ID: 1151320394

View in Genome Browser
Species Human (GRCh38)
Location 17:73349160-73349182
Sequence GGGCCCCGGAGCCAGCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 8, 3: 45, 4: 432}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151320390_1151320394 -5 Left 1151320390 17:73349142-73349164 CCCTTGTTACATGTAGTAGGGCC 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG 0: 1
1: 0
2: 8
3: 45
4: 432
1151320391_1151320394 -6 Left 1151320391 17:73349143-73349165 CCTTGTTACATGTAGTAGGGCCC 0: 1
1: 0
2: 1
3: 1
4: 42
Right 1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG 0: 1
1: 0
2: 8
3: 45
4: 432
1151320389_1151320394 -4 Left 1151320389 17:73349141-73349163 CCCCTTGTTACATGTAGTAGGGC 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG 0: 1
1: 0
2: 8
3: 45
4: 432
1151320385_1151320394 11 Left 1151320385 17:73349126-73349148 CCACGTGTGAAATGCCCCCTTGT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG 0: 1
1: 0
2: 8
3: 45
4: 432
1151320387_1151320394 -3 Left 1151320387 17:73349140-73349162 CCCCCTTGTTACATGTAGTAGGG 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG 0: 1
1: 0
2: 8
3: 45
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151320394 Original CRISPR GGGCCCCGGAGCCAGCCTGG CGG Intronic
900142670 1:1145142-1145164 GGGCCACGGTGTCAGCCAGGAGG - Intergenic
900213154 1:1467353-1467375 GGGCCCCTGAGCCACAGTGGCGG + Intronic
900218366 1:1494409-1494431 GGGCCCCTGAGCCACAGTGGCGG + Intronic
900220723 1:1508174-1508196 GGGCCCCTGAGCCACAGTGGCGG + Intergenic
900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG + Intronic
900243163 1:1626311-1626333 GGGCCCGTGAGCCAGCGTGGGGG - Intronic
900467452 1:2832792-2832814 GAGCCCCAGACCCAGGCTGGAGG - Intergenic
900569868 1:3352952-3352974 GGGCCCCGAAGCCTGCAGGGTGG - Intronic
900619574 1:3580646-3580668 GGGCACCCGGTCCAGCCTGGGGG - Intronic
901425331 1:9179042-9179064 GGGCCCTGGGGTGAGCCTGGTGG + Intergenic
901633677 1:10659845-10659867 GGGTGCGGGAGCCAGGCTGGGGG + Exonic
901640540 1:10690905-10690927 GGGCCTGGGAATCAGCCTGGTGG + Intronic
901793090 1:11664568-11664590 TGGCCCCGGGGCCACCCAGGCGG + Intronic
901813358 1:11779945-11779967 GGGCCCAGGAGCGGGGCTGGCGG + Exonic
901878597 1:12181085-12181107 CGGGCCTGGTGCCAGCCTGGGGG + Intronic
901987930 1:13091028-13091050 GGGTCCCTGTGCCTGCCTGGAGG - Intergenic
901993882 1:13135739-13135761 GGGTCCCTGTGCCTGCCTGGAGG + Intergenic
902336445 1:15757609-15757631 CAGCCCCAGAGCCACCCTGGAGG + Intronic
902740183 1:18432505-18432527 AGGCCTTGGGGCCAGCCTGGAGG + Intergenic
903055502 1:20633533-20633555 GGGCCGCGGCGCCACCATGGCGG + Exonic
903541007 1:24096363-24096385 GGGGCCAAGAGCAAGCCTGGTGG + Intronic
906107529 1:43303878-43303900 GGACCCCTGCTCCAGCCTGGGGG - Intronic
907321430 1:53605222-53605244 TGGCCCCAGAGCCAGGCTGAAGG - Intronic
909094550 1:71271095-71271117 GGGCCGCGGGTCCAGGCTGGAGG + Intergenic
910488846 1:87746059-87746081 GGGCCGCGGATCCAGGCTTGAGG - Intergenic
913115511 1:115692714-115692736 GGGCAGAGGAGCCATCCTGGCGG + Exonic
915491090 1:156250416-156250438 GGGCCCAGGAGCCGGCTGGGAGG - Exonic
918108804 1:181437760-181437782 GGGCCCAGAAGCCAGCCCTGGGG - Intronic
918393494 1:184090793-184090815 GGACACCTGAGCAAGCCTGGAGG - Intergenic
919730743 1:200912155-200912177 GGACCCCGGGGCCAGGCAGGAGG + Intronic
919896135 1:202010886-202010908 GGGCCCTGGAGCCAGACTAGCGG - Exonic
919978061 1:202625692-202625714 GGGCCTGGGAGGGAGCCTGGCGG - Intronic
922722452 1:227905840-227905862 GGGCCCTGTGGCCAGCATGGTGG + Intergenic
922800211 1:228361667-228361689 GGACCCCTGAGCCAGCCTCGGGG - Intronic
1062999370 10:1900156-1900178 GGGAACAGGAGCCAGGCTGGGGG + Intergenic
1064015146 10:11765796-11765818 GGGCCGGGAAGCCAGACTGGAGG - Intergenic
1065025111 10:21534130-21534152 GGGCCCCGGAGGTAGGCCGGGGG + Intergenic
1066013784 10:31217729-31217751 GGGCCCCTGAGCCTGCCCGCTGG + Intergenic
1066058971 10:31705916-31705938 TGGGCACAGAGCCAGCCTGGGGG - Intergenic
1067038934 10:42938421-42938443 GGGCCCAGGAGCTGGGCTGGGGG - Intergenic
1067351931 10:45484339-45484361 GGGCCCACGAGCCATCCTGGAGG - Intronic
1067385323 10:45813103-45813125 TGGCTCCCGAGCCAGCCGGGAGG - Intergenic
1067429678 10:46234724-46234746 GGTCCCTGGAGCCAGCCTTGAGG - Intergenic
1067440680 10:46307808-46307830 TGGCCCCTGAGCCTGCCTGGTGG + Intronic
1067443973 10:46329201-46329223 GGTCCCTGGAGCCAGCCTTGAGG + Intronic
1067587548 10:47484915-47484937 TGGCTCCCGAGCCAGCCGGGAGG - Intergenic
1067634604 10:47992681-47992703 TGGCTCCCGAGCCAGCCGGGAGG - Intergenic
1070141416 10:73740983-73741005 GAGCTCCCGAGCCAGCCGGGAGG - Intergenic
1070538852 10:77401485-77401507 GTGTCCTGGAGACAGCCTGGTGG - Intronic
1070753053 10:78975117-78975139 GGACCCCGCAGCCAGCCTGCTGG - Intergenic
1070808206 10:79283266-79283288 AGGCCCTGGAGCCAGGCTGCTGG + Intronic
1071610440 10:87027001-87027023 GAGCTCCCGAGCCAGCCGGGAGG + Intergenic
1072757830 10:98031924-98031946 GGGCCCAGAAGCCAGACTAGTGG - Intergenic
1073062951 10:100743100-100743122 GCGGCCAGGAGCCGGCCTGGCGG + Intronic
1073177500 10:101565406-101565428 TGGCCCCTGACCCAGCCTAGAGG + Intergenic
1073249829 10:102114650-102114672 GGGCCAGGGGGCCGGCCTGGGGG + Intronic
1073266387 10:102230736-102230758 GGCGGCCGGAGCCAGCCCGGGGG + Exonic
1074204187 10:111267829-111267851 GGGCCCCGGAGGGAGACTGCAGG - Intergenic
1075088008 10:119426423-119426445 GGGACTCGGACCCAGGCTGGGGG - Intronic
1075405945 10:122195863-122195885 GGGCCCCCTGGCCAGCCTGTGGG - Intronic
1075559943 10:123460898-123460920 AATCCCAGGAGCCAGCCTGGTGG + Intergenic
1075602609 10:123781433-123781455 AGGTCCCCCAGCCAGCCTGGTGG + Intronic
1076242314 10:128917623-128917645 GTGCCCAGGAGCCAGCATGATGG - Intergenic
1076328128 10:129644395-129644417 TGGCCCCGACGCCAGCCTAGGGG - Intronic
1076916176 10:133424004-133424026 GGGCGGGGGAGCAAGCCTGGGGG + Intronic
1076936284 10:133568799-133568821 GGGCGGGGGAGCAAGCCTGGGGG + Intronic
1076984549 11:225888-225910 GGGCTACTGAGCCAGCCTGAGGG + Intronic
1077111169 11:862862-862884 GGGCCACACTGCCAGCCTGGAGG - Intronic
1077145576 11:1042794-1042816 GGGACCCTGAGCCAGCCTGGGGG + Intergenic
1077230541 11:1456540-1456562 TGGGCCCGGAGCCGCCCTGGGGG - Intronic
1077315923 11:1919329-1919351 GGTCCCCAGAGCCAGGCTGCCGG - Intergenic
1077326458 11:1966039-1966061 GGGCCCCGGAGCAGGCCTGGTGG + Intronic
1077342659 11:2032981-2033003 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1077419194 11:2441639-2441661 GGGCCCAGGAGACAGCCCTGGGG + Intergenic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1077614895 11:3667544-3667566 CGGCGCTGCAGCCAGCCTGGCGG - Exonic
1079079730 11:17405887-17405909 GGGCCCTGGGGACAGCCTGCCGG + Intronic
1079083816 11:17431360-17431382 AGGCCACTGAGCCAGCCAGGTGG - Intronic
1083265944 11:61546888-61546910 GGGCCCCGGGACCAGCTGGGGGG + Intronic
1083770628 11:64864892-64864914 GGGCCCCCCAGCCATCCAGGGGG - Intronic
1083849068 11:65354903-65354925 GGGCTCGGGAGCCGGGCTGGGGG + Exonic
1083887841 11:65581435-65581457 GGGCCCTGGAGGCAGGTTGGTGG - Intronic
1084345127 11:68541922-68541944 GGGCCCAGGTGAAAGCCTGGAGG + Intronic
1084555987 11:69876121-69876143 TGGCTCCGGATCCAGCCTGGGGG + Intergenic
1084564070 11:69919797-69919819 AGGCCCTGGAGCCAGCAGGGAGG - Intergenic
1084597942 11:70128408-70128430 GAGCCCTGGAGGAAGCCTGGGGG + Intronic
1084971577 11:72774989-72775011 AGGGCACAGAGCCAGCCTGGGGG + Intronic
1085408981 11:76280684-76280706 GGGCCCTGCAGCCTGGCTGGTGG - Intergenic
1086103860 11:83128910-83128932 GGCCACAGGTGCCAGCCTGGTGG - Intergenic
1087094546 11:94306684-94306706 GGGCCCTGGATCCAGCCAGTGGG + Exonic
1088818305 11:113436074-113436096 GGTCCCCGGTGTCAGCCTGCTGG - Intronic
1089966073 11:122655935-122655957 GGGACCCAGAGCCAGGCAGGAGG - Exonic
1202809439 11_KI270721v1_random:21218-21240 GGGCCCCGGAGCAGGCCTGGTGG + Intergenic
1202825645 11_KI270721v1_random:88170-88192 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1092239594 12:6828724-6828746 GGGCCCCGGAGCCCGACTCCGGG + Exonic
1096420241 12:51450973-51450995 GGGCAAAGGAGCCAGCCAGGGGG + Exonic
1096588866 12:52644094-52644116 GGGGCTCTGAGCAAGCCTGGAGG - Intergenic
1096649053 12:53053042-53053064 GGGCCCTGGAGCTGGCTTGGGGG + Intronic
1098221314 12:68272995-68273017 TGGCCTAGGAGCCAGCATGGAGG - Intronic
1099989929 12:89709931-89709953 GGGCCCAGGAGCGAGCCAGCGGG + Intergenic
1101746382 12:107544641-107544663 AGGACCCGGAGGCTGCCTGGAGG + Intronic
1102030701 12:109738539-109738561 GGGCCTCGCAGCCTTCCTGGGGG - Intronic
1102541071 12:113619547-113619569 GTGCCCCGGAGCCTGGTTGGTGG - Intergenic
1103361788 12:120358951-120358973 GGGCCCCGTGGTCAGCCAGGGGG - Intronic
1103459113 12:121089774-121089796 GGTCCTCTGAGCCAGACTGGGGG - Intergenic
1104852376 12:131883431-131883453 GGCCCTAGGATCCAGCCTGGTGG - Intergenic
1104930415 12:132336589-132336611 GGGCCCGGGACCCCGACTGGAGG + Intergenic
1105000341 12:132686844-132686866 GGGCCGGGGACCCTGCCTGGGGG - Intronic
1106109010 13:26760685-26760707 GGGCTCCGGAGCGGGCCGGGAGG + Exonic
1110318256 13:74134498-74134520 GCGCCGCGGACCCAGCCCGGCGG - Intergenic
1112050606 13:95641730-95641752 GGGCCCCGAAGCCGCGCTGGGGG + Exonic
1113875089 13:113589296-113589318 GGTTCCCGGAGCCAGCCAGGTGG - Intronic
1113912980 13:113853000-113853022 GGGCCCCAGAGCAGGCCTAGGGG - Intronic
1113961207 13:114127274-114127296 GGACCCCGGAGGCAGCCCTGGGG - Intronic
1114670593 14:24408843-24408865 GGACCCCGGGGCCAGCCTTTGGG + Exonic
1118149905 14:63178537-63178559 GGGCTCAGCAGCCAGGCTGGGGG + Intergenic
1119479682 14:74951699-74951721 GGGACCCGGAACCTGCATGGTGG - Intronic
1119667895 14:76498123-76498145 GGGTCCAGGAGGCAGCATGGAGG - Intronic
1121101502 14:91253355-91253377 TGGCCGCGGAGCCAGCCGAGGGG + Intronic
1121410469 14:93745481-93745503 GGCCCCCAGCCCCAGCCTGGTGG + Intronic
1122270412 14:100566438-100566460 GTGCCCTGAGGCCAGCCTGGGGG - Intronic
1122605905 14:102947581-102947603 AGGACCTGGAGCCAGGCTGGAGG + Intronic
1122899826 14:104777822-104777844 GGGGCTCGGGACCAGCCTGGTGG + Intronic
1202903556 14_GL000194v1_random:56233-56255 GGGCCTCTGGGCCAGGCTGGGGG + Intergenic
1202918139 14_KI270723v1_random:3566-3588 GGGCTCCGGGGACAGCCGGGAGG - Intergenic
1202926488 14_KI270724v1_random:31021-31043 GGGCTCCGGAGACAGCCGGGAGG + Intergenic
1123627519 15:22238041-22238063 ATTCCCCGGACCCAGCCTGGAGG - Intergenic
1126348026 15:47717273-47717295 GGGCCGCGGCGCCAGGGTGGGGG + Intronic
1129298275 15:74611573-74611595 GGGCCCCCGAGCGGGACTGGAGG - Intronic
1129463762 15:75712630-75712652 GAGACCCCGACCCAGCCTGGCGG - Intronic
1129521904 15:76191524-76191546 GGGCCCCCGTCCCAGCCTGGGGG - Intronic
1129539022 15:76336433-76336455 CGGCCGCGGAGCCAGCTCGGCGG + Intergenic
1129686522 15:77689254-77689276 GGGGCTGGCAGCCAGCCTGGGGG - Intronic
1129827227 15:78641721-78641743 GGGCCCCTCACCCAGCTTGGGGG + Intronic
1130269851 15:82440472-82440494 GGGCCCTGAACTCAGCCTGGAGG - Intergenic
1130462190 15:84167773-84167795 GGGCCCTGAACTCAGCCTGGAGG - Intergenic
1130490487 15:84427000-84427022 GGGCCCTGAACTCAGCCTGGAGG + Intergenic
1130502075 15:84505770-84505792 GGGCCCTGAACTCAGCCTGGAGG + Intergenic
1130531124 15:84748520-84748542 GGGGGCGGGAGCCGGCCTGGCGG - Intergenic
1130656375 15:85794600-85794622 GGGCCCCGGCCCCAGCCGCGGGG + Intronic
1131118584 15:89809215-89809237 GTGCCCCAGTGCCAGCCTGGGGG - Intronic
1131839970 15:96426650-96426672 GGGGACTGGATCCAGCCTGGGGG + Intergenic
1131975133 15:97936798-97936820 GGGTCCTGGAGGCAGCCTGCAGG - Intergenic
1132549136 16:547179-547201 TGGCCACGGAGCCCGCCAGGGGG + Exonic
1132690277 16:1178942-1178964 GGGGCACGGGGCCAGCCTGCTGG - Intronic
1132730146 16:1357048-1357070 GGGCCCTAGGGCCAGACTGGAGG + Intronic
1132767027 16:1539546-1539568 GGGGCTGAGAGCCAGCCTGGTGG - Intronic
1132831355 16:1929903-1929925 GGGCCCGGGAGGCCGCCTCGAGG + Intergenic
1132893170 16:2214486-2214508 GGGGCCCGGCGCCAGCCTGGAGG - Exonic
1132920448 16:2387169-2387191 AGGCCCCTGAGCCACCCTAGTGG + Intergenic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1133076323 16:3283608-3283630 GGGCCACGGGGCCGGCGTGGCGG + Exonic
1133090666 16:3401409-3401431 GGGCCGCGGGGCCGCCCTGGAGG + Exonic
1133216828 16:4297694-4297716 GGGCCTGGCAGCCAGCATGGTGG + Intergenic
1133304953 16:4802785-4802807 GAGCCCTGGAACCAGACTGGCGG + Exonic
1136479807 16:30534349-30534371 GGGCCCCGGGGCCGGGCAGGCGG - Intronic
1136483676 16:30557885-30557907 GGGCCCCGGGGCCGGGCAGGTGG - Intronic
1137666451 16:50252348-50252370 TGGCCCCGAAGCCAGGCTGGCGG - Intronic
1138097068 16:54220154-54220176 GAGTCCCAGACCCAGCCTGGTGG + Intergenic
1138166299 16:54804815-54804837 GGGCCCTGGGGCCAGACTGCTGG + Intergenic
1138263009 16:55639100-55639122 AGGCCCTGGAGCCACCCAGGAGG - Intergenic
1138419913 16:56892515-56892537 GGGCCCCAGAGCCTGCTAGGTGG - Intronic
1138488701 16:57363620-57363642 GGGCTCCTGAGCCTTCCTGGAGG - Exonic
1140092237 16:71848008-71848030 AGGCTCCCGAGCCAGCCGGGAGG + Exonic
1141040323 16:80667499-80667521 GGGCACCGAAGCCAGCTTAGGGG - Intronic
1141945248 16:87305145-87305167 TGGCCCCGGAGGCTTCCTGGGGG + Intronic
1142156210 16:88533875-88533897 GGGCCCCGGAGCGCGCGAGGAGG + Exonic
1142263676 16:89053944-89053966 GGGGCAGGGAGCCATCCTGGAGG - Intergenic
1142335893 16:89489835-89489857 GGGCTCCGGGGCGGGCCTGGGGG - Intronic
1142753798 17:2003669-2003691 GGGCCCTGGGGCCAGGCAGGCGG - Intronic
1143444092 17:6996942-6996964 GGGCCCTGGAGCCTGCGCGGAGG + Exonic
1143538935 17:7558238-7558260 GCGGGCAGGAGCCAGCCTGGAGG + Intronic
1143914017 17:10275684-10275706 GGTCCCCAGAGCCAACGTGGTGG + Intergenic
1144672449 17:17140609-17140631 GTGCCCAGGAGCCAGACTGCTGG + Intronic
1144679397 17:17182878-17182900 AGGCCCCGGAGCATGGCTGGGGG - Intronic
1144779739 17:17801783-17801805 GGGCCCCTACTCCAGCCTGGAGG + Intronic
1146057636 17:29589261-29589283 AGGCCCCGGCGCCCGCCCGGCGG + Intronic
1146912350 17:36656972-36656994 GGGCCTCAGGGCCAGACTGGGGG + Intergenic
1147446047 17:40475903-40475925 AGGCCCCAGTCCCAGCCTGGGGG - Exonic
1150764631 17:67993566-67993588 GGGTCCCGGGGCCAGCGCGGCGG + Intronic
1151310312 17:73288697-73288719 GAGCCCTGGAGCCAGGCTGTGGG - Intronic
1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG + Intronic
1152087914 17:78231716-78231738 GGGACCCGGGGCCAGCCCGTGGG + Exonic
1152312273 17:79558558-79558580 GGGGCCCGAAGCCACCTTGGAGG - Intergenic
1152356377 17:79809681-79809703 GCGGCCTGGAGCCAGCCAGGTGG - Intergenic
1152606702 17:81295086-81295108 GGGCCCCAGAGGCTGCCTGGAGG + Exonic
1152609815 17:81310009-81310031 GGGCCCTGGGGGCTGCCTGGAGG - Intergenic
1152637975 17:81437941-81437963 GGGCCCTGGGGCCTGCCTTGGGG + Intronic
1152757331 17:82092473-82092495 GGCACCCGGAGCCAGCCTCGGGG - Exonic
1152882851 17:82830322-82830344 CGGCCCCGGAACCTGCCTGCCGG - Exonic
1152900572 17:82938671-82938693 GAGCCCCGGGCCCACCCTGGAGG - Intronic
1153219046 18:2846719-2846741 GGGGCCGGGAGCGAGCCTGTCGG + Intergenic
1155169957 18:23259983-23260005 TTCCCCCGGAGCCAGCCTAGGGG + Exonic
1156494905 18:37519277-37519299 GGGGTCCTGAGCCAGCCAGGTGG + Intronic
1157529352 18:48408851-48408873 GGGCCGCGGTGCCAGCCAGGAGG + Intronic
1157593702 18:48851195-48851217 GGCCCCAGGAGCCTGCCTGCGGG + Intronic
1160007315 18:75076861-75076883 GGGCCCTGGAGCCTGGCTGCTGG - Intergenic
1160591235 18:79945720-79945742 GGGGGCTGGAGCCAGCCTGTGGG - Intronic
1160771072 19:831495-831517 GGGCACCTGGCCCAGCCTGGAGG + Intronic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160868402 19:1266313-1266335 GGGGCCCAGAGCCAGGGTGGGGG - Intronic
1161006793 19:1941196-1941218 GGGCCCCGGAGCGGGCGCGGCGG + Exonic
1161313239 19:3606556-3606578 GGGCGCGGGATCCAGCCAGGTGG - Exonic
1161594600 19:5144653-5144675 GGCCCCCGCAGCCAGCTTTGGGG + Intronic
1161651860 19:5490635-5490657 GGGTCTCTGGGCCAGCCTGGAGG - Intergenic
1161779057 19:6279501-6279523 GGGTCTCCGAGCCAGGCTGGGGG + Intronic
1162031745 19:7920565-7920587 CGGGACCGGAGCCAGGCTGGAGG + Intronic
1162299964 19:9838856-9838878 GGGCAGAGGACCCAGCCTGGGGG + Intronic
1163557542 19:18001194-18001216 GGGGCCCGGAGGAAGCTTGGGGG + Intronic
1163602858 19:18259189-18259211 GTGACCTGGAGCCAGACTGGTGG + Intronic
1163612622 19:18309155-18309177 GGGCTCAGGTGCCAGCCTGGGGG - Intronic
1164387932 19:27793196-27793218 GGGCCCTGCAGCCAGCCCGGGGG + Intergenic
1164493495 19:28736131-28736153 AAGCCCCGGAGCTAGCTTGGGGG - Intergenic
1165074590 19:33273755-33273777 GGGCCCCAAGGCCAGCCCGGGGG + Intergenic
1165114593 19:33521517-33521539 TGGGGCCGGAGCCAGCCAGGAGG + Intronic
1165990875 19:39812696-39812718 GGGCCCCCCACCCACCCTGGGGG + Intergenic
1166320506 19:42015720-42015742 GGGTCCTGCAGCCAGGCTGGTGG - Intronic
1166857983 19:45792705-45792727 GGGCCCCGGCGCCGCCATGGGGG - Exonic
1167016130 19:46842282-46842304 GGGCACCTGACCCAGCCTGGGGG - Intronic
1167158391 19:47752805-47752827 GGGCACCTGGCCCAGCCTGGGGG + Intronic
1167248900 19:48390654-48390676 GGCGCCCGGGACCAGCCTGGAGG + Intronic
1167448702 19:49554824-49554846 GGGACCAGGAACCAGCCCGGTGG - Intergenic
1167516055 19:49923820-49923842 GGGCCCTAGAGCCAGCCTGCTGG - Intronic
1167611156 19:50508264-50508286 AGGGCCCCGATCCAGCCTGGAGG - Intronic
1167763120 19:51461840-51461862 GGGCCCCACAGGAAGCCTGGGGG + Intergenic
1168691545 19:58380647-58380669 AGGCCCGGGACCCATCCTGGCGG - Intronic
925054417 2:846187-846209 GCACCCTGGAGCAAGCCTGGTGG + Intergenic
925540741 2:4964863-4964885 GGTCGCAGGAGCCCGCCTGGTGG + Intergenic
925927297 2:8679320-8679342 GAGTCCTGGAGCCAGGCTGGGGG + Intronic
926145721 2:10396232-10396254 GGGCCCAGGAGGCATGCTGGGGG + Intronic
926206113 2:10835326-10835348 GGGCTCCGGAGCCCGACTGCCGG - Intronic
927236676 2:20881240-20881262 TGTCCCAGGAGCCATCCTGGAGG + Intergenic
927751386 2:25673497-25673519 AGGCCCCGGAGCCACCCCCGCGG + Exonic
929539551 2:42809887-42809909 GGGCCCCGCCTCCTGCCTGGAGG + Intergenic
929558441 2:42940064-42940086 GGACTCTGGAGCCAGGCTGGCGG + Intergenic
929789724 2:45013886-45013908 GGGGCTCGGGGCCAGCCTGGAGG + Intergenic
931666483 2:64612920-64612942 AGGGCACTGAGCCAGCCTGGGGG + Intergenic
932493612 2:72136059-72136081 GGGCTGCGCAGCCAGCCGGGAGG - Intronic
932884957 2:75541303-75541325 GGGCCCTAGCACCAGCCTGGAGG + Intronic
934519023 2:95007633-95007655 GGGGGCAGGAGCCATCCTGGGGG - Intergenic
934527004 2:95058262-95058284 GGGCCCGGGAGCCACTCTGCTGG - Intergenic
936540106 2:113342783-113342805 GAGCCACGGAGCCAGGGTGGAGG - Intergenic
937220014 2:120337327-120337349 GGGGGCTGGAGCCACCCTGGAGG - Intergenic
937265525 2:120612589-120612611 GGTCCCCGAACCCAGGCTGGGGG - Intergenic
938246012 2:129778587-129778609 GGGCCCCACAGCCTGGCTGGCGG + Intergenic
942247852 2:174023991-174024013 GGGCCCTGGAGGCAAACTGGTGG - Intergenic
942452290 2:176116069-176116091 GGAACCCGGAGCCAGGCAGGAGG + Intronic
943722031 2:191214965-191214987 GGGTACAGGAGCAAGCCTGGAGG + Intergenic
946399532 2:219461170-219461192 GGGCACCAGAGTCAGCCTTGGGG - Intronic
947353543 2:229270977-229270999 GGAGCCGGGGGCCAGCCTGGAGG - Intronic
947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG + Intergenic
947745147 2:232503488-232503510 GGGGCCTGGCGCCCGCCTGGTGG + Intergenic
948402215 2:237692294-237692316 GGGGCCAGGAGCCAGCCCGCCGG - Intronic
948821968 2:240554465-240554487 GGGCTCAGGACCTAGCCTGGGGG + Intronic
948929666 2:241123951-241123973 GCTCACCGGACCCAGCCTGGTGG - Exonic
948933852 2:241149860-241149882 GCGCCCCGGAGCCAGCCAGCTGG + Intronic
949004636 2:241638038-241638060 GGGCGGCGGAGCCTGCCGGGCGG + Intronic
1169118416 20:3081946-3081968 GGGCCCCTCAGCCAGAGTGGGGG - Intergenic
1169140410 20:3224440-3224462 GGGCACAGAAGCAAGCCTGGGGG - Intergenic
1170745713 20:19097405-19097427 GGGCCTGTGAGGCAGCCTGGAGG + Intergenic
1170804407 20:19617239-19617261 AGGCCGTGGAGCCTGCCTGGTGG + Intronic
1171181707 20:23095704-23095726 GGCTGCAGGAGCCAGCCTGGCGG - Intergenic
1171782103 20:29428226-29428248 GGGCTCCGGGGACAGCCGGGAGG - Intergenic
1171994860 20:31723438-31723460 CGGCCCCGGAGCCCTCCCGGGGG - Intronic
1172010795 20:31844680-31844702 GGGGCCCGGAGTGAGCCTGGAGG + Exonic
1172271053 20:33656152-33656174 GGCCCAGGGAGCCAGGCTGGTGG + Intergenic
1172406700 20:34695056-34695078 GGGCACTGGAGCCAGGCTGCAGG + Intergenic
1172474323 20:35226300-35226322 GGGCCTGAGAGGCAGCCTGGGGG - Intergenic
1172764857 20:37346005-37346027 GGGCCCGGCAGGCAGCCGGGAGG - Intronic
1172839595 20:37894387-37894409 GGGCCCCAGTGCCAGGGTGGTGG - Intergenic
1172924055 20:38514270-38514292 GGACCCAGGAGCAAGCCTGCTGG - Intronic
1173146401 20:40528380-40528402 AGGCCCTGGAGCCTGCCTGAGGG - Intergenic
1173221689 20:41137248-41137270 CGGCCCCGGACACAGCCCGGCGG - Intronic
1173505862 20:43586617-43586639 GAGCCCTGGAGCCAGCTTGTAGG - Intronic
1173750544 20:45471796-45471818 GAGCCAGGGAGGCAGCCTGGAGG + Intronic
1174354620 20:49989675-49989697 GAGCCCCAGAGTCAGGCTGGGGG + Intergenic
1174643297 20:52063747-52063769 GGACCCAGGAGCCAACTTGGAGG + Intronic
1175951977 20:62588449-62588471 GGGGTCTGGAGACAGCCTGGTGG - Intergenic
1176040046 20:63060549-63060571 GAGCCCCAGGGCCAGCCAGGAGG - Intergenic
1176048403 20:63104143-63104165 GAGCCCCCAAGCCAGACTGGAGG - Intergenic
1176104926 20:63381452-63381474 GGGCCCCCGAGCCACACAGGAGG - Intergenic
1176293048 21:5056285-5056307 GGGCCCCTGAGGCACCCAGGAGG - Intergenic
1176311655 21:5154026-5154048 GGGCCGCGGAGCCGGCCTGGGGG - Intronic
1176383871 21:6127401-6127423 GGTCCCTGGGCCCAGCCTGGAGG + Intergenic
1176622923 21:9071001-9071023 GGGCCTCTGGGCCAGGCTGGGGG + Intergenic
1178684670 21:34701864-34701886 GGGCACAGAAGGCAGCCTGGCGG + Intronic
1178981465 21:37268093-37268115 GGCCCGCGGAGCCCGGCTGGCGG - Intergenic
1179565978 21:42249258-42249280 GTGCCCACGAGCCAGCCAGGCGG - Intronic
1179627020 21:42654361-42654383 GGGCCCCGCGGAGAGCCTGGGGG + Intronic
1179730381 21:43364234-43364256 GGCCGCTGGAGCAAGCCTGGTGG - Intergenic
1179739602 21:43410837-43410859 GGTCCCTGGGCCCAGCCTGGAGG - Intergenic
1179845395 21:44108009-44108031 GGGCCGTGGAGCCGGCCTGGGGG + Intronic
1179864212 21:44207365-44207387 GGGCCCCTGAGGCACCCAGGAGG + Intergenic
1179976196 21:44868561-44868583 GGACCCAGAAGCCAGCCTGGAGG + Intronic
1180059219 21:45376005-45376027 GTGGCCTGGAGGCAGCCTGGAGG + Intergenic
1180127345 21:45801371-45801393 GGGCCCTGCAGCCAGCAGGGAGG - Intronic
1180137843 21:45872625-45872647 AGGCCCCGGAGCCCGCGTTGGGG + Intronic
1180652227 22:17387511-17387533 AGGCCCCGGCTCCAGCCTGCTGG + Intronic
1180802519 22:18638446-18638468 GGGTCAGGGAGGCAGCCTGGGGG + Intergenic
1180853756 22:19034002-19034024 GGGTCAGGGAGGCAGCCTGGGGG + Intergenic
1180960719 22:19761131-19761153 GGGCCCCGGGGCCAGCTGCGCGG + Exonic
1181219204 22:21356815-21356837 GGGTCAGGGAGGCAGCCTGGGGG - Intergenic
1181520572 22:23447096-23447118 GAGTCCCGGAGGCAGGCTGGTGG - Intergenic
1181539491 22:23565843-23565865 GGACCCCAGAGCCCGGCTGGAGG - Intergenic
1181956191 22:26589644-26589666 GCGCCCTGGCGCCCGCCTGGGGG + Intronic
1182137346 22:27918838-27918860 TGGGCCCAGACCCAGCCTGGGGG + Intronic
1183214026 22:36467696-36467718 GGCCCCAGGAGCCAGACAGGAGG + Exonic
1183373342 22:37448164-37448186 GGGACCCAGAGACAGCCTGAGGG - Intergenic
1183702362 22:39457638-39457660 GGGCCGCGGAGCCGGGCGGGGGG - Intronic
1183735762 22:39644018-39644040 AGGCTCCCGATCCAGCCTGGAGG + Intronic
1183742538 22:39676918-39676940 GGACCCTGGGGCCAGCCTGCTGG + Intronic
1184121370 22:42452675-42452697 AGGGCCTGGAGCCAGCCTGCTGG + Intergenic
1184837470 22:47032405-47032427 AGGCCCTGGACCCAGTCTGGGGG - Intronic
1184851591 22:47124422-47124444 AGGCCCTCGAGCCAGCCTAGGGG + Intronic
1185083122 22:48720727-48720749 GTGCCCAGGTGCCAGCGTGGTGG - Intronic
1185281737 22:49972592-49972614 GGGACACAGAGCCAGACTGGAGG - Intergenic
1185317470 22:50185298-50185320 GGGCCCCGCGGCCAGCCTAGCGG - Intergenic
1185337952 22:50279132-50279154 GGGGCTCGGAGCCGGGCTGGCGG - Intronic
1185372091 22:50465652-50465674 TGGAGCCGGGGCCAGCCTGGGGG + Intronic
949559383 3:5187977-5187999 GGGCCCGTGGGCCGGCCTGGGGG + Exonic
949888416 3:8714232-8714254 GGGCCCTGGAGCCTGCTTTGGGG - Intronic
955187728 3:56731249-56731271 GGCCCCCGGGCCCAGCCTGGAGG - Intronic
955352352 3:58203193-58203215 GGGCCCTGGATGCAGCCTGCTGG - Intronic
957083385 3:75658178-75658200 GGGCTCCGGGGACAGCCGGGAGG + Intergenic
960047485 3:113211959-113211981 GGGCCCGGGGGCCAGCGTGGTGG - Exonic
960988098 3:123293309-123293331 GGGCTGCTAAGCCAGCCTGGGGG + Intronic
961000067 3:123368031-123368053 GGGCCCCAGAGATTGCCTGGGGG + Intronic
961643292 3:128378707-128378729 GGGGCCAGCAGCCAGCCTGGGGG - Intronic
962263148 3:133927631-133927653 CGGCCCCACAGCCAGCCGGGCGG - Intergenic
962609883 3:137066267-137066289 GCACCCATGAGCCAGCCTGGAGG - Intergenic
965590425 3:170356963-170356985 CCGCCCCGGAGGCAGCCGGGCGG - Intergenic
967890637 3:194361925-194361947 GGTGCCCGAAGCCAGCCTTGTGG + Intronic
968130958 3:196192565-196192587 GGGCCCCGCCTCCAGCCTGGTGG + Intergenic
969379159 4:6782933-6782955 GGGCTCCGGGGCCAGCCCGAGGG + Intronic
969379203 4:6783056-6783078 GGGCTCCGGGGCCAGCCTGAGGG + Intronic
969379221 4:6783097-6783119 GGGCTCCGGGGCCAGCCTGAGGG + Intronic
971051650 4:22869044-22869066 GAGCCACCCAGCCAGCCTGGTGG - Intergenic
972456960 4:39264237-39264259 AGGCTCTGGAGCCAGCCTGCTGG - Intronic
975428068 4:74253855-74253877 GGTCCATGGAGCCAGGCTGGTGG - Intronic
977669466 4:99679350-99679372 GACTCCCGGAGCTAGCCTGGTGG - Intergenic
978133903 4:105233924-105233946 TGGCCCCGAAGCAAGCCTGATGG + Exonic
979335304 4:119455156-119455178 GGTCCCCGGGCCCTGCCTGGGGG - Intergenic
981582208 4:146261195-146261217 GGGCCCCAGAGGAAGGCTGGAGG + Intronic
983290604 4:165799372-165799394 GGGCCACAGGGCCAGACTGGTGG - Intergenic
983938478 4:173518975-173518997 GGGCCCCGAAGGCAACCCGGTGG - Intergenic
985494874 5:198805-198827 GGGCCCAGGAGCACGCCTGCTGG + Exonic
985536061 5:466309-466331 GGGGCCTGGAGCCAGCATGGTGG - Intronic
985536811 5:469596-469618 GGGCCCACGGGCCAGCCTTGTGG - Intronic
985679034 5:1246428-1246450 GGCCCCCTGAGCCACCCGGGCGG - Intergenic
985850772 5:2387664-2387686 GGGCCACAGGGCCAGCCTGCCGG + Intergenic
986004237 5:3654740-3654762 TGGCCCCCGACCCAGCCTGAAGG + Intergenic
987087424 5:14483633-14483655 GGGCACAGGTGCCAGGCTGGGGG + Intronic
987103547 5:14614735-14614757 TGGCCCAAGAGCCAGCATGGAGG + Intronic
990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG + Intronic
990557693 5:56952012-56952034 CGACCCCCGAGCCAGCCTGGGGG - Intronic
992143723 5:73824412-73824434 GGTCCCCTGACCCAGCCAGGAGG - Intronic
997265214 5:132491106-132491128 GGCCCCAGGAGCCAGCCGGCTGG - Intergenic
997428579 5:133821699-133821721 GGGCCCAGAAGCCAGCAGGGAGG + Intergenic
997470545 5:134114837-134114859 GGGGCGCGGAGCCGGCCCGGGGG - Exonic
997640612 5:135446502-135446524 AGGCCCTGAAGCCAGCCTGACGG + Exonic
997714054 5:136029103-136029125 GGGCCCCGCCGCGACCCTGGCGG + Exonic
998153209 5:139769082-139769104 GGGCCTGTGACCCAGCCTGGTGG + Intergenic
998511673 5:142718995-142719017 GGGGGCCGGGGGCAGCCTGGTGG + Intergenic
999736523 5:154517382-154517404 GTGCCCAGGAGCCAGCCGGCTGG - Intergenic
1001400007 5:171440805-171440827 GGGCTCTGTACCCAGCCTGGGGG - Intronic
1001694206 5:173657918-173657940 GGGGCCAGGAGCGAGCCTGAAGG + Intergenic
1002336688 5:178484363-178484385 GGACCTCGGAGCCATCCTTGAGG - Intronic
1002566830 5:180116833-180116855 GGGAACAGGAGTCAGCCTGGCGG + Intronic
1002568442 5:180127263-180127285 GGGTCCCGGAGCGCGCCAGGGGG + Intronic
1002763291 6:218226-218248 AGGCCCCGGGGACAGCCAGGGGG + Intergenic
1004222544 6:13759128-13759150 GTGTCCAGGAGCCAGACTGGGGG - Intergenic
1005347136 6:24901761-24901783 GGTCCACTTAGCCAGCCTGGAGG - Intronic
1005997191 6:30938647-30938669 GGGCTCAAGAGCCAGCCTGAGGG - Intergenic
1006092597 6:31636851-31636873 GGGCCGCACAGCCAGGCTGGGGG - Exonic
1006119338 6:31794941-31794963 GGGCCCAGGGGGCAGCCGGGCGG - Exonic
1006317481 6:33298974-33298996 GGGCCCAGGAGCCCGGCGGGGGG - Exonic
1006414986 6:33898207-33898229 GGGCCCCTGACCAGGCCTGGTGG - Intergenic
1007068222 6:39014762-39014784 GGGCTCAGGAGCAAGGCTGGGGG + Intronic
1007630675 6:43271598-43271620 GGGCCCTGGCCCCTGCCTGGGGG + Intronic
1007719148 6:43875194-43875216 GGAGCCCGTGGCCAGCCTGGGGG + Intergenic
1007824978 6:44593671-44593693 AGACCCCTGAGCCAGACTGGAGG - Intergenic
1011032615 6:82940126-82940148 GGGCCAGGCAGACAGCCTGGAGG - Intronic
1014653422 6:124069794-124069816 GAGCTCAGCAGCCAGCCTGGAGG + Intronic
1015024650 6:128519495-128519517 GGAGCGCGGGGCCAGCCTGGCGG + Intronic
1017670194 6:156763177-156763199 TGGTCCCGGAGCCAGCGTAGGGG + Intergenic
1017840780 6:158221066-158221088 GGGCACCGCAGCCTTCCTGGAGG + Intergenic
1017939156 6:159036198-159036220 GGGCCCGGCAGCCAGACTAGTGG - Exonic
1018443441 6:163834339-163834361 GGGCCCTGGAGTGAGGCTGGGGG - Intergenic
1018908582 6:168089096-168089118 GGGGCCAGCAGCCTGCCTGGGGG + Intergenic
1019116145 6:169764158-169764180 GGGCCGAGGAGCCAGGCGGGGGG - Intronic
1019347740 7:538973-538995 GGTCCCAGGAGCCGGCCTGGAGG + Intergenic
1019542706 7:1558768-1558790 GGGCCCCGGACACAGACTGAGGG + Intronic
1019659395 7:2215624-2215646 GGGCTCCTGGGCCATCCTGGGGG - Intronic
1019667069 7:2257285-2257307 GGGACCCGGAGCCGTCCTGGTGG - Intronic
1019781798 7:2944838-2944860 GGGGCCCAGATCCAGCCTTGTGG + Intronic
1020130436 7:5556168-5556190 CGGCCCCAGAGCCAGGCGGGTGG - Intronic
1022029752 7:26481407-26481429 GGAGCCAGGAGACAGCCTGGAGG - Intergenic
1022370902 7:29770492-29770514 GGGCCCCGGAGCCTTCCCTGGGG - Intergenic
1022925756 7:35054916-35054938 TGTCCCCGGAGACAGGCTGGTGG - Intergenic
1022982087 7:35613263-35613285 GGGCCCTGGAGCCACCCTCAGGG + Intergenic
1024615572 7:51108786-51108808 GGGCGCTGGAGCCAGCCTTGGGG + Intronic
1024664218 7:51529618-51529640 GGGTCCCACAGACAGCCTGGAGG - Intergenic
1026202640 7:68227840-68227862 TGGCCTGGGACCCAGCCTGGTGG - Intergenic
1029540229 7:101178444-101178466 GTTCCACGGAGCCAGGCTGGAGG - Intronic
1029823761 7:103169608-103169630 TGTCCCCGGAGACAGGCTGGTGG - Intergenic
1030115523 7:106059737-106059759 AGGCCCCGGAGAGAGACTGGAGG - Intergenic
1033369475 7:140695705-140695727 GGGGCCCGGGGTCAGCCTGGAGG + Intronic
1033536974 7:142321204-142321226 GAGCACCGGAGACAGCCTGGTGG - Intergenic
1033555165 7:142482679-142482701 GAGCTCAGGAGACAGCCTGGAGG - Intergenic
1033559773 7:142520216-142520238 GAGCACTGGAGACAGCCTGGAGG - Intergenic
1033857218 7:145578139-145578161 GGGCCCCGGGTCCAGGCTTGAGG + Intergenic
1034178083 7:149116076-149116098 AGGCCCAGGAGCCAGCAGGGTGG - Intronic
1034200708 7:149281612-149281634 GGGCCCAGGAACAGGCCTGGGGG + Exonic
1034306220 7:150047456-150047478 GCGCCACGGAGCCTGTCTGGGGG + Intergenic
1034345422 7:150382552-150382574 GGGCTGAGGAGCCAGCCAGGTGG + Intronic
1034425133 7:151010123-151010145 GGGTCCCGCACCCAGCCGGGGGG - Exonic
1034641630 7:152608470-152608492 GGGCCCTGCAGCCAGCCACGTGG - Intergenic
1034800624 7:154053196-154053218 GCGCCACGGAGCCTGTCTGGGGG - Intronic
1035024140 7:155815372-155815394 GTGCCCAGGAGGGAGCCTGGGGG - Intergenic
1035171046 7:157017734-157017756 GGGCCCCGGAGACTGCGGGGAGG - Intergenic
1035367033 7:158355746-158355768 GTGCACAGGAGCCAGCCTGAAGG + Intronic
1035479406 7:159169930-159169952 GGGCCCCGGACCTCGCCTGAGGG + Intergenic
1035535255 8:386163-386185 GGACCATGGAGGCAGCCTGGGGG - Intergenic
1036205269 8:6800925-6800947 GAGCCCAGGTTCCAGCCTGGGGG + Intergenic
1036390302 8:8318882-8318904 CGGGCCCGGGGCCGGCCTGGAGG + Exonic
1036417516 8:8564317-8564339 GGGCCACGGAGCCAGGGAGGAGG + Intergenic
1036425926 8:8645379-8645401 GGGCCCCTGTGGGAGCCTGGAGG - Intergenic
1036454341 8:8893809-8893831 GGGCTCCGGGGCCCCCCTGGTGG + Intergenic
1036698408 8:10994312-10994334 GGGGCCTAGAGCCAGGCTGGGGG - Intronic
1036751313 8:11445237-11445259 GGTCCCCAGAGCCAGCCAGCAGG + Intronic
1036961578 8:13249955-13249977 GGCCCCCCAAGCCATCCTGGAGG - Intronic
1037820128 8:22131272-22131294 CGGCCCCGGAGCCTGGCAGGCGG + Exonic
1037835624 8:22213308-22213330 GGGCCCTGGGGCCACACTGGTGG - Intergenic
1037896478 8:22659673-22659695 GGGCCCTGGAGCCAGACAGCTGG + Intronic
1042872686 8:73412565-73412587 GGGCACTGGAGCCAGCCTGGGGG + Intergenic
1045215567 8:100145631-100145653 GGGTCCCGCCGCCTGCCTGGAGG + Intronic
1045231960 8:100314447-100314469 GAGCTCTGGAGCCAGCCTGCCGG - Intronic
1045324785 8:101109963-101109985 GGGCCCCCGAGGCTGCATGGGGG - Intergenic
1049221482 8:141430672-141430694 GGAGCCCAGAGTCAGCCTGGAGG + Intronic
1049353521 8:142176765-142176787 GGGCCCGGCAGGCTGCCTGGAGG - Intergenic
1049494354 8:142922724-142922746 GTGGCCCGGGGCCAGCCTAGAGG + Intergenic
1049519267 8:143079984-143080006 GGGCAACTGAGCCAGCCTGAGGG + Intergenic
1049540695 8:143207541-143207563 GCACTCCAGAGCCAGCCTGGGGG - Intergenic
1049604562 8:143523251-143523273 GGGACGTGGAGCAAGCCTGGAGG - Intronic
1049649959 8:143761241-143761263 GGGGCCCCGCGCCAGCCTAGTGG + Intergenic
1049783184 8:144438341-144438363 GGGCCCCTTAGCAAGCATGGTGG - Intronic
1049807826 8:144548829-144548851 GGGCCCAGGAGCCTGCCCGGCGG - Intronic
1049991806 9:998412-998434 GGGCCCAGGAGGAAGCCAGGCGG - Intergenic
1049998353 9:1051622-1051644 CGGCCGCGGAGCCAGCCTGCGGG - Exonic
1050075243 9:1856110-1856132 TGGGCCCAGAGCTAGCCTGGAGG + Intergenic
1051120441 9:13746480-13746502 AGGCCCCAGGGCCAGCCTAGGGG + Intergenic
1052344196 9:27391737-27391759 GGGCCCAGGATTCAGCTTGGAGG + Intronic
1054175055 9:61869184-61869206 GGGGGCCGGGGCCGGCCTGGGGG + Intergenic
1054662482 9:67711609-67711631 GGGGGCCGGGGCCGGCCTGGGGG - Intergenic
1054861256 9:69956117-69956139 GGGCCTGGAAGTCAGCCTGGCGG + Intergenic
1057665080 9:97038794-97038816 GGGCTCCGCGGCCAGGCTGGGGG + Intronic
1060229702 9:121817739-121817761 GGGATCTGGAGCCAGCCGGGGGG + Intergenic
1060404877 9:123368242-123368264 GTGCCCAGGAGCCTGCCAGGGGG - Intronic
1060526513 9:124324065-124324087 GGGCCCCTGAGCCGGGTTGGAGG - Intronic
1060657231 9:125380479-125380501 GGGACCCAGAGACATCCTGGTGG - Intergenic
1060666033 9:125432767-125432789 GGGCCCCAGAGCTTCCCTGGAGG + Intergenic
1060671183 9:125471256-125471278 AGGCCCAGAATCCAGCCTGGAGG + Intronic
1060821027 9:126661685-126661707 GGGCCCCGCAGCCACACTGCAGG - Intronic
1061911608 9:133728042-133728064 GGGACCCGGAGCCAGGGAGGAGG + Intronic
1062357254 9:136170758-136170780 GAGCCCAGGTGCCAGCCAGGGGG - Intergenic
1062389637 9:136328771-136328793 GGGCCCAGGAGCCAGGCTAGGGG - Intronic
1062469388 9:136695888-136695910 GGACCCGGGTGCCTGCCTGGGGG - Intergenic
1062502432 9:136857268-136857290 GGGCATGGGAGCCAGGCTGGTGG - Exonic
1062582391 9:137234342-137234364 TAGCCCCCGAGTCAGCCTGGTGG - Intronic
1203746110 Un_GL000218v1:41428-41450 GGGCCTCTGGGCCAGGCTGGGGG + Intergenic
1185750705 X:2608452-2608474 GGGCCCCTGACGCAGCCTGCTGG + Intergenic
1190335554 X:49259612-49259634 GGGGCCCGGAGCCATTGTGGAGG - Intronic
1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG + Intronic
1191197470 X:57740546-57740568 GGGTGCAGGAGCCAGCCTGGAGG + Intergenic
1192215583 X:69156025-69156047 GGGCCTGGGGGCCAGCCTGAAGG - Intergenic
1195702501 X:107715928-107715950 TGCCTCCGGAGCCAGCGTGGTGG - Exonic
1196689502 X:118544293-118544315 TGGCCCAGGAGCCAGACTGTTGG + Intronic
1196858216 X:120003009-120003031 GGACCCTGGAGCCAGACTGCTGG + Intergenic
1196860031 X:120017877-120017899 GGACCCTGGAGCCAGACTGCTGG + Intergenic
1197064333 X:122220760-122220782 GGGCCCCTGAGGCAGCCTTGGGG - Intergenic
1199274209 X:145922979-145923001 GGTCCCCTGACCCAGCATGGAGG + Intergenic
1201159436 Y:11156441-11156463 GGGCCTCTGGGCCAGGCTGGGGG + Intergenic
1202367743 Y:24178553-24178575 GGGCCCTGAACTCAGCCTGGAGG - Intergenic
1202377091 Y:24247359-24247381 GGGCCCTGAACTCAGCCTGGAGG + Intergenic
1202493689 Y:25422762-25422784 GGGCCCTGAACTCAGCCTGGAGG - Intergenic
1202503040 Y:25491570-25491592 GGGCCCTGAACTCAGCCTGGAGG + Intergenic