCAGGCACCACTGGGG + Intronic
1193514357 X:82445715-82445737 TGGGGTTCCAGGCACCACTGGGG - Intergenic
1194708094 X:97200307-97200329 TGGTGTTCCAGGCACCGCCGGGG - Intronic
1197645458 X:129012072-129012094 GAGGGTCCCAGGTACCCAGGTGG + Intergenic
1198060601 X:133042231-133042253 TGGGGTTCCAGGCACTGCTGGGG + Intronic
1199894027 X:152115387-152115409 TCTGGTCCCAGGCACCCTGGGGG - Intergenic
1200162906 X:154018464-154018486 TAGGGTCCCTGGCCCCTTGGTGG - Intronic