ID: 1151320312

View in Genome Browser
Species Human (GRCh38)
Location 17:73348846-73348868
Sequence CCTGGAAGGCAGACCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 462}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151320312_1151320329 8 Left 1151320312 17:73348846-73348868 CCTTCCTGGGTCTGCCTTCCAGG 0: 1
1: 0
2: 7
3: 39
4: 462
Right 1151320329 17:73348877-73348899 CCTGGGAGGTAGGAATCTGGAGG 0: 1
1: 0
2: 4
3: 29
4: 265
1151320312_1151320327 5 Left 1151320312 17:73348846-73348868 CCTTCCTGGGTCTGCCTTCCAGG 0: 1
1: 0
2: 7
3: 39
4: 462
Right 1151320327 17:73348874-73348896 GGGCCTGGGAGGTAGGAATCTGG 0: 1
1: 0
2: 4
3: 31
4: 334
1151320312_1151320321 -9 Left 1151320312 17:73348846-73348868 CCTTCCTGGGTCTGCCTTCCAGG 0: 1
1: 0
2: 7
3: 39
4: 462
Right 1151320321 17:73348860-73348882 CCTTCCAGGGGCCCGGGCCTGGG 0: 1
1: 0
2: 5
3: 30
4: 353
1151320312_1151320330 11 Left 1151320312 17:73348846-73348868 CCTTCCTGGGTCTGCCTTCCAGG 0: 1
1: 0
2: 7
3: 39
4: 462
Right 1151320330 17:73348880-73348902 GGGAGGTAGGAATCTGGAGGAGG 0: 1
1: 0
2: 1
3: 42
4: 463
1151320312_1151320324 -2 Left 1151320312 17:73348846-73348868 CCTTCCTGGGTCTGCCTTCCAGG 0: 1
1: 0
2: 7
3: 39
4: 462
Right 1151320324 17:73348867-73348889 GGGGCCCGGGCCTGGGAGGTAGG 0: 1
1: 0
2: 8
3: 96
4: 885
1151320312_1151320331 20 Left 1151320312 17:73348846-73348868 CCTTCCTGGGTCTGCCTTCCAGG 0: 1
1: 0
2: 7
3: 39
4: 462
Right 1151320331 17:73348889-73348911 GAATCTGGAGGAGGACAAAGAGG 0: 1
1: 0
2: 1
3: 43
4: 469
1151320312_1151320333 29 Left 1151320312 17:73348846-73348868 CCTTCCTGGGTCTGCCTTCCAGG 0: 1
1: 0
2: 7
3: 39
4: 462
Right 1151320333 17:73348898-73348920 GGAGGACAAAGAGGGAAAAATGG 0: 1
1: 2
2: 32
3: 382
4: 2172
1151320312_1151320332 21 Left 1151320312 17:73348846-73348868 CCTTCCTGGGTCTGCCTTCCAGG 0: 1
1: 0
2: 7
3: 39
4: 462
Right 1151320332 17:73348890-73348912 AATCTGGAGGAGGACAAAGAGGG 0: 1
1: 0
2: 2
3: 51
4: 455
1151320312_1151320334 30 Left 1151320312 17:73348846-73348868 CCTTCCTGGGTCTGCCTTCCAGG 0: 1
1: 0
2: 7
3: 39
4: 462
Right 1151320334 17:73348899-73348921 GAGGACAAAGAGGGAAAAATGGG 0: 1
1: 0
2: 11
3: 89
4: 794
1151320312_1151320322 -6 Left 1151320312 17:73348846-73348868 CCTTCCTGGGTCTGCCTTCCAGG 0: 1
1: 0
2: 7
3: 39
4: 462
Right 1151320322 17:73348863-73348885 TCCAGGGGCCCGGGCCTGGGAGG 0: 1
1: 0
2: 8
3: 37
4: 505
1151320312_1151320319 -10 Left 1151320312 17:73348846-73348868 CCTTCCTGGGTCTGCCTTCCAGG 0: 1
1: 0
2: 7
3: 39
4: 462
Right 1151320319 17:73348859-73348881 GCCTTCCAGGGGCCCGGGCCTGG 0: 1
1: 0
2: 3
3: 59
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151320312 Original CRISPR CCTGGAAGGCAGACCCAGGA AGG (reversed) Intronic
900345866 1:2210013-2210035 CCTGGAATGCAGCCTCAGGGTGG + Intronic
900565125 1:3328411-3328433 CCAGGAAGGCTGACACAGGCAGG - Intronic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
901094191 1:6665173-6665195 CTTGGGAGGCAGACGAAGGAGGG - Intronic
901848601 1:12000668-12000690 CCAGGATGTCAGAGCCAGGAGGG + Intronic
902571935 1:17352574-17352596 TCTGGAAGGCAGAGCCAGCAGGG + Intronic
902773229 1:18658293-18658315 CCTCGAAGACACAGCCAGGATGG - Intronic
902777246 1:18682758-18682780 CTTCCCAGGCAGACCCAGGAGGG - Intronic
903034944 1:20486932-20486954 GCTGGAAGGGAGACCCCCGAGGG - Intergenic
903972016 1:27125083-27125105 TCTAGAAGGCAGAACCAGCAGGG - Intronic
904044892 1:27603186-27603208 CCTGGCAGGCAGCGCCGGGAAGG - Intronic
904402348 1:30265222-30265244 CCTGGAGGGCAGCCCCAGGCTGG - Intergenic
904804952 1:33124497-33124519 TCTGAAAGGCAGACCCAGTCAGG + Intergenic
904822604 1:33255825-33255847 CCTGGAGGGGACCCCCAGGATGG - Intergenic
905497360 1:38403293-38403315 CCAGGAATGCAGACACAGCACGG + Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907415775 1:54312909-54312931 TCAGAAAGGCAGGCCCAGGAGGG + Intronic
907909648 1:58815072-58815094 CCCCAAAGGCAGCCCCAGGACGG + Intergenic
912515755 1:110215645-110215667 CCAGGAAGGCAGCTCCAGCAGGG + Intronic
912874117 1:113339185-113339207 CCTTGGAGGAAGACACAGGAGGG + Intergenic
914980455 1:152410372-152410394 TCTGGAACTCAGACCCAGGCAGG - Exonic
915977368 1:160400253-160400275 CCAGGAAGACAGCCCCAGGAGGG + Intergenic
916560986 1:165933968-165933990 CCAGGAGGGCAGACACATGAAGG + Intergenic
918526080 1:185466524-185466546 CCTGGAAGGCAAGGCCAGAATGG + Intergenic
918654324 1:187005282-187005304 CTTGGAAGTTAGACCCAAGATGG + Intergenic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
920017690 1:202926993-202927015 CCTTGCAGGGAGACCAAGGATGG + Intronic
920061957 1:203233070-203233092 CAGGGAGGGCAGCCCCAGGAGGG - Intronic
920649710 1:207827654-207827676 CCCAGCAGGCAGAGCCAGGAGGG - Intergenic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
921788792 1:219265134-219265156 CCTGGAGGGCTGACACAGCATGG + Intergenic
922374332 1:224945896-224945918 ACTGGGAGGCAGCCCCAGTAGGG - Intronic
922787930 1:228292514-228292536 CCTGGCAGGCAGAGCTGGGAAGG - Exonic
922976112 1:229784894-229784916 CCTGGCACACAGACCCTGGAAGG - Intergenic
924176329 1:241395086-241395108 GCAGTAATGCAGACCCAGGAAGG - Intergenic
924217511 1:241839349-241839371 GCAGGAAGGGAGACCCAGTATGG - Intergenic
1064429979 10:15262474-15262496 CCAGGAAGGCAGAACCGGGTAGG + Intronic
1065077690 10:22097705-22097727 CCTGGGTGACAGACCAAGGATGG - Intergenic
1065795449 10:29303291-29303313 CCAGGAAGGTAGAACCAGGCAGG - Intronic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1067044143 10:42975046-42975068 CCTGGCAGGCAGCCCCAGCGGGG - Intergenic
1069115244 10:64497062-64497084 CCTGGAAAGCATTCCCAAGAAGG - Intergenic
1069708936 10:70477124-70477146 CCTGGAATGCATCCTCAGGATGG + Intergenic
1070225275 10:74497721-74497743 CTTGGGAGGCAGAGACAGGATGG + Intronic
1070322286 10:75363227-75363249 CCCGGGAGACAGGCCCAGGATGG + Intergenic
1070505906 10:77112489-77112511 CCTGTAAGGCAGCCCCAGCAGGG - Intronic
1070550999 10:77490766-77490788 CCTGGAATGGAGGCCCAGGGAGG - Intronic
1071106701 10:82106325-82106347 GCTAGAAGTTAGACCCAGGAGGG + Intronic
1071544358 10:86517005-86517027 CCTGGGAGGCGGAGCCAGCATGG + Intronic
1071604189 10:86973240-86973262 CCTGGAGGGCAGGGCCAGGTGGG + Intronic
1072362219 10:94670796-94670818 CCTGGAAGGGTAACCCATGAAGG - Intergenic
1072605248 10:96975905-96975927 CTTGGGAGGCTGAGCCAGGAGGG + Intronic
1072808613 10:98443094-98443116 CAGGGTAGGCAGTCCCAGGAGGG - Intronic
1073104474 10:101024349-101024371 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1073352609 10:102830782-102830804 CCTGGAAGGCATCCCCAAGGTGG - Exonic
1074307741 10:112294657-112294679 GCTGGAAGTCATACACAGGATGG + Intronic
1074412593 10:113241368-113241390 TCTGGAAGACAGAGCCCGGAGGG + Intergenic
1074436871 10:113441847-113441869 CTTGGAAGGCAGGGCCATGAGGG + Intergenic
1074700723 10:116089698-116089720 CCAGGAAGGGAGCCCCAGCAAGG + Intronic
1075261502 10:120967272-120967294 CTTGGAAGACAGAGACAGGAGGG - Intergenic
1075658089 10:124174893-124174915 CAGGGAAGGGAGAGCCAGGAAGG - Intergenic
1075719790 10:124577950-124577972 CCTGGGTGGCACTCCCAGGATGG - Intronic
1075915149 10:126160527-126160549 CCTGGAAGGGAGAGCTGGGAAGG - Intronic
1076445555 10:130511569-130511591 CCTGAAAGCCAGAGCAAGGAGGG - Intergenic
1077092510 11:786108-786130 ACTGGAAGGCAGGCTGAGGATGG + Intergenic
1077411286 11:2405079-2405101 CCAGCAAGGCAGGCCCAGGAAGG + Intronic
1077507844 11:2940397-2940419 GCTGGAAGCCAGTCCGAGGAGGG - Intergenic
1077531986 11:3101666-3101688 CGTGGAAGGCAGACACGGGCGGG + Exonic
1077557029 11:3230800-3230822 CCGGGAAGGCAGACCATGGGTGG + Intronic
1078059749 11:8035552-8035574 CCTGGAAGACAGCCCATGGAGGG - Intronic
1078557330 11:12340051-12340073 TCTGGAAGGTAGAGCCAAGATGG - Intronic
1079101320 11:17544017-17544039 CCTGGAAGGCAGAGGGAGAAAGG + Intronic
1080590904 11:33722463-33722485 CCTGGAAGGAAGGGACAGGAAGG + Exonic
1080615674 11:33942843-33942865 CTTGGGTGGCAGACCCAGGTGGG - Intergenic
1080822237 11:35818632-35818654 CCTGGAAAAGAGAACCAGGAGGG - Intergenic
1080897930 11:36461664-36461686 CCAAGGAGGCAGACACAGGAAGG - Intronic
1081100427 11:38995083-38995105 CCTGGAAGCCACACTCATGAAGG - Intergenic
1081906326 11:46672668-46672690 GCTGCAAGGCAGGCCCAGGCAGG - Exonic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1082778747 11:57269756-57269778 CCTGAAAGGCAGACAGAGGCTGG - Intergenic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1083200372 11:61117964-61117986 CCCCGAAGCTAGACCCAGGAGGG - Intronic
1083771092 11:64867980-64868002 TCAGGAAGGCAGACCCTGTAAGG - Intronic
1083882535 11:65555595-65555617 TCTGGAAGGCAGGGCCAGGCTGG + Intronic
1084721441 11:70908271-70908293 CCTGGCTGGCACACGCAGGATGG + Intronic
1084751132 11:71205028-71205050 CCATGAAGGCAGCCCCAGCAGGG + Intronic
1084751867 11:71209379-71209401 CGTGCAGGGCTGACCCAGGAGGG + Intronic
1085267446 11:75245639-75245661 CCTTGAAGGAAGAGTCAGGAAGG + Intergenic
1085385317 11:76154388-76154410 TCTAGAAGGAAGACCCAGGTTGG - Intergenic
1088203234 11:107362536-107362558 ACTGGGAGGCACCCCCAGGAGGG + Intronic
1088923846 11:114281090-114281112 CCTGGATGACAGACCGAGGGAGG + Intronic
1089192319 11:116661958-116661980 CCTGGAAGGCTTCCCCAGGGAGG + Intergenic
1089329549 11:117680132-117680154 CCTGGATGGCAGAGCTAGGCTGG - Intronic
1089502843 11:118942451-118942473 CTTGGGAGGCTGACACAGGAGGG + Intronic
1089657174 11:119957653-119957675 CATGGGAGGCTGAGCCAGGAGGG + Intergenic
1090134694 11:124185250-124185272 CATGGAAGCCAGTCCTAGGAAGG - Exonic
1090207268 11:124892428-124892450 GCTGGAAGCCAGACCAAGGAAGG - Intronic
1092307606 12:7317533-7317555 CCAGGAAGGCCTACCCAGAAAGG + Intronic
1093565894 12:20603253-20603275 CCTGGGAGGCAAACACAGCATGG - Intronic
1095227675 12:39696105-39696127 CCTGGAAAGCATTCCCAAGATGG + Intronic
1096367154 12:51037796-51037818 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
1096565277 12:52473111-52473133 CCTGCTAGGGAGACCTAGGAGGG - Intronic
1096567297 12:52492562-52492584 CCTGCCAGGGAGACCTAGGAGGG - Intronic
1096658182 12:53104739-53104761 GCTGGAATTCAGACCCAGGGAGG + Intronic
1097023957 12:56040383-56040405 CCTAGCATTCAGACCCAGGATGG - Intergenic
1098459514 12:70716737-70716759 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1099392355 12:82097392-82097414 CGTGGTAGCCAGACCCAGAAGGG - Intergenic
1100461600 12:94805181-94805203 CTTGGAAGGCGCATCCAGGAAGG - Intergenic
1101854936 12:108434357-108434379 TCTGGAAGGTAGTTCCAGGATGG - Intergenic
1102214078 12:111147794-111147816 CCAGGTAGGCATGCCCAGGAAGG + Intronic
1102251344 12:111389624-111389646 ATTGGAAGGCAGGTCCAGGAAGG + Intergenic
1102274933 12:111574533-111574555 CTTGGGAGGCTGACTCAGGAGGG - Intronic
1102300469 12:111767334-111767356 CCTGGAAAACAGACCGAGGCTGG - Intronic
1102304116 12:111791792-111791814 CTTGGAAGGCCGAGGCAGGAGGG + Intronic
1102533069 12:113561241-113561263 CCTGGAAGGCACACGCCGGCCGG + Intergenic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1104495407 12:129232462-129232484 CCTGCAAGGCAGAGCTAGCATGG - Intronic
1105324168 13:19355176-19355198 CATGGAAGGTAGAATCAGGAAGG + Intergenic
1105325880 13:19370416-19370438 CCTGGAAAGCAGACTCTGGATGG + Intergenic
1105867627 13:24474678-24474700 CCTAGAAAGCAGACTCTGGATGG - Intronic
1105869093 13:24488228-24488250 CATGGAAGGTAGAATCAGGAGGG - Intronic
1106193593 13:27475030-27475052 CCTGGAACACAGACCCAGGAAGG + Intergenic
1106771739 13:32967995-32968017 CATGTAAGGCAGACCCTGGAAGG + Intergenic
1107832890 13:44390221-44390243 TCTGGGAGCAAGACCCAGGATGG - Intronic
1108140511 13:47416108-47416130 CCTGGAGGACAGAGCCAGGAGGG + Intergenic
1108996923 13:56746644-56746666 CCTGGAAAGCATTCCCAAGAAGG - Intergenic
1109685967 13:65819803-65819825 CCTGGAAAGCCTTCCCAGGAAGG + Intergenic
1110848174 13:80213381-80213403 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1111986957 13:95075819-95075841 CCTGGAAGGCTGAGTTAGGAAGG - Intronic
1114080481 14:19198774-19198796 CCCTGCAGGCAGACCCAGGAAGG + Intergenic
1115403546 14:32991076-32991098 CTTGGAAGGCTGAAGCAGGAGGG - Intronic
1117696649 14:58371171-58371193 CTTGGAAGGCTGAGGCAGGAGGG + Intronic
1117711873 14:58538803-58538825 CCTGGACGACAGAGCCAGGCTGG - Intronic
1119397043 14:74334181-74334203 CCTGGAAGCCAAAGCCAAGAAGG + Intronic
1119738487 14:76999076-76999098 CCCAGGAGGCAGACCCAGGCGGG + Intergenic
1120723388 14:87911719-87911741 CCCTGAAGGCAGACTCTGGAAGG - Intronic
1121406967 14:93725082-93725104 CCTGGCAGGAGGACCCTGGAAGG + Intronic
1121406974 14:93725096-93725118 CCTGGAAGGCAGGGTGAGGAGGG + Intronic
1121539288 14:94712963-94712985 TCTGGAAAGAAGGCCCAGGAGGG + Intergenic
1121795643 14:96733149-96733171 TATGGAAGGCAGCCACAGGAGGG - Intergenic
1122157580 14:99759443-99759465 CCTGGAGGGCAGCCCCGGGCCGG + Intronic
1122183623 14:99972367-99972389 CCTGGGAGGCAGACCCCCGCGGG + Intronic
1122370351 14:101225969-101225991 CCTGGGCGTCAGCCCCAGGAGGG - Intergenic
1122504700 14:102224971-102224993 ACAGGAAGCCAAACCCAGGAGGG + Intronic
1122660790 14:103293639-103293661 CCTGGCAGCCAGACACAGGATGG - Intergenic
1122781962 14:104147489-104147511 CCTGGCTGGCAGACCAGGGAGGG + Intronic
1123690071 15:22831237-22831259 CCGGGGAGGCTGACGCAGGAGGG - Intergenic
1123923359 15:25086341-25086363 CATGGAAGGCAGGCCCATGTTGG + Intergenic
1126161352 15:45616565-45616587 CCAGAAATGCAGGCCCAGGAAGG - Intronic
1126180874 15:45783952-45783974 AGGGGAAGGCAGACCCAGGTAGG + Intergenic
1126339465 15:47623193-47623215 CTTGGAAGGCAGGACCAGCATGG - Intronic
1126588803 15:50318645-50318667 CCTAGAAGGCAAACCCAGATGGG + Intronic
1128290818 15:66477036-66477058 CCTGGGAGCCAGATCCCGGAGGG - Intronic
1128723259 15:69968615-69968637 ACTGGAAGGGAGACCCAGGTGGG + Intergenic
1129277889 15:74459414-74459436 CCTGGGAGGCTGAGGCAGGAAGG - Intronic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129683537 15:77671727-77671749 CCTGGAAGTCTCACCCAGGAGGG - Intronic
1130136678 15:81187485-81187507 CTTGGAAGGCCGAGGCAGGAGGG + Intronic
1131180100 15:90233703-90233725 CCTGGAAGGCAAAGCCAGAGCGG + Exonic
1131383182 15:91981220-91981242 CCTGGCTGGCAGAGCAAGGAGGG - Intronic
1132374020 15:101316657-101316679 CCTTGAGGGCTGCCCCAGGAGGG + Intronic
1132618826 16:854948-854970 CCGGGAGGGGAGACCCAGCAGGG + Intronic
1132637948 16:962474-962496 CCTGGCAGGCAGACCTTGGCCGG + Intronic
1132744838 16:1432272-1432294 GCTGGACGGCTGGCCCAGGATGG - Intergenic
1132996911 16:2828177-2828199 GCTGGATGGCAGAGTCAGGAAGG - Intergenic
1133824288 16:9263156-9263178 CTTTGGAGGCAGACGCAGGAGGG - Intergenic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1134089388 16:11383588-11383610 CCTGGAAGGCAGATGCCAGACGG + Intronic
1134746219 16:16590936-16590958 CCTAGAGGGCAGAGCTAGGATGG + Intergenic
1134863215 16:17579501-17579523 CCAGGAAGGGAGACCATGGAGGG + Intergenic
1134999262 16:18762764-18762786 CCTAGAGGGCAGAGCTAGGATGG - Intergenic
1135859144 16:26038977-26038999 CCTTGAAGGAAGAACCAGGCTGG - Intronic
1135954103 16:26941157-26941179 GCTGGAAGCCTGACCCTGGAGGG - Intergenic
1136372921 16:29847431-29847453 CCAGGAAGGCAGAGCCAAGGCGG + Intronic
1136479630 16:30533447-30533469 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136483408 16:30556406-30556428 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137430614 16:48415343-48415365 ACTGGAAGGCAGATAGAGGATGG + Intronic
1137589876 16:49686991-49687013 CCTGGAGGGAAGCCCCAGGAAGG + Intronic
1138200916 16:55087756-55087778 CCTGGGAGGCAGACTCAAGGTGG - Intergenic
1138589350 16:57991253-57991275 GCAGGAAGACAGACCCAGGGTGG + Intergenic
1139534519 16:67563023-67563045 CCTCGAGGGCAGACAAAGGAAGG - Intronic
1140658396 16:77163978-77164000 CCTAGTAGGCATTCCCAGGATGG - Intergenic
1141344187 16:83230330-83230352 CCGGGAAAGCAGGCACAGGAAGG + Intronic
1141426744 16:83949273-83949295 TCTGGAGGGGAGACCCAGGAAGG - Exonic
1141915547 16:87094063-87094085 TCTGGCAGGGAGACCCGGGATGG + Intronic
1143350224 17:6282682-6282704 TCTGGAGGGCAGCCTCAGGATGG + Intergenic
1145105497 17:20111844-20111866 CCTGAACGGCAGCCCCAAGAAGG + Intronic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1148163361 17:45464620-45464642 CCTGTGAGACAGACACAGGACGG + Intronic
1148249141 17:46059509-46059531 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1148435591 17:47681938-47681960 CCTGGGAGGCTGAGGCAGGAGGG - Intronic
1148625678 17:49067290-49067312 CCTGGAAGCCTGACCCATGCTGG + Intergenic
1149955292 17:61042780-61042802 CCTGGGAGGCTGAGGCAGGAGGG + Intronic
1150006224 17:61470597-61470619 CTTGGAAGGCAGGTTCAGGAGGG + Intronic
1150394593 17:64811272-64811294 CCTGTGAGACAGACACAGGACGG + Intergenic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151326855 17:73385032-73385054 CCTTGAAGACAAAGCCAGGAGGG - Intronic
1151517809 17:74607666-74607688 CGTGGAAGGCAGAGCCATGGAGG + Intergenic
1151570068 17:74921608-74921630 CCAGGAGGGGAGGCCCAGGAAGG - Intronic
1151740542 17:75979157-75979179 CCTAGGAGGCAGCCTCAGGACGG + Exonic
1152431265 17:80249334-80249356 CATGGGAGGCAGGCACAGGAAGG - Intronic
1152653375 17:81507285-81507307 CCTGGATGACAGAGCCAGGATGG + Intergenic
1153768216 18:8394876-8394898 CATGGAAGGCACTGCCAGGAAGG - Intronic
1156306627 18:35883973-35883995 CTTGGAAATCAGACCCAGGCAGG + Intergenic
1156410128 18:36819951-36819973 CTTGGGAGGCTGACACAGGAGGG + Intronic
1159511596 18:69402177-69402199 CCTGGGAGGCTGACCCCGGCTGG + Intronic
1159810332 18:73011725-73011747 CCTGGGAGCCGGATCCAGGAGGG + Intergenic
1159941460 18:74412073-74412095 CCTGAAAGGATGACCCAGCAGGG + Intergenic
1160397658 18:78583984-78584006 CCTGGAAGACTCACGCAGGAGGG + Intergenic
1160561162 18:79756397-79756419 TCTGGAAGGCTGGCCCAGGACGG + Exonic
1160562427 18:79766971-79766993 CCTGGTGGGCAGAGCAAGGATGG - Intergenic
1160872857 19:1285126-1285148 CCTGGTAGGCTGACACAGGTGGG - Intergenic
1161014398 19:1976514-1976536 GCTGCAAGGCACGCCCAGGACGG + Intronic
1161516789 19:4700884-4700906 CCTGGAGGCCAGAGCCACGAGGG - Intronic
1161534349 19:4809821-4809843 TCTGGAAGGCAGCTCCAGGCAGG - Intergenic
1162189370 19:8932683-8932705 CCTGGAAGGCAGGCTTAGGGAGG + Intronic
1162454376 19:10774195-10774217 CCTGAAAGGCTGAGTCAGGAGGG + Intronic
1162492005 19:10998265-10998287 TCTGGCAGGCAGACCCAACATGG + Intronic
1162566643 19:11448464-11448486 CCAGGACGACAGACACAGGAGGG - Intronic
1163413428 19:17171281-17171303 CCTGGGAGGCAGACTCAGTCAGG + Intronic
1163513611 19:17749939-17749961 CCTGGAAGCCAGATCGTGGAAGG + Intronic
1163695523 19:18761515-18761537 CTTGGAAGGCAGCACCAGGCAGG + Intronic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1164171585 19:22730057-22730079 ATTGGAAGGTAGACCCAGGGAGG - Intergenic
1164604671 19:29589222-29589244 CCTGGTACACAGAGCCAGGATGG - Intergenic
1164767274 19:30781613-30781635 CCTGCAAAGCACAGCCAGGATGG + Intergenic
1164915848 19:32051888-32051910 CCCTGAAGGCAGATCCAGGCAGG - Intergenic
1164925799 19:32129104-32129126 CCTGGAAGGCAGAACTTGGTGGG - Intergenic
1165064645 19:33221816-33221838 CCTGGTCAGCAGACCCAGGGGGG + Intronic
1165280768 19:34795380-34795402 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1165834437 19:38745550-38745572 CCAGGGAGGCTGACCCTGGAGGG + Intronic
1165886702 19:39084146-39084168 GCGGGAAGGGGGACCCAGGAAGG - Intronic
1166570296 19:43791632-43791654 CCTGGAAGGCAGAGCTTGCAGGG - Intergenic
1166752384 19:45170475-45170497 CCAGGACGGCAGCCCCCGGAGGG + Intronic
1167176543 19:47868383-47868405 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1167728348 19:51234640-51234662 CCTAGAAGGCACAGCCAGGCAGG + Intronic
1168102875 19:54150239-54150261 CCTGGGAGACAGGCCCAGGAAGG + Intronic
1168125191 19:54278943-54278965 CCTGGCCGGCAGCCCCAGGCTGG - Exonic
1168133813 19:54337531-54337553 CCTGGCCGGCAGCCCCAGGCTGG - Exonic
1168169281 19:54575399-54575421 CCTGGTTGGCAGCCCCAGGCTGG + Exonic
1168516420 19:57013337-57013359 CCTGGAAGGTACCCCCTGGATGG - Intergenic
925222044 2:2149780-2149802 CCTGAAATGCAGACCTGGGATGG - Intronic
925397517 2:3546323-3546345 CCAGGAAGGCAGAACAAGGCAGG + Intronic
926156227 2:10455461-10455483 CCAAGAAGGCTGCCCCAGGAAGG + Intergenic
926172542 2:10561409-10561431 CCTGGAAGGCAGACCTAGCAAGG + Intergenic
926205562 2:10832708-10832730 CCTGGAAGGAAGACCGAGGCGGG - Intronic
927680000 2:25132831-25132853 GCTGAAAGGCTGAACCAGGAGGG + Intronic
928715387 2:34055045-34055067 CCTGGAAATCATACCCAAGAAGG - Intergenic
928863835 2:35894697-35894719 CCTGGAAAGCCTTCCCAGGAAGG - Intergenic
929477658 2:42268542-42268564 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
930400834 2:50883929-50883951 CCAGGAAGGGAGCACCAGGATGG + Intronic
931000629 2:57777162-57777184 ACTGGAAGACAAACACAGGAAGG + Intergenic
931649361 2:64454363-64454385 CCTGGCAGGCAGAGCCTGGGAGG - Exonic
931728980 2:65136358-65136380 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
931913951 2:66932808-66932830 CATGGAGGGTAGTCCCAGGAGGG + Intergenic
932317718 2:70796975-70796997 CCAGGAGGGCAGACCCAGCAGGG - Intergenic
932569633 2:72931766-72931788 GCTGGAAAGCTGGCCCAGGAAGG - Intronic
932630280 2:73336023-73336045 CTTGGAAGGCTGAGGCAGGAAGG + Intergenic
934077588 2:88441100-88441122 CGTGTAAGGCAGAGGCAGGAGGG + Intergenic
934122751 2:88855890-88855912 CCTGGAAGGCAGACTCATTCAGG + Intergenic
934679673 2:96274396-96274418 CCTGGGAGGCAGCACCAGAAAGG - Exonic
936029150 2:109057844-109057866 CCAGCCAGGCAGACCCAGGCAGG - Intergenic
936153980 2:110036423-110036445 GCTGGGAGGCAAACCCAGCAGGG - Intergenic
936190705 2:110334992-110335014 GCTGGGAGGCAAACCCAGCAGGG + Intergenic
938303706 2:130234399-130234421 TCTAGAAGGCAGACCCATCAGGG + Intergenic
938452972 2:131439868-131439890 TCTAGAAGGCAGACCCATCAGGG - Intergenic
938727701 2:134121554-134121576 CCTGGCAGTCGGTCCCAGGAGGG - Intronic
939519820 2:143215609-143215631 CATGTGAGGCAGACACAGGAGGG + Intronic
940672805 2:156690953-156690975 CCTGGTAGGCAGATCCATGCTGG - Intergenic
942000950 2:171646679-171646701 ACTGGGAGGCACACCCAGTAGGG - Intergenic
944579018 2:201116400-201116422 CCGGGAAGGCGCACCCAAGATGG - Exonic
946353689 2:219171832-219171854 CTTGGAAGGCAGATACAGGGAGG + Intergenic
946408788 2:219506414-219506436 CCAGGAAGCCATACCCAGGATGG - Exonic
946436985 2:219663716-219663738 CCAGGAAGGAAGAGCCATGAAGG - Intergenic
946643742 2:221811709-221811731 ATTAGAAGGCAGGCCCAGGATGG - Intergenic
947056298 2:226107972-226107994 ACTGGGAGGCAGCCCCAGTAGGG + Intergenic
947615978 2:231557217-231557239 CCGGGAACACAGACCCAAGAGGG + Intergenic
947617647 2:231568715-231568737 CCTGGAAGGCTAACTCTGGAAGG - Intergenic
948807388 2:240458929-240458951 GCAGGATGGCAGACCCAGGGTGG - Intronic
948844708 2:240677498-240677520 CCAGGAGGGCAGGCCCAGGGAGG + Intronic
948849152 2:240697381-240697403 CCAGGAGGGCAGGCCCAGGGAGG - Intronic
1169002764 20:2179872-2179894 CGTGGAAGGCAGACACAGCTTGG - Intergenic
1169068700 20:2708610-2708632 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1169464323 20:5823985-5824007 GCTGGAAAGGAGACCAAGGAGGG - Intronic
1169889255 20:10434759-10434781 CCTGGAACCCAGAAGCAGGATGG - Intergenic
1170531328 20:17295655-17295677 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1170920511 20:20674508-20674530 ACTGGAAGGCTGACTCAGGGCGG + Intronic
1171791167 20:29526618-29526640 ACTGGGAGGCAGCCCCAGCAGGG + Intergenic
1172114377 20:32564932-32564954 CCAGGAAGGCTGGCCCAGGGAGG + Intronic
1172190839 20:33061028-33061050 CCTGGAAGGTGGACACAGAACGG - Intronic
1172198902 20:33111631-33111653 CCTGGCAGGCTGACCATGGAAGG - Exonic
1172630081 20:36372307-36372329 ACTGGGAGTCAGACCCAGGTAGG + Intronic
1173207649 20:41007301-41007323 CATGGAAGGGAGACCAAGGAAGG - Intergenic
1174292729 20:49520277-49520299 GCAGGAAGGCAGGCCCAGGAAGG - Intronic
1174339683 20:49887954-49887976 TCAGGCAGGCAGGCCCAGGATGG + Exonic
1174570704 20:51499125-51499147 CCGGGAGGGGAGACACAGGAGGG + Intronic
1174794406 20:53510363-53510385 CCTGGGAAGCAGACCAAGGAGGG - Intergenic
1175092148 20:56513311-56513333 CCTGGAAGGCAGCCCCACACTGG - Exonic
1175263618 20:57689713-57689735 CCTGGGAGGCAGATTCAGGGCGG - Intronic
1176024211 20:62977587-62977609 CCTGGAAAGCAGGGCCCGGAGGG + Intergenic
1176033054 20:63023133-63023155 CCTGGGAAGGAGACTCAGGACGG - Intergenic
1176257735 20:64160886-64160908 CCTGCCAGGCAGATCCAGGCAGG - Intronic
1177381526 21:20351021-20351043 TCTGGGAAGCTGACCCAGGAGGG + Intergenic
1177824607 21:26068465-26068487 CTTGGAAGGCTGAGACAGGAAGG - Intronic
1177948605 21:27505103-27505125 CTTGGAAGGCTGAGACAGGAGGG + Intergenic
1179091322 21:38268704-38268726 CCTGGAATTCACATCCAGGAAGG - Intronic
1179657705 21:42855386-42855408 CCTGGCTGGCAGACCCACAAAGG + Intronic
1179779514 21:43690419-43690441 CCTGGACGGCAGGGCCTGGAGGG - Exonic
1179891432 21:44337329-44337351 CCTGGAAAGGAATCCCAGGAGGG - Intronic
1180090091 21:45529415-45529437 CCTGGAGGGGAAGCCCAGGAAGG + Intronic
1180500298 22:15923910-15923932 CCCTGCAGGCAGACCCAGGAAGG - Intergenic
1180555664 22:16569740-16569762 CCTGGATTGCACACACAGGATGG - Intergenic
1180616235 22:17129939-17129961 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1181488127 22:23244497-23244519 GGAGGAAGACAGACCCAGGAAGG - Intronic
1181617030 22:24061925-24061947 CCTGCAGGACAGACACAGGAAGG - Exonic
1181788407 22:25244037-25244059 GCTGGAAGCCAGGCCCAGGTGGG + Intergenic
1181820087 22:25468735-25468757 GCTGGAAGCCAGGCCCAGGTGGG + Intergenic
1182074365 22:27484949-27484971 CCTGGATGGCAGAGCAAGGCTGG - Intergenic
1182353508 22:29711632-29711654 CCTGGTAGGCAGGGCCAGGTGGG - Intergenic
1182584649 22:31337404-31337426 CCTGGAAGGAGGACTCAGGTTGG + Intronic
1182880018 22:33725132-33725154 CGCGGGAGGCAGAGCCAGGAGGG + Intronic
1183119806 22:35721672-35721694 GGGTGAAGGCAGACCCAGGAAGG - Intronic
1183277892 22:36912613-36912635 CCTGGGAGGCAGCCCCATGTAGG + Intergenic
1183302055 22:37063303-37063325 CCGGGAAGTCAAACACAGGAGGG - Exonic
1183410668 22:37653498-37653520 CCTGGTAGGTAGGGCCAGGATGG - Intronic
1183703717 22:39464171-39464193 CCTGGAAGCAAGTCCCAGGCAGG + Intronic
1184192998 22:42907553-42907575 CCTGCAAGGCTGACACAGGCAGG + Intronic
950106770 3:10393523-10393545 CCAGGAAGGCAGAGCTGGGATGG + Intronic
950250289 3:11459582-11459604 CCTGGAAGCCAGAGCCAACAGGG + Intronic
950658937 3:14454477-14454499 CCTGGAAGTCAGACACGGAAGGG + Intronic
950956831 3:17062923-17062945 ACAGGAAGGCAGATTCAGGACGG - Intronic
951842083 3:27045235-27045257 TTTGAAAGACAGACCCAGGAAGG - Intergenic
952412770 3:33064330-33064352 CTTGGGAGGCTGACACAGGAGGG + Intronic
952723246 3:36555361-36555383 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
952860165 3:37806475-37806497 CCTGAGAGGCAGAGCCAGGTGGG - Intronic
953163276 3:40441916-40441938 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
953236855 3:41114432-41114454 TTTGGAAGGCAGAGACAGGAAGG + Intergenic
953373789 3:42411846-42411868 CCTAGAAGGCAGTCCTATGAGGG - Intergenic
953417745 3:42732609-42732631 GCTAGAAGCCAGGCCCAGGAAGG + Intronic
953607206 3:44419755-44419777 CATGGAAGTCAGCCCCAGGCTGG - Intergenic
953704292 3:45219715-45219737 CCAGCAAGGAAGACCCAAGAAGG + Intergenic
953877590 3:46675142-46675164 CCTGCAAGGCAGTGACAGGAAGG + Intronic
955052961 3:55430449-55430471 CCTGGAAGGTAGCCAGAGGATGG + Intergenic
955320329 3:57969937-57969959 CCTGGAAGGCAGGATGAGGAGGG - Intergenic
955376255 3:58399781-58399803 CCTGGAGGGCAGACCCTTCAAGG - Intronic
955728776 3:61961169-61961191 CCTGGAAGGAGGGGCCAGGAAGG + Intronic
956018304 3:64907762-64907784 CCTAGGAGGCAGCCCTAGGATGG + Intergenic
956730635 3:72193665-72193687 TCTGGAACACAGTCCCAGGAAGG + Intergenic
956761578 3:72448527-72448549 CCAGGCAGGCGCACCCAGGAGGG + Intergenic
959075331 3:101743501-101743523 CTTGGAAGGCTGAGACAGGACGG - Intronic
960440217 3:117677753-117677775 CCTGGGAGGCTGAGGCAGGAGGG - Intergenic
962283358 3:134068049-134068071 CCACGGAGGCAGACCCAGAACGG - Intronic
962467315 3:135672882-135672904 CCTGGCAGACAGATCCAGAAAGG - Intergenic
963443849 3:145375579-145375601 CCTGGAAGGCCATCCCAAGAAGG + Intergenic
963590692 3:147254349-147254371 CCTGGAAGTCAGAGTCAGGAGGG - Intergenic
966368320 3:179215929-179215951 CCTGGATTGCACACACAGGATGG - Intronic
966651015 3:182301161-182301183 CCTGGAAAGCAGCCCCAGGTAGG + Intergenic
966855830 3:184193343-184193365 GCTGGAAGGCAGAACCAGGAAGG - Exonic
968404022 4:323858-323880 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
968623924 4:1618111-1618133 CCTGGAAGGAAGACAGAGGCAGG + Intronic
969093282 4:4712910-4712932 ACTGCAATGCAGACCCAGCAAGG - Intergenic
970233310 4:13933145-13933167 GTTGGAAGGCAGAAGCAGGAGGG + Intergenic
971137529 4:23886167-23886189 CTTGGAAGGCAGGGCCATGAGGG - Intronic
972794010 4:42398431-42398453 CCTGGCGCACAGACCCAGGAAGG - Intronic
974414843 4:61594441-61594463 CCTGGAAGGCCTTCCCAAGAAGG - Intronic
976405816 4:84659564-84659586 CCTAGCAGACAGATCCAGGAGGG - Intergenic
977736362 4:100421277-100421299 GCTGGAAGGCAGATCCGGGTAGG - Exonic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
981221996 4:142248024-142248046 CCTGGAGGGCAGGGGCAGGAGGG - Intronic
981520208 4:145652975-145652997 CCTGGGAGGCTGAGGCAGGAGGG - Intronic
981748605 4:148073150-148073172 CCTGGAAGGCAGAGGCATGCTGG - Intergenic
984325150 4:178241862-178241884 CATGGAAGGGAGGCCAAGGAGGG + Intergenic
984887368 4:184461978-184462000 CCTAGAAGGCAGACGGAGGCTGG - Intronic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
985102854 4:186475420-186475442 TCTCGCAGGCAGACCCTGGAGGG + Intronic
985684410 5:1274232-1274254 CCTGGAAGGCAGTAACAGGAAGG + Intronic
985942302 5:3147006-3147028 CATGGAAGGTGGTCCCAGGAAGG - Intergenic
986332688 5:6729132-6729154 GCTGGAAGCCACACTCAGGAAGG - Intronic
986860337 5:11920115-11920137 CCTAGAAGGAAGACCATGGAAGG - Intergenic
988486080 5:31669161-31669183 CCTGTCTGGGAGACCCAGGAGGG + Intronic
990708517 5:58557545-58557567 ACTGGGAGGCACCCCCAGGAGGG - Intronic
993899905 5:93578450-93578472 CCAGGAAGGCAGAGGAAGGAAGG + Intergenic
994899785 5:105757077-105757099 CCTGGAAGGCTGAGGCAGGATGG + Intergenic
995066346 5:107867545-107867567 TCAGGATGGCAGGCCCAGGAGGG + Intronic
995853789 5:116573300-116573322 TCTGGAAAGATGACCCAGGAGGG - Intronic
996087703 5:119321537-119321559 CACGAAAGGCAAACCCAGGAAGG - Intronic
996087878 5:119322662-119322684 CCTGCAAAGAAGACCAAGGAGGG - Intronic
997065681 5:130556112-130556134 CCTGGGATGGAGACCCAGGATGG + Intergenic
997408713 5:133673399-133673421 CCAGGATAGCAGAGCCAGGAGGG - Intergenic
998004343 5:138647301-138647323 CCTGGAGGGCAGTTCTAGGAGGG + Intronic
998452268 5:142244245-142244267 CATGGAAGGCAGGCACAGGGGGG - Intergenic
998605925 5:143634509-143634531 CCTGGGAAGAAGAACCAGGATGG + Intergenic
1002298966 5:178247019-178247041 CCAGGGAGGCAGACACAGAAGGG - Intronic
1002575279 5:180170731-180170753 CCAGGCAGGCAGGCCCGGGAGGG - Intronic
1002641608 5:180633123-180633145 CCTGGGACGCAGCACCAGGACGG + Intronic
1002711010 5:181195070-181195092 CACGGAGGGCAGACCCAAGACGG + Exonic
1004116674 6:12775102-12775124 CCTGGAAGGATGACACAGTAAGG - Intronic
1004459006 6:15818164-15818186 AGTGGAAGGCAGTCTCAGGAAGG + Intergenic
1006449546 6:34098361-34098383 CCTGGAGGGCATGCCCAGGAGGG - Intronic
1007119750 6:39370002-39370024 ACTGGAAGGCTGCCCCTGGAGGG - Intronic
1007159348 6:39776273-39776295 ACTAGAAGGCAGACTCAGGAGGG - Intergenic
1007269291 6:40624006-40624028 CCTGAATGTCAGATCCAGGAGGG - Intergenic
1007703157 6:43775953-43775975 TCTGGAAAGCAGACCTTGGAGGG + Intronic
1008045702 6:46849370-46849392 GCAGGATGGAAGACCCAGGATGG + Intergenic
1009315551 6:62214659-62214681 TCTGAAAGGGAGACCTAGGAAGG + Intronic
1011102788 6:83743280-83743302 CCTGGAAAGCCTTCCCAGGAAGG - Intergenic
1013747221 6:113359752-113359774 TCTGGGACACAGACCCAGGAGGG - Intergenic
1015158640 6:130126360-130126382 TGTGGTAGGCTGACCCAGGAGGG - Intronic
1016677468 6:146788209-146788231 CCTAGAAGGCTGACCCAGGCAGG - Intronic
1017015162 6:150093962-150093984 CCTGGAAGGCATCCCGAGAATGG - Intergenic
1017522399 6:155213754-155213776 CATGGGAGGCAGGCCAAGGAGGG - Intronic
1017795579 6:157841389-157841411 CCTGGAGGTCACACACAGGATGG + Intronic
1017807056 6:157955028-157955050 CGTGGGAGGCAGTCCCAGGGAGG + Intergenic
1018203804 6:161417969-161417991 CCTGGGGGCCAGGCCCAGGAGGG - Intronic
1019518150 7:1448553-1448575 CCTGGGAGCCAGGCCAAGGATGG + Intronic
1020478569 7:8628872-8628894 CCTTGAAGCCAGACCCCGTATGG + Intronic
1022476861 7:30716688-30716710 CCAGGCAGGCAGACCCAGAGAGG - Intronic
1023335166 7:39161498-39161520 CCTGCCAGGCAGATCCAGGCTGG + Intronic
1023795437 7:43788245-43788267 ACTGGAAGACAGAGGCAGGAGGG + Intronic
1023856774 7:44188929-44188951 GCTGGACGACAGAGCCAGGATGG - Intronic
1024022877 7:45387370-45387392 CCTGGAGTCCAGCCCCAGGATGG + Intergenic
1024096464 7:45986653-45986675 CATAGAAGGCAGGCCCAGGATGG + Intergenic
1026538550 7:71260700-71260722 CTTGGGAGGCTGACGCAGGAGGG - Intronic
1026899102 7:74027498-74027520 CCTGGAAGGTAGGCCCGGGTTGG - Intergenic
1026909208 7:74082993-74083015 CGTGGAAGGTAGACCTAGGGGGG + Intronic
1029451963 7:100646493-100646515 CCTGGACAGCTGAGCCAGGACGG + Intronic
1029650180 7:101886166-101886188 TATGGAAGGCAGACCCTGTAGGG - Intronic
1031642406 7:124180970-124180992 CCTAGCAGGCAGACACAGGTGGG - Intergenic
1032098093 7:128949564-128949586 CCTGGAAGGCAAAGCCAGCCAGG - Intronic
1032180000 7:129667094-129667116 ACTGGAAGATATACCCAGGAGGG + Intronic
1033664915 7:143431296-143431318 CTGTAAAGGCAGACCCAGGATGG - Intergenic
1034496887 7:151428486-151428508 CATGGGAGGGAGGCCCAGGAAGG + Intergenic
1036307288 8:7611519-7611541 CAGGGATGGCAGTCCCAGGATGG + Intergenic
1036358132 8:8059506-8059528 CAGGGATGGCAGTCCCAGGATGG + Intergenic
1036892819 8:12607440-12607462 CAGGGATGGCAGTCCCAGGATGG - Intergenic
1037536288 8:19827604-19827626 CCTGGACACCAAACCCAGGAGGG - Intronic
1037616148 8:20520498-20520520 CCTGGAAGGCAATACCAGGAAGG - Intergenic
1039217566 8:35289874-35289896 CTTGGAAGGCTGAGACAGGAGGG + Intronic
1040298936 8:46178011-46178033 CCTGCAGGGCTGTCCCAGGAGGG + Intergenic
1040388842 8:46932869-46932891 GCTGGAAGGCAGATCCTGGTGGG - Intergenic
1040598930 8:48865497-48865519 CCTGGAAGGCAGAGGCCTGAGGG + Intergenic
1042824662 8:72967893-72967915 TTTGGAAGGCAAAGCCAGGAGGG + Intergenic
1045318035 8:101059986-101060008 CATGGAGGGGAGACCCAGGCTGG - Intergenic
1046742064 8:117840212-117840234 CCTGTAAGGCAGAGCTAGTAGGG - Intronic
1047127529 8:121978944-121978966 TCTGAATGACAGACCCAGGATGG + Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1047735410 8:127760912-127760934 CCTCCAGGGCAGAGCCAGGATGG - Intergenic
1048029733 8:130620371-130620393 CCTGGAAGGCCTTCCCAAGAAGG - Intergenic
1048307466 8:133294395-133294417 CCTGGAAGGAAGGCCAGGGAGGG - Intronic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1048950960 8:139496430-139496452 CCTGGAATGAAGAGCCAGAACGG + Intergenic
1049240449 8:141535166-141535188 GCAGGAAGGAAGAGCCAGGAGGG + Intergenic
1049475459 8:142795124-142795146 CCAGGCAGGCTGACTCAGGAGGG - Intergenic
1049519311 8:143080159-143080181 CCGGCCAGGCAGATCCAGGAAGG - Intergenic
1049672950 8:143877859-143877881 CGTGGGAGGCAGAGGCAGGAAGG - Intronic
1049781246 8:144429923-144429945 TCTGGAAGACAACCCCAGGAAGG - Intronic
1049840594 8:144768669-144768691 CCAGGTAGGAAGGCCCAGGATGG - Intergenic
1049924587 9:396463-396485 CCTGGAAGGCAGACCTGAGCTGG - Intronic
1050404292 9:5291869-5291891 CCTGAAATGCAGACCGAGAAAGG + Intergenic
1050946133 9:11520679-11520701 CCTGCAACACAGACCCAGAAGGG - Intergenic
1051454903 9:17244458-17244480 TTTGGAAGGCAGAGGCAGGAGGG - Intronic
1052420371 9:28235345-28235367 CCTGGAAAGCCTCCCCAGGAAGG + Intronic
1053144826 9:35705318-35705340 CCAGAAAGGCAGGCCCGGGAAGG + Intronic
1053353156 9:37426427-37426449 CCTGGCAGGCAGATCAAAGAGGG + Intronic
1055815126 9:80195862-80195884 GTTGGAAGGCAGAACAAGGAAGG - Intergenic
1056853167 9:90101743-90101765 TTTGGGAGGCAGGCCCAGGAGGG - Intergenic
1057032089 9:91783726-91783748 CCTGGAGGGCACACCAGGGATGG + Intronic
1057230729 9:93319890-93319912 CCTGCAATGCACACGCAGGAGGG - Intronic
1057714119 9:97476042-97476064 CCTGGAAGACACAGACAGGAAGG - Intronic
1057842856 9:98500410-98500432 CCTGGAAGGGAGCCCCAGGAGGG + Intronic
1057923559 9:99121265-99121287 GCTGCAAGGTAGCCCCAGGAGGG + Intronic
1060878756 9:127102958-127102980 CCTTGAAGGCTGACTCAGGATGG + Intronic
1061045684 9:128163725-128163747 CCAGGCAGGCAGACCCACCAGGG - Exonic
1061589692 9:131590417-131590439 CCAGGGAGGCAGCCTCAGGATGG - Intronic
1061591907 9:131603246-131603268 CCTTGAAGGGAGGCCCATGAGGG - Intronic
1061634656 9:131899690-131899712 TCTCGATGGCAGAGCCAGGAGGG - Intronic
1061802276 9:133119253-133119275 CCAGGAAACCAGCCCCAGGACGG + Intronic
1061868337 9:133506864-133506886 CCTGGAAGCTCGACCCAGGCTGG - Intergenic
1061868575 9:133507917-133507939 CTTGGGAGGCAGACACAGGCTGG - Intergenic
1061966969 9:134020447-134020469 CCTGGGAGGCTGAGGCAGGAGGG - Intergenic
1062059310 9:134486419-134486441 CATGGAAGGCAGAGCCGGGCTGG + Intergenic
1062453808 9:136626580-136626602 CCGGGAAGCCAGAGCCACGACGG + Intergenic
1062509188 9:136895475-136895497 CCTGGACGACAGCCCCAAGATGG - Intronic
1062690001 9:137836841-137836863 CTGGGCAGGCGGACCCAGGATGG + Intronic
1185527512 X:791079-791101 CTTCGAAGGCAGACCGGGGAGGG - Intergenic
1186440631 X:9583181-9583203 CCTGGAGGACAGACACAGAAGGG - Intronic
1189695030 X:43654900-43654922 CCGGGAAGGCGGAGCCAGGCCGG + Intronic
1190215761 X:48478533-48478555 CCCAGATGGGAGACCCAGGAGGG + Intronic
1190602559 X:52107809-52107831 CCTGGAAAGCCTACCCAGGAAGG - Intergenic
1190717069 X:53114004-53114026 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1191717170 X:64201735-64201757 CCTGGCAGGTAGAACCAAGAGGG - Intronic
1191946821 X:66543695-66543717 CCTGGAAAGCCTACCCACGAAGG - Intergenic
1192055465 X:67769101-67769123 CCTGGAAGACTCACCCAGGGAGG - Intergenic
1192401383 X:70839225-70839247 ACTGGGAGGCACCCCCAGGAGGG + Intronic
1195118946 X:101729896-101729918 CTTTGAAGTCAGACCCAGGTTGG - Intergenic
1196639385 X:118040114-118040136 CCTGGAAAGCCTTCCCAGGAAGG + Intronic
1199156271 X:144552035-144552057 CCTGGAAAGCAGTCCCAAGAAGG + Intergenic
1199189598 X:144954079-144954101 CCTGGAAAGCATTCCCAAGAAGG + Intergenic
1199978068 X:152905877-152905899 CCTGGAGGGGAGTCCCTGGAGGG - Intergenic
1200591921 Y:5086554-5086576 CCTGGAAAGCATTCCCAGAAAGG - Intronic
1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG + Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202263917 Y:22998311-22998333 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202416908 Y:24632053-24632075 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202453879 Y:25038033-25038055 CTTTGAAGGCAGAGCCACGATGG + Exonic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic