ID: 1151320683

View in Genome Browser
Species Human (GRCh38)
Location 17:73350546-73350568
Sequence CGCTGCCAGGAGCCAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 1, 1: 0, 2: 9, 3: 73, 4: 544}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151320674_1151320683 -2 Left 1151320674 17:73350525-73350547 CCCCACCCACCAGAGCAGGTGCG 0: 1
1: 0
2: 3
3: 101
4: 1610
Right 1151320683 17:73350546-73350568 CGCTGCCAGGAGCCAGGAGAGGG 0: 1
1: 0
2: 9
3: 73
4: 544
1151320678_1151320683 -8 Left 1151320678 17:73350531-73350553 CCACCAGAGCAGGTGCGCTGCCA 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1151320683 17:73350546-73350568 CGCTGCCAGGAGCCAGGAGAGGG 0: 1
1: 0
2: 9
3: 73
4: 544
1151320677_1151320683 -7 Left 1151320677 17:73350530-73350552 CCCACCAGAGCAGGTGCGCTGCC 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1151320683 17:73350546-73350568 CGCTGCCAGGAGCCAGGAGAGGG 0: 1
1: 0
2: 9
3: 73
4: 544
1151320675_1151320683 -3 Left 1151320675 17:73350526-73350548 CCCACCCACCAGAGCAGGTGCGC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1151320683 17:73350546-73350568 CGCTGCCAGGAGCCAGGAGAGGG 0: 1
1: 0
2: 9
3: 73
4: 544
1151320671_1151320683 8 Left 1151320671 17:73350515-73350537 CCCTAGGCTGCCCCACCCACCAG 0: 1
1: 0
2: 2
3: 32
4: 313
Right 1151320683 17:73350546-73350568 CGCTGCCAGGAGCCAGGAGAGGG 0: 1
1: 0
2: 9
3: 73
4: 544
1151320676_1151320683 -4 Left 1151320676 17:73350527-73350549 CCACCCACCAGAGCAGGTGCGCT 0: 1
1: 0
2: 0
3: 14
4: 142
Right 1151320683 17:73350546-73350568 CGCTGCCAGGAGCCAGGAGAGGG 0: 1
1: 0
2: 9
3: 73
4: 544
1151320672_1151320683 7 Left 1151320672 17:73350516-73350538 CCTAGGCTGCCCCACCCACCAGA 0: 1
1: 2
2: 6
3: 41
4: 372
Right 1151320683 17:73350546-73350568 CGCTGCCAGGAGCCAGGAGAGGG 0: 1
1: 0
2: 9
3: 73
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151320683 Original CRISPR CGCTGCCAGGAGCCAGGAGA GGG Intronic
900014528 1:138909-138931 CGCTGACAGGAGGCAGGAGCTGG + Intergenic
900044393 1:494111-494133 CGCTGACAGGAGGCAGGAGCTGG + Intergenic
900065800 1:729017-729039 CGCTGACAGGAGGCAGGAGCTGG + Intergenic
900385538 1:2408936-2408958 TGTTGACAGGAGCCAGCAGAGGG - Intronic
900550626 1:3252636-3252658 GGCAGCCAGGTCCCAGGAGAAGG + Intronic
900582454 1:3415769-3415791 TGCAGCCCGGAGCCAGGAGGTGG + Intronic
900985314 1:6069754-6069776 CGCTGCCAGGCCTCGGGAGAAGG - Intronic
901035670 1:6334599-6334621 AGCTTCCAGGTGCCAAGAGACGG + Intronic
901222116 1:7589184-7589206 CTCTGCCAGGAGGAAGGGGAGGG - Intronic
901475804 1:9488435-9488457 GGCTGCCAGGAGCAAGGATAGGG + Intergenic
901868843 1:12125771-12125793 AGCTTCCTGGAGCCAGGCGAGGG + Intronic
902097267 1:13957114-13957136 ACCTGCCAGGATCCCGGAGAAGG + Intergenic
902309351 1:15568904-15568926 CGCTGCTGGTAGCCAGGGGAGGG + Exonic
903673970 1:25053003-25053025 AGGTGCCAGGAGGGAGGAGAAGG - Intergenic
904116193 1:28163724-28163746 AGCTGCTTGGAGCCAGGGGAGGG + Intronic
904318799 1:29683169-29683191 AGCTGCCAAGGGCCAGGAGCTGG - Intergenic
904366066 1:30011683-30011705 AGCAGGAAGGAGCCAGGAGAGGG - Intergenic
904385731 1:30140792-30140814 CCCTGCCAGCAGCCAGGGGCCGG + Intergenic
904659350 1:32073132-32073154 CGCGGACAGGAGCCCGGTGACGG + Intronic
904772438 1:32887649-32887671 TGCTGCCAGGTCCCAGGAGAGGG - Intronic
905061659 1:35145095-35145117 AGCTGCCAGGAGCAAGGTGGAGG + Intergenic
905104774 1:35557782-35557804 AGCAGCCTGGAGCCAGGAGTGGG + Intronic
906071110 1:43017100-43017122 AGTCACCAGGAGCCAGGAGAGGG + Intergenic
906793916 1:48681661-48681683 ACCTGGCAGGAGCCAGGAGTGGG - Intronic
907464416 1:54625269-54625291 AGCTGCCAGGAGCCAGGCCCTGG + Intronic
909571937 1:77123615-77123637 GGCTGCCAGGAGCTGGGAGGAGG + Intronic
912579384 1:110706361-110706383 CTGGGCCAGGAGCCAAGAGATGG - Intergenic
913088186 1:115458232-115458254 CACTTCCAGCAGCCAGGACAGGG - Intergenic
914705740 1:150168434-150168456 GGTTGCCAGGAGCCAGGGGCAGG + Intergenic
915016840 1:152742364-152742386 TGATGCCAGGAGCAAGGAGGAGG - Intronic
915135526 1:153728609-153728631 TGCAGCCAGGAGCCGGGAAAAGG - Exonic
915321901 1:155060982-155061004 CCCTGCCTGTAGCCAGGGGAGGG - Intronic
915468947 1:156114491-156114513 AGCAGGCAGGAGCCAAGAGAGGG + Intronic
917110182 1:171539553-171539575 GGCTGCCAGGGGCTAGGAGTAGG - Intronic
917993101 1:180403901-180403923 AGTTGCCAGGGGCCAGGGGAAGG + Intronic
918248887 1:182684447-182684469 CTCTCCCAGGTGCCAGGAGGAGG - Intronic
918623702 1:186634067-186634089 AGCTACCAGGAACCAGGAGAGGG - Intergenic
919048478 1:192483170-192483192 CCCTGGCAGGAGGCAGGAGAAGG - Intergenic
919169902 1:193939945-193939967 AGCTGCCTGGAGCCAGAAAAGGG - Intergenic
920046017 1:203132935-203132957 CACTGGCAGGAGTCAGGATAAGG - Intronic
921030243 1:211329877-211329899 CGCTGCCACCACCCAGGAGTGGG + Intronic
921052601 1:211521728-211521750 CTTGGCCAGGACCCAGGAGAGGG - Intergenic
921185338 1:212665395-212665417 ACCTGCCAGCAGCCACGAGATGG + Intergenic
921800221 1:219394493-219394515 AGCTGCCAGGGGTTAGGAGAAGG - Intergenic
921929517 1:220743607-220743629 CACTGCCAGGAGACTGGGGAGGG + Intergenic
921936573 1:220801731-220801753 CTCTGCCAGGAGCCTGGAGAAGG + Intronic
921986861 1:221321805-221321827 GGCTGCTGGGAGACAGGAGAGGG - Intergenic
922100924 1:222476366-222476388 TGCTGACAGGAGGCAGGAGCTGG + Intergenic
922733694 1:227968306-227968328 CGCTGACAGGAGGCAGGAGCTGG - Intergenic
922733756 1:227968597-227968619 AGCTGCCATGAGGCAGGAGCTGG - Intergenic
922996911 1:229971463-229971485 GCCAGCCGGGAGCCAGGAGATGG - Intergenic
923101572 1:230821724-230821746 AGCAGCCAGGAGGCAGGAGCAGG + Intergenic
923554543 1:234990437-234990459 GGCTACCAGAAGCCAGGAGAGGG - Intergenic
923617058 1:235546880-235546902 TGCTGCTGGGAGCCAGGGGAGGG - Intergenic
923664590 1:235988845-235988867 GGCTGCCAGGGGCTAGGACATGG + Intronic
924343848 1:243056483-243056505 CGCTGACAGGAGGCAGGAGCTGG + Intergenic
924343998 1:243057252-243057274 GGCTGCCAGGAGGTAGGAGCTGG + Intergenic
924729176 1:246696469-246696491 TGCTACCAGGAGCCAAGAAATGG - Intergenic
1062817924 10:514627-514649 CGGTGTCAGGGGCCAGGAGGAGG - Intronic
1063217925 10:3940675-3940697 GGTTGCCAGGGTCCAGGAGATGG + Intergenic
1063476699 10:6335076-6335098 CCCTGCTAGGTCCCAGGAGAAGG - Intergenic
1064016772 10:11778964-11778986 TGATCCCAGGAGACAGGAGAAGG - Intergenic
1065191357 10:23212190-23212212 GGCTACCAGAAGCTAGGAGACGG + Intronic
1065381674 10:25096903-25096925 CCCTGCCAGGAGTTAGGGGAGGG + Intergenic
1066422952 10:35278806-35278828 CCCTGCCAGGAGCCAGGGGCTGG + Intronic
1066467988 10:35670316-35670338 CTGTGCCAGGAGCAAGGAGGAGG + Intergenic
1066653875 10:37681955-37681977 CCCTGGCAGGAGCCAGGAGCAGG - Intergenic
1066732478 10:38448577-38448599 CGCTGACAGGAGGCAGGAGCTGG - Intergenic
1067008913 10:42691450-42691472 CACTGCCTGCAGCCAGGAGCGGG - Intergenic
1067038295 10:42934621-42934643 CCCTGGCAGGAGCAAGGAGCAGG - Intergenic
1067498941 10:46785256-46785278 CGCCTGCAGGAGCCAGGCGAGGG + Intergenic
1067595701 10:47555117-47555139 CGCCTGCAGGAGCCAGGCGAGGG - Intergenic
1067816517 10:49481761-49481783 GGCTGACAGGATCGAGGAGATGG - Intronic
1067833264 10:49622243-49622265 CTGTGCCAGGAGCCAGGAATGGG - Intronic
1068536480 10:58245260-58245282 AGCTGCCAGGGGCCAGGAGAAGG + Intronic
1068881033 10:62049072-62049094 CGCAGCCTGGAGCCAGGGCATGG - Intronic
1069394742 10:67976685-67976707 CTCTGCCAGGGGCTGGGAGAGGG - Intronic
1070401514 10:76056894-76056916 AGCTGGCAGGAGCCAGGAACAGG - Intronic
1070698647 10:78582577-78582599 AGCTGGTAGGAGGCAGGAGAGGG + Intergenic
1070776504 10:79112948-79112970 GGGAGCCAGGAGCCAGGAGGAGG - Intronic
1073064667 10:100750926-100750948 TGCAGGCAGGAGCCAGGAGCTGG - Intronic
1075035157 10:119059570-119059592 TGCTGTAAGGAGACAGGAGAAGG - Intronic
1075066808 10:119294361-119294383 CTCTGCCAGGACCTAGGAGTTGG + Intronic
1075101166 10:119507267-119507289 CTCTGCCACCACCCAGGAGAGGG + Intronic
1075475285 10:122728814-122728836 AGGTGCCAGGTGACAGGAGAGGG + Intergenic
1075834770 10:125444189-125444211 CACTGCCAAGGGTCAGGAGAGGG - Intergenic
1075922945 10:126228028-126228050 AGCTTCCAGAAGCCAGGGGAGGG + Intronic
1076356367 10:129856558-129856580 GGTTGCCAGGAGCTAGGGGAGGG + Intronic
1076422666 10:130342131-130342153 AGCTGCAAGGAGACAGGAGTTGG + Intergenic
1076568124 10:131412685-131412707 AACTGCCAGAAGCCAGGAGAGGG + Intergenic
1076570884 10:131432199-131432221 CGCTGCCAGGGCCCAGGTGAGGG + Intergenic
1076683172 10:132185750-132185772 CGCTGCCGGGCGGCAGGAGGCGG + Intergenic
1076970724 11:130586-130608 CGCTGACAGGAGGCAGGAGCTGG + Intergenic
1077200411 11:1304173-1304195 CCACTCCAGGAGCCAGGAGAGGG + Intronic
1077210253 11:1367826-1367848 CTCTGCCAGGACCCAGGGGTGGG + Intergenic
1077395285 11:2317496-2317518 GGCAGCCAGGTGGCAGGAGAGGG - Exonic
1077550440 11:3197757-3197779 AGCTGGCAGGAGCCAGAGGAAGG - Intergenic
1077583561 11:3433531-3433553 GGTTGCCAGGAGCCAGGGGTGGG - Intergenic
1077844830 11:6013177-6013199 AGCTGATAGGAGCCAGGAGCAGG - Intergenic
1079407196 11:20157187-20157209 CGCGGCCAGCGGCCAGGAGAAGG + Exonic
1079594454 11:22224981-22225003 GGCTACCAGAAGCCAGGAAAGGG + Intronic
1079870761 11:25794972-25794994 CACTCCTAGGAGACAGGAGAGGG - Intergenic
1081706918 11:45187652-45187674 AGCAGCCAGCAGCCAGCAGATGG + Intronic
1081745930 11:45472410-45472432 GGCTGCCAGAAGCTGGGAGAGGG + Intergenic
1083276364 11:61599272-61599294 CGCTGCCAGGGGGCAGAAGCGGG - Intergenic
1084027541 11:66461369-66461391 TGCAGCCAGCAGCCAGCAGAAGG - Intronic
1084589232 11:70080453-70080475 ACCAGCCAGGAGCCAGGGGATGG + Intronic
1084636753 11:70398282-70398304 CGCTGCCCGGGGCCGGGGGAAGG - Intergenic
1084789941 11:71468033-71468055 TGAAGCCTGGAGCCAGGAGACGG + Intronic
1085281903 11:75336413-75336435 CGCTGAGAGGAGTCAGCAGAAGG - Intronic
1085467082 11:76731383-76731405 CTCTGCCAGGACCTAGGAGCTGG - Intergenic
1085773276 11:79343154-79343176 CTCTTCCAGGGGCCAGGAGGAGG - Intronic
1085792680 11:79509469-79509491 AGCTGCCAGAAGCTAGGAGAGGG + Intergenic
1085824912 11:79835237-79835259 AGCTGCCTGGAGCCAAGACAGGG + Intergenic
1086080892 11:82901323-82901345 CGGTGGCAGGAGGCAGGAGGGGG - Intronic
1087731578 11:101784277-101784299 AGTTGCAATGAGCCAGGAGATGG - Intronic
1088791668 11:113232096-113232118 CAGTGCCAGGAGACAGGATATGG + Intronic
1089588146 11:119522883-119522905 TGGTTCCAGGGGCCAGGAGATGG + Intergenic
1089616295 11:119696679-119696701 GGCTGGCAGGAACCAGGAAAGGG + Intronic
1089711650 11:120319161-120319183 TGCTGCCAGGAGAAAGGAGAGGG - Exonic
1089731922 11:120524684-120524706 AGCTGCCATGAGTCAGGAGGAGG + Intronic
1089801239 11:121030143-121030165 CTCTGCCAAGAGACAGGAAAAGG + Intronic
1089853114 11:121517240-121517262 GGCTGCCAGGGGCTGGGAGAAGG - Intronic
1090040182 11:123283755-123283777 CTCTTCCTGGTGCCAGGAGAAGG - Intergenic
1090196850 11:124823904-124823926 CACTGCCTGGAGCCAGGGAAAGG + Intergenic
1091327473 11:134701800-134701822 GGCCGCCAGGACCCAGGGGAAGG - Intergenic
1091675843 12:2488715-2488737 CCCTGCCAGGCTCCATGAGAAGG + Intronic
1091721916 12:2820145-2820167 CGCTGGGAGGAGCTAGGTGAGGG + Exonic
1091798655 12:3311081-3311103 TGCTGCCTGGAGCCAGCAGCTGG - Intergenic
1092193010 12:6533901-6533923 AGATGCCAGGAGCCAGGAGATGG + Intergenic
1092410709 12:8250899-8250921 GGTTGCCAGGAGCCAGGGGTGGG - Intergenic
1092425582 12:8373117-8373139 CTCTGCAACAAGCCAGGAGATGG - Intergenic
1092492248 12:8956207-8956229 GGCCGCCTGGTGCCAGGAGAGGG - Intronic
1092540729 12:9418513-9418535 CGCTGCCAGGACCCAGGCACAGG - Intergenic
1092767838 12:11869534-11869556 CGCTGCTCGGGGTCAGGAGAAGG - Exonic
1092915904 12:13188787-13188809 AGCTTCCAGGAGCCACGAAAAGG + Intergenic
1093940726 12:25050954-25050976 GGTTGCCAGGAGCTAGGGGAGGG + Intronic
1095986470 12:48002839-48002861 AGCTGCGAGGAGCCGGGAGCAGG - Intronic
1096487624 12:51994413-51994435 CGTGGCCAGGAGCCATGACAGGG + Intronic
1096789522 12:54036169-54036191 CCATCCCAGGAGCCTGGAGAAGG - Intronic
1098961423 12:76743694-76743716 AGATTCCAGGAGACAGGAGAAGG - Intergenic
1100819371 12:98417009-98417031 CACTCCCATTAGCCAGGAGAGGG + Intergenic
1101606042 12:106248141-106248163 CGCCGCCACGACCCCGGAGAGGG + Intronic
1101702876 12:107191859-107191881 CCCTCCCTGGAGCCTGGAGAGGG - Intergenic
1101735732 12:107461454-107461476 AGCCTCCAGAAGCCAGGAGAGGG + Intronic
1102648632 12:114420350-114420372 GGCTCCCAGGAGCAGGGAGAAGG + Intergenic
1102687286 12:114734799-114734821 GGATGCCAGGAACCGGGAGAGGG - Intergenic
1102882797 12:116498582-116498604 ACCTGCCAGGAGCCAGGAACTGG - Intergenic
1104439182 12:128781270-128781292 CGCTGGCAGCCACCAGGAGATGG + Intergenic
1104443963 12:128818774-128818796 GGTTGCCACGGGCCAGGAGAGGG - Intronic
1104519608 12:129461254-129461276 AGATGACAAGAGCCAGGAGAAGG + Intronic
1104864523 12:131944955-131944977 GGCTGCCAGGAGCCCAGGGAGGG + Exonic
1104955240 12:132461609-132461631 GGCCGCCAGGAGCCTGGGGAGGG + Intergenic
1105439590 13:20404182-20404204 AGCTGCCAGGAGGCAGTGGAGGG - Exonic
1105603234 13:21905950-21905972 GCCTGCCAGGTGCCAGGAGCTGG + Intergenic
1106074648 13:26447839-26447861 GGCTGCCAGGAAACAGAAGAAGG - Intergenic
1106256844 13:28030000-28030022 TGGTGCCTGGAGCCTGGAGAGGG - Intronic
1106330631 13:28736235-28736257 AGCTGACAGAAGGCAGGAGATGG - Intergenic
1107080590 13:36370351-36370373 CTCTGGCAGGAGCCAGGAGATGG + Intergenic
1108046239 13:46387191-46387213 CGCTGCCCGGAGCCGCGCGAGGG - Exonic
1109396600 13:61766662-61766684 AGGTGCCAGGAGCCAGGAGAAGG + Intergenic
1109837315 13:67877208-67877230 CGCTGGCAGGAGCCAGGAACAGG + Intergenic
1110370069 13:74729893-74729915 CTCTTCCAGGCCCCAGGAGATGG - Intergenic
1110448661 13:75617272-75617294 AGCTGCCTGGAGCTGGGAGATGG + Intergenic
1110939877 13:81336555-81336577 AGCCGCCAGAAGCCAGAAGAGGG + Intergenic
1111348364 13:86994210-86994232 CAGTGGCAGGAGGCAGGAGATGG + Intergenic
1112492978 13:99883793-99883815 GGATGCCAGGAGACAGGAGAGGG - Intronic
1113244128 13:108376335-108376357 AGCTGCCTGGAGCTGGGAGAGGG + Intergenic
1113469400 13:110533844-110533866 GGCTGCCTGGAGCCAGCACAGGG + Intronic
1113561311 13:111283627-111283649 TGCCGCCAGGGGCCAGGAGCTGG + Intronic
1114320318 14:21541730-21541752 AACTGCGAGGAGCAAGGAGAAGG + Intergenic
1114469252 14:22947912-22947934 GGATGCCAAGAGCCAGCAGAAGG - Exonic
1114664453 14:24369636-24369658 CTCTCCCAGGTGCCAGGTGAGGG - Exonic
1117418435 14:55519480-55519502 ACCTGCCTGGAGCCAGGAGGAGG + Intergenic
1117865687 14:60146890-60146912 GGTTGCCAGGAGCCAGAAGATGG + Exonic
1117870889 14:60198861-60198883 AGCTTCCTGGAGCTAGGAGAGGG - Intergenic
1118764346 14:68899927-68899949 GGCTGCGAGGGGCCAGGGGAGGG + Intronic
1119257299 14:73209223-73209245 AGCTGGCAGGAGCCAGGAACAGG - Intronic
1119779620 14:77269507-77269529 TGCTGCCCAGAGCCAGTAGAAGG - Intronic
1120210719 14:81631016-81631038 AGCTGCCAGGAGCCTGATGATGG - Intergenic
1120410769 14:84152581-84152603 AGCTACCAGGGGCCAGGAGCAGG + Intergenic
1120693315 14:87617503-87617525 ACCTGCAAGTAGCCAGGAGATGG - Intergenic
1120876912 14:89383566-89383588 GGCCGCCAGAAGCCAGGAGGAGG - Intronic
1121153071 14:91654875-91654897 AGCTGCCTGGAGCTAGGGGAGGG - Intronic
1122139570 14:99654458-99654480 CATTGGCAGGAGCCTGGAGAGGG - Intronic
1122761717 14:104033601-104033623 CTCTGCCAGGATGCAGGTGATGG + Intronic
1122828478 14:104383714-104383736 CGCTGCCGGGAGCCTGGGGCGGG + Intergenic
1123041212 14:105490981-105491003 CCCTGCCAGGAGCCCGGAAGTGG + Exonic
1123435540 15:20251485-20251507 CGCAGCCATGAGCCAGGCGCTGG - Intergenic
1124417859 15:29488944-29488966 GGCTTCCAGGGGCTAGGAGAGGG + Intronic
1124458455 15:29866809-29866831 AGCTGTCAGGAACCTGGAGAAGG + Intronic
1124546836 15:30636745-30636767 CACTACCAGGAGCCAGGAAGAGG - Intronic
1124651265 15:31476118-31476140 CGCTGTTAGGAGCAAGGAGCAGG - Exonic
1124780439 15:32626741-32626763 CACTACCAGGAGCCAGGAAGAGG - Intronic
1125917117 15:43497706-43497728 GGCTGCCAGGAGCTAGGAGGAGG + Intronic
1128128509 15:65210435-65210457 CACAGCCAGGAGCCAGCTGACGG + Intronic
1129116275 15:73367200-73367222 CCCTGCCGGCAGCCAGGATAGGG - Intronic
1129187227 15:73916307-73916329 TGCTGCCAGCAGCCATGTGAGGG - Intergenic
1129738301 15:77977718-77977740 GGCTGGAAGGAGGCAGGAGAGGG + Intergenic
1129847775 15:78775895-78775917 GGCTGGAAGGAGGCAGGAGAGGG - Intronic
1130141937 15:81234955-81234977 GGCAGCCAGGAGCCATGAAATGG - Intronic
1130254128 15:82318020-82318042 GGCTGGAAGGAGGCAGGAGAGGG + Intergenic
1130600843 15:85271951-85271973 GGCTGGAAGGAGGCAGGAGAGGG - Intergenic
1131387368 15:92018571-92018593 GGCTGCCAGGAGGCTGGTGAGGG - Intronic
1131680808 15:94721018-94721040 AGTTGTCAGGAGCCAGGAGATGG - Intergenic
1132327558 15:100984498-100984520 AGTTGCCAGGGGCCAGGGGAGGG - Intronic
1132397154 15:101482372-101482394 CAGTCCCAGGAGCCAGGAGGAGG + Intronic
1132764870 16:1529253-1529275 TCATGCCTGGAGCCAGGAGAGGG + Intronic
1132890839 16:2203817-2203839 CGGGGACAGGAGCTAGGAGAAGG + Intergenic
1133119854 16:3599310-3599332 CGCTGTCAGGAGCAAAGGGAAGG - Intronic
1133351927 16:5107078-5107100 GGTTGCCAGGAGCCAGGGGTGGG - Intergenic
1136073669 16:27804206-27804228 CGGTGGCAGGAGGCAGGACAGGG - Intronic
1136187866 16:28598719-28598741 AGGTGCCAAGAGCCTGGAGAAGG + Intergenic
1136190338 16:28611713-28611735 AGGTGCCAAGAGCCTGGAGAAGG + Intronic
1136634055 16:31508146-31508168 CACGGCCTGGAGCCCGGAGAGGG + Exonic
1136849066 16:33599510-33599532 CGCAGCCATGAGCCAGGTGCTGG + Intergenic
1138407050 16:56804533-56804555 GGTTGCCAGGAGCTAAGAGATGG + Intronic
1139775637 16:69315477-69315499 AGCTGCATGGAGCCAGGAGGAGG + Intronic
1140555562 16:75917040-75917062 AGCTACCAGGAGCCAGGAGAAGG - Intergenic
1140962895 16:79933897-79933919 CTCTGCAAGGAGCCTGGTGAGGG + Intergenic
1141154896 16:81590424-81590446 AGCTGCCAGGACCCCGGACAAGG - Intronic
1141403913 16:83774764-83774786 GGCTGCCAGGGGCCAGGGGAAGG + Intronic
1141444324 16:84048260-84048282 GGTTGCCAGGAGCTAGGGGAAGG - Intergenic
1141536075 16:84680802-84680824 GGCTGCCAGGGGCTGGGAGATGG + Intergenic
1141620578 16:85234997-85235019 GGATGCGAGGAGCCAGGAGGGGG - Intergenic
1141661846 16:85445719-85445741 CTCTCCCTCGAGCCAGGAGAGGG - Intergenic
1142434261 16:90047090-90047112 TGCTGCCCTGGGCCAGGAGAAGG + Intergenic
1142449525 16:90166897-90166919 CGCTGACAGGAGGCAGGAGCTGG - Intergenic
1203110773 16_KI270728v1_random:1448160-1448182 CGCAGCCATGAGCCAGGTGCTGG + Intergenic
1142457567 17:64949-64971 CGCTGACAGGAGGCAGGAGGTGG + Intergenic
1142607067 17:1087793-1087815 CCCTCCCAGGAGCCAGGGGCAGG + Intronic
1143324184 17:6087727-6087749 CTCTGCCAGGAGCCAGGCGTCGG - Intronic
1143781739 17:9232777-9232799 CCCGGCAAGGAGTCAGGAGAGGG + Intronic
1143894937 17:10128353-10128375 TGCTCCCAGGAGCCATTAGAGGG + Intronic
1144469505 17:15524932-15524954 CATTGCCAGAAGCCAGGAGGAGG - Intronic
1144666287 17:17104597-17104619 CTCTGCTAGCAGCCAGGGGAAGG - Intronic
1144872184 17:18378177-18378199 CCCTGGCAGGAGGCAGGGGATGG + Intronic
1145284477 17:21495117-21495139 TGCTACCTGGAGTCAGGAGAAGG - Intergenic
1145392983 17:22470377-22470399 TGCTACCTGGAGTCAGGAGAAGG + Intergenic
1146322592 17:31858763-31858785 CGCTGCCAGGAGCCTGGGCGAGG - Intronic
1146560558 17:33865227-33865249 CGTCCCCAGGAGCCATGAGATGG + Intronic
1146657973 17:34646102-34646124 CATTGTCAGGAGACAGGAGATGG + Intergenic
1147166981 17:38598721-38598743 GGCTACCAGGAGCCAGGATAAGG + Intronic
1147339698 17:39746088-39746110 GGCTGCCAGAAGACAGGAGATGG - Exonic
1147345077 17:39786035-39786057 GGCTGCCAGGAGCTAGAGGAAGG + Intronic
1147964837 17:44189028-44189050 CCCTGCCAGCAGCCAGGCCATGG + Exonic
1148384310 17:47223208-47223230 GGCAGGCAGGAGACAGGAGATGG - Intronic
1149188688 17:54031706-54031728 AGCTGCCTGGAGCTAGGGGAGGG - Intergenic
1149548405 17:57521570-57521592 CCCTGCCAGAAGTCAGGAGCAGG - Intronic
1150315100 17:64162676-64162698 CCCTGCCAGGAGCTGGGAGGTGG + Intronic
1150334989 17:64324357-64324379 TACGGGCAGGAGCCAGGAGAGGG - Intronic
1150649454 17:67000507-67000529 AGGAGCCTGGAGCCAGGAGAGGG + Intronic
1151119538 17:71777239-71777261 CGCTGCCAGCAGACAGGCGGAGG - Intergenic
1151320683 17:73350546-73350568 CGCTGCCAGGAGCCAGGAGAGGG + Intronic
1151838014 17:76596760-76596782 GGCTGCCATGAGCAGGGAGAGGG - Intergenic
1151979507 17:77500126-77500148 GGCTGCTTGCAGCCAGGAGAAGG + Exonic
1152037057 17:77880070-77880092 CGCTGCCGGGCGGCAGGAGGCGG + Intergenic
1152296095 17:79467717-79467739 TCCTGCCAGGATCCAGGAGTGGG + Intronic
1152339305 17:79715598-79715620 CGCTGGCTGGAGCCAGGGCAGGG + Intergenic
1152418085 17:80175878-80175900 CCCTGCCAGGAAGCAGGAGGAGG - Intronic
1152630295 17:81407979-81408001 AGGAACCAGGAGCCAGGAGACGG - Intronic
1152639606 17:81444130-81444152 CACTTTCAGGGGCCAGGAGATGG + Intronic
1152891974 17:82887318-82887340 GGCTGCCAAGGGTCAGGAGAGGG - Intronic
1152905060 17:82965479-82965501 TGCTGGCAGGTGCCAGGAGGGGG + Intronic
1152938125 17:83152413-83152435 CGCTGCCTGGGGGCAGGAGAGGG + Intergenic
1152938162 17:83152550-83152572 CGCTGTCTGGGGGCAGGAGAGGG + Intergenic
1152938193 17:83152680-83152702 CGCTGCCTGGGGGCAGGAGAGGG + Intergenic
1153139507 18:1955059-1955081 AGCTGGCAGGAGCCGGGAGCAGG - Intergenic
1157210699 18:45739640-45739662 CACAGCCAAGAGCCAGGAGGTGG - Exonic
1158047818 18:53177382-53177404 GGCTGCCAGGAGCTAAGTGATGG - Intronic
1159394648 18:67839650-67839672 CACTGCCAGGGGATAGGAGAGGG + Intergenic
1159837753 18:73359926-73359948 AGCTGCCAGGGCCAAGGAGAGGG - Intergenic
1160386834 18:78501985-78502007 CACTGGCAGGAGGCAGGAGGAGG + Intergenic
1160591471 18:79947242-79947264 TGGTGCCAGAAGCCAGGAGAAGG - Intronic
1160717615 19:583494-583516 CACAGACAGGAGCCAGGAGAGGG - Intergenic
1160885227 19:1343312-1343334 GGCTGCCAGGGGCCGGCAGAGGG + Intergenic
1161063477 19:2226674-2226696 CGCGGCAAGGAGGCAGGGGAGGG + Exonic
1161345483 19:3767011-3767033 CAGTGCTAGGAGGCAGGAGAGGG + Intronic
1161800845 19:6416135-6416157 CTCTACCAGTAGACAGGAGAGGG + Intronic
1161941043 19:7404275-7404297 GGCTCCCTGGAGCCAGGACAGGG - Intronic
1162438181 19:10675907-10675929 CGGATCCAGGAGCCAGGAGGAGG - Intronic
1162506569 19:11089580-11089602 CGCGGCGAGGAGCAAGGCGACGG - Exonic
1163322343 19:16582157-16582179 CACTCCCTGGAGCCAGCAGAAGG + Intronic
1163353914 19:16797291-16797313 CCCTGCTAGGTGCCAGGAGAAGG - Intronic
1163395630 19:17059085-17059107 ACCTGCCAGGTGCCAGGGGAAGG - Intronic
1163636822 19:18440889-18440911 CCCTGGCAGGTGGCAGGAGAGGG + Intergenic
1164455842 19:28405902-28405924 AGCTGCGCGGAGGCAGGAGATGG - Intergenic
1164609970 19:29625149-29625171 CACCGCCAGGAGGCAGGAGCTGG - Intergenic
1164624141 19:29715323-29715345 CGCAGCTCGGAGCCAGGAGCTGG - Intronic
1164717699 19:30405494-30405516 TGAAGCCAGGAGCTAGGAGATGG - Intronic
1164938148 19:32230776-32230798 CGGTGCAAGGAGCAAGGACATGG + Intergenic
1165031699 19:33002355-33002377 CGCAGCCATGAGCCAGGCGCCGG - Exonic
1165895235 19:39137281-39137303 CCCTGCTTGGAGGCAGGAGAAGG + Intronic
1166750693 19:45162782-45162804 CTCTGCCAGGAGCACGGGGAGGG + Intronic
1167080840 19:47275194-47275216 GACTCCCAGGAGGCAGGAGAGGG - Exonic
1167645414 19:50702851-50702873 GGAAGCCAGGAGGCAGGAGAGGG - Intronic
1168312515 19:55468030-55468052 CAATGACAGGAGACAGGAGAGGG - Intergenic
924988242 2:289335-289357 GGCGGCCAGGAGGCAGGAGATGG + Intergenic
925765735 2:7233555-7233577 AGCTGCCAGCAGCCAAGATAGGG + Intergenic
926148129 2:10409359-10409381 GGCTGCCAGGACCCAGGTGCAGG - Intronic
926216448 2:10908537-10908559 TGCAGCCAGAAGCCAGGGGAGGG - Intergenic
926502723 2:13675766-13675788 CGGTGCAAGATGCCAGGAGAGGG - Intergenic
927000316 2:18788162-18788184 TGTTGCCAGGAGGCAGAAGAAGG + Intergenic
927150635 2:20193558-20193580 GGCTGCCAGGAGCCAGGGGTGGG + Intergenic
927158265 2:20234770-20234792 GGCTGCCAGGAGCCAGGGGTGGG - Intergenic
930021635 2:47005184-47005206 GGTTGGAAGGAGCCAGGAGAGGG + Intronic
930971991 2:57407773-57407795 TGCTGCCAGGAGACAGGGGAGGG - Intergenic
931781592 2:65583300-65583322 CGCTCCCAGGAGTAAGGAGTGGG + Intergenic
932141981 2:69287135-69287157 TCCTGCCAGGTGCCAGGAGCTGG + Intergenic
932812663 2:74837329-74837351 TGCTACCAGCAGCCAGGAGTGGG - Intronic
932813662 2:74844602-74844624 CGCTGGCAGCAGACAGGAGTGGG + Intronic
932889602 2:75580413-75580435 AGCTGCCAGGAGCTTGGGGAGGG - Intergenic
933798654 2:85942271-85942293 CTCTGAAAGCAGCCAGGAGAAGG - Intergenic
933850834 2:86365295-86365317 AATTGCCAGAAGCCAGGAGAGGG + Intergenic
934752334 2:96801020-96801042 CGCAGTCAGGAGACAGGACACGG - Intronic
934987977 2:98900941-98900963 TGGTGCCAGGAGGCAGGTGAAGG + Intronic
935238001 2:101153850-101153872 AACTGCCAGAAGCCGGGAGAGGG + Intronic
936145557 2:109978419-109978441 GGCTGCCAGGAGCCAGTCTATGG + Intergenic
936199129 2:110393059-110393081 GGCTGCCAGGAGCCAGTCTATGG - Intergenic
936241314 2:110790808-110790830 GGCTGGGAGGAGCCAGGAGGAGG - Intronic
936274621 2:111083744-111083766 CTCTCCCAAGAGCCAGGAAAGGG + Intronic
937111963 2:119373354-119373376 GGCAGCCAGGGGCCATGAGAGGG - Intergenic
937981914 2:127620652-127620674 GGCTGGAAGGAGCCAGGAGCAGG - Intronic
938063590 2:128269688-128269710 CGTGGACAGGAGCCAGGAGGAGG - Intronic
938070901 2:128307719-128307741 CCAGGCCAGGAGCCAGGAAATGG - Intronic
940178373 2:150904376-150904398 AGCTGGAAGGAGCCAGGAAAGGG - Intergenic
940802929 2:158153481-158153503 TGCTGCCTGGAGCTAGGGGAGGG - Intergenic
942321497 2:174740581-174740603 CAATCCCAGGAGCCAGGAGATGG + Intergenic
942321635 2:174741395-174741417 CAATCCCAGGAGCCAGGAGATGG - Intergenic
942678200 2:178450759-178450781 CGCCGCCAGGGACCACGAGAGGG + Intronic
943060437 2:183037750-183037772 CGCCGCCGGGAGCCGGGAAATGG + Intronic
945929855 2:215843889-215843911 CCCTGCCTGGGGCCAGGAGGAGG - Intergenic
946159509 2:217827568-217827590 CGGTGCCTGCAGGCAGGAGAAGG + Intronic
946225476 2:218261986-218262008 AGATGCCAGCAGCAAGGAGAGGG - Intronic
946309388 2:218874271-218874293 GGCTGCCAGGCTCCAGAAGAAGG + Intergenic
947585529 2:231354087-231354109 TTCTGCCAGGTGCCAGAAGAGGG - Intronic
947586316 2:231359040-231359062 GACAGCCAGGAGCTAGGAGATGG - Intronic
947716055 2:232339361-232339383 CGCCGCCAGGAGGCAGGAAGTGG + Intronic
948016699 2:234697046-234697068 CGGTGAAAGCAGCCAGGAGAGGG - Intergenic
948301464 2:236910127-236910149 CCCAGCCAGAGGCCAGGAGAGGG - Intergenic
949070074 2:242019224-242019246 AGCTTCCCGGAGTCAGGAGACGG + Intergenic
1168809705 20:697019-697041 ACCTGTCAGGAGTCAGGAGAGGG - Intergenic
1168917423 20:1501462-1501484 CACTGCCAGGGGTTAGGAGAGGG + Intergenic
1169880428 20:10341321-10341343 AGGTGCTGGGAGCCAGGAGAAGG - Intergenic
1169988598 20:11474185-11474207 TGCTGCCAGGAGACTGGGGAGGG - Intergenic
1171968676 20:31549739-31549761 GGCTGCCTGGGGCCAGGAAAAGG - Intronic
1172172443 20:32946803-32946825 GGCTGCCAGGGGTTAGGAGAAGG - Intronic
1172843204 20:37914615-37914637 GGGAGCCAGGAGCCGGGAGACGG - Intronic
1174061444 20:47835719-47835741 AGCTTCCTGGAGTCAGGAGATGG - Intergenic
1174070082 20:47893604-47893626 AGCTTCCTGGAGTCAGGAGATGG + Intergenic
1174156311 20:48517621-48517643 AGCTTCCTGGAGTCAGGAGATGG - Intergenic
1174607627 20:51772491-51772513 CGGTGCCAGGGTCTAGGAGAGGG + Intergenic
1174982035 20:55407590-55407612 AGCTGCCTGGAGCTGGGAGAGGG + Intergenic
1175044700 20:56093986-56094008 CCATGACAGCAGCCAGGAGAGGG - Intergenic
1175470097 20:59221471-59221493 CCCTGCCAGCAGCCAGCAGTGGG - Intronic
1175868219 20:62192782-62192804 CTGTGTCAGGAGCCAGGAGCAGG + Intronic
1175979300 20:62729005-62729027 TGCTGGCAAGAGCCAAGAGATGG + Intronic
1176367135 21:6039996-6040018 TGCTCCCAGGCGCCAGGACAAGG - Intergenic
1178514063 21:33230752-33230774 CGCTGCGTGGAGGCAGGAGGGGG + Intronic
1178780534 21:35598867-35598889 GGCTGCAAGGAGGGAGGAGAGGG - Intronic
1178805379 21:35834777-35834799 TGCTGGTGGGAGCCAGGAGAGGG + Intronic
1179756384 21:43498550-43498572 TGCTCCCAGGCGCCAGGACAAGG + Intergenic
1179802910 21:43819889-43819911 CACTGCCAGGACCCAGGCGTTGG - Intergenic
1180114575 21:45691906-45691928 CTGTGCAAGAAGCCAGGAGATGG + Intronic
1180927500 22:19566528-19566550 AGCGGTCAGGAGCAAGGAGAAGG + Intergenic
1180927940 22:19569015-19569037 GGCTGGCAGGAGCCAGGGGCTGG + Intergenic
1181007178 22:20019412-20019434 CGATGCCAGGAAGCAGGTGACGG - Intronic
1181053069 22:20246739-20246761 CGATGCCAGGAGGCAGCACAGGG + Intronic
1181277450 22:21695620-21695642 GGCTCCCAGGGGCCAGGAAAGGG - Intronic
1181305930 22:21917278-21917300 CACTGCCGGGAGCCGGGGGAGGG + Intergenic
1181316615 22:21974723-21974745 GGCTGCCGGGAGCCAGGAGCAGG + Intronic
1182275882 22:29188342-29188364 GGCTACCCGAAGCCAGGAGAGGG - Intergenic
1182450316 22:30416166-30416188 TGGTGCCAGGACCCCGGAGAGGG + Intronic
1183341258 22:37283179-37283201 CGCTGCCTAGAGCCAGGGGAGGG + Intronic
1183347952 22:37318329-37318351 AGCTGCCAGGGGACAGGAGATGG + Intergenic
1183453456 22:37908829-37908851 AGATGGCAGGAGCCAGGTGAGGG + Intronic
1183497326 22:38154372-38154394 GGCCGCCTGGAGCTAGGAGAGGG - Intronic
1183736386 22:39647046-39647068 CTCTGACAGGTGCCAGGAGAGGG - Intronic
1184420916 22:44382427-44382449 CACAGCCAGGAGGCAGGGGATGG + Intergenic
1184669510 22:46005444-46005466 CTCTGCCCAGATCCAGGAGAGGG - Intergenic
1184776361 22:46625480-46625502 CTGGGCCAGGAGCAAGGAGATGG - Intronic
1184777877 22:46632324-46632346 CCCGACCAGGAGGCAGGAGATGG + Intronic
1185315705 22:50178323-50178345 CGCCTCCCGGAGCCAGGAGGGGG + Exonic
949448420 3:4161200-4161222 TGCTGCCTGGAGCTAGGGGAGGG + Intronic
950144672 3:10640574-10640596 CGAGGCCAGAAGGCAGGAGAAGG + Intronic
950457449 3:13101123-13101145 CGCAGCGAGGAGCCATGGGAGGG + Intergenic
950716290 3:14849991-14850013 AGTTGCCAGGAGCTATGAGAGGG - Intronic
952021329 3:29024569-29024591 AGCTTGCAGGAGCCAGGAGCCGG + Intergenic
953176816 3:40561054-40561076 AGCTGGGATGAGCCAGGAGAAGG - Intronic
953210126 3:40868276-40868298 CGCTTCCAGGAGTCAGTTGAGGG - Intergenic
953279476 3:41539841-41539863 TGCTTTCATGAGCCAGGAGATGG + Intronic
953594053 3:44291012-44291034 CACAGCCAAGAGACAGGAGAAGG - Intronic
954376610 3:50197386-50197408 GGATGCCAGGAGCCGGGGGAAGG - Intergenic
954401690 3:50322569-50322591 CCCTCCCGGGCGCCAGGAGAGGG + Exonic
954435522 3:50493859-50493881 CGAAGCCAGCAGCCTGGAGAGGG + Intronic
955236262 3:57142539-57142561 CCCTGCCAGGAGGCCGGAGTGGG - Intronic
956653096 3:71523197-71523219 CCCTGCCAGGAGGTAGGAGAAGG + Intronic
957055933 3:75443008-75443030 GGTTGCCAGGAGCCAGGGGTGGG - Intergenic
957264866 3:77949910-77949932 CACTCCCAGGAGCAAAGAGAAGG - Intergenic
958441316 3:94159306-94159328 GGCTTTTAGGAGCCAGGAGAGGG + Intergenic
959090089 3:101893162-101893184 GGCTGCCAGGAGCTAGGGGGAGG - Intergenic
959191060 3:103112338-103112360 CACTGCCAGGAGACAGAAAAGGG - Intergenic
961199533 3:125033327-125033349 GGCTGCCAAGAATCAGGAGATGG + Intronic
961298444 3:125905595-125905617 GGTTGCCAGGAGCCAGGGGTGGG + Intergenic
961370001 3:126423261-126423283 AGCAGACAGGAGCCAGGGGAGGG - Intronic
961604508 3:128083633-128083655 GGCTGCGATGAGCCAGGTGAGGG + Intronic
962264479 3:133935372-133935394 CTCTGCCAGGAGCCATGATGTGG + Intronic
962932566 3:140051543-140051565 GGCTGCAAGGGGCCAGGAGGAGG + Intronic
963020352 3:140868024-140868046 GGCTGCCTGGAGCTGGGAGAGGG + Intergenic
964785684 3:160393501-160393523 GGCTGCCAGGGGCTAGGGGAAGG + Intronic
965061451 3:163789143-163789165 AGCTGGCAGGGGCCAGGATAAGG - Intergenic
965237007 3:166137017-166137039 TGCTGCCAGGGGCCTGGGGACGG + Intergenic
965560167 3:170054629-170054651 AGTAGCCAGGAGCTAGGAGAAGG - Intronic
967392645 3:188972457-188972479 GGCTGCCAAGAGGCAGGAAAGGG + Intronic
968049280 3:195643102-195643124 AGCTTCCCGGAGTCAGGAGACGG + Intergenic
968061843 3:195731762-195731784 CACAGCCAGGTGCCAGGGGACGG + Intronic
968098122 3:195946526-195946548 AGCTTCCCGGAGTCAGGAGACGG - Intergenic
968106627 3:196006042-196006064 AGCTTCCCGGAGTCAGGAGACGG - Intergenic
968305336 3:197646832-197646854 AGCTTCCCGGAGTCAGGAGACGG - Intergenic
968509507 4:989210-989232 GGCTGCCAGGAGGAAGGAGGGGG - Exonic
968735174 4:2291518-2291540 TGCTGCCAGGAGCAGGGAGTAGG + Intronic
968940463 4:3634872-3634894 AGATTCCTGGAGCCAGGAGAAGG - Intergenic
968998737 4:3963317-3963339 GGTTGCCAGGAGCCAGGGGTGGG - Intergenic
969279907 4:6162763-6162785 CCCAGCCAGGAGCCAGGTGTGGG + Intronic
969338501 4:6526294-6526316 CTCTGGCAGGAGCCAGAAGCAGG - Intronic
969484668 4:7465489-7465511 CACTGTGAGGAGCCAGGAGCTGG + Intronic
969921855 4:10547651-10547673 GGCTGCCAGGAGCAAGGAGGAGG - Intronic
971406221 4:26322110-26322132 CGCCGTCAGGAACCAGGAGGGGG - Intronic
971992377 4:33916039-33916061 AACTGCCAGGAGCCATTAGATGG + Intergenic
974836448 4:67256873-67256895 AGCTGGCAGGAGCCAGCAGATGG - Intergenic
975258123 4:72263380-72263402 AGATGCCAGGAGCAAGGAGAAGG + Intergenic
976126118 4:81835414-81835436 CACCACCAGGAGCCAGGACAAGG + Intronic
976722168 4:88179166-88179188 AGCCGCCTGGAGCTAGGAGAGGG - Intronic
977280404 4:95032532-95032554 TGTTGCCAGGAGCTAGGAGAGGG - Intronic
977985728 4:103380352-103380374 AGCTGCCTGGAGGCAGGAGAGGG - Intergenic
979258868 4:118631205-118631227 TGCTGACAGGAGGCAGGAGCTGG - Intergenic
979329482 4:119409352-119409374 CGCTGACAGGAGGCAGGAGCTGG + Intergenic
979530910 4:121768205-121768227 CGCTGGCAAGTGGCAGGAGAGGG + Intergenic
981695289 4:147553247-147553269 CAATGCCAGCAGCCAGGAGAGGG + Intergenic
982234390 4:153238811-153238833 CACTGCAAGAGGCCAGGAGATGG + Intronic
982626788 4:157777475-157777497 TGCTGCTAGTAGCCATGAGATGG + Intergenic
982719803 4:158847907-158847929 CTCTGCCTGGGGACAGGAGAGGG + Intronic
984765745 4:183399009-183399031 CGCTGCCAGGCGCCGGGACCGGG + Intergenic
985505837 5:279938-279960 AGCTTCCCGGAGTCAGGAGACGG + Intronic
985521219 5:374699-374721 GGCAGCCAGAAGCCCGGAGACGG - Intronic
985558068 5:567883-567905 CGCTAGCAGGAGGCAGGACATGG + Intergenic
985579709 5:690213-690235 CTCAGCCAGGAGCCAGGATCAGG - Intronic
985594555 5:782272-782294 CTCAGCCAGGAGCCAGGATCAGG - Intergenic
985612060 5:895097-895119 AGCTGTCAGGAGCCAGGTGCTGG + Intronic
985742360 5:1625988-1626010 AGCTTCCCGGAGTCAGGAGACGG - Intergenic
986401778 5:7389045-7389067 AGCCTCCTGGAGCCAGGAGAAGG + Intergenic
988109920 5:26807355-26807377 AGCTGGCAGGAGCCAGGAGCAGG + Intergenic
988199877 5:28054422-28054444 CCCTGAAAGGAGCCAGGAGTGGG - Intergenic
990226087 5:53656047-53656069 CAGTGCAAGGAGCCTGGAGACGG - Intronic
991230754 5:64330801-64330823 AGCTGGCAGGAGCCAGGAACAGG + Intronic
991359454 5:65803824-65803846 AGCTGGCAGGAGCCAGGAACAGG - Intronic
991482334 5:67094820-67094842 AGCTGGCAGGAGCCATGAAAAGG - Intronic
991967831 5:72108862-72108884 CTCTGTCAGGAGCGAGGGGAGGG - Intronic
993497954 5:88628958-88628980 AATTGCCTGGAGCCAGGAGACGG + Intergenic
994172104 5:96669013-96669035 CGCTGCCAGGAGACTAGAGGTGG - Intronic
994676881 5:102834532-102834554 GGATGCCAGGAGCCTGGGGAAGG + Intronic
995019486 5:107351451-107351473 AGCTGCCTGGAGCTAGGGGAGGG + Intergenic
995335788 5:110997986-110998008 TGCTACCAGAAGCTAGGAGAGGG + Intergenic
995784785 5:115816580-115816602 CGCTGCCAGGGGCCTGGGGGTGG - Exonic
997725424 5:136116473-136116495 CCCTGCAAGGAGCCAAAAGAAGG + Intergenic
998403112 5:141858360-141858382 CTCTGCCAGGAGCCTGGACATGG + Intronic
998722270 5:144966489-144966511 CACTGAAAGGAGCCAGGAGGAGG - Intergenic
999120998 5:149209300-149209322 CTCTGCCAGCAGCCAGGTAAGGG - Intronic
999122560 5:149220428-149220450 CTCTCCCAGGAGCCAGGAGAGGG - Intronic
999309014 5:150539426-150539448 GGCTTCCTGGAGCCAGGAAAGGG + Intronic
1001090608 5:168737428-168737450 CACTGACAGGAGACAGGAAAAGG - Intronic
1001234519 5:170018376-170018398 GAATGCCAGGAGCCAGGGGAGGG + Intronic
1001763299 5:174225085-174225107 GGCAGCCACGAGCCAGGAGGAGG - Intronic
1002103609 5:176869294-176869316 CACCCCCAGGAGCCAGCAGAGGG + Intronic
1002279481 5:178122168-178122190 CCTTGGCAGGAGCCAGGACAAGG + Exonic
1002427612 5:179185445-179185467 CCTGGCCAGGAGCCAGGAGAGGG - Intronic
1002660115 5:180786047-180786069 AGCTACCAGGAAGCAGGAGAGGG - Intergenic
1002729450 5:181324818-181324840 CGCTGACAGGAGGCAGGAGCTGG - Intergenic
1004506364 6:16250023-16250045 CTCTGCCAGGAGGCAGGAGAGGG - Intronic
1004938868 6:20534739-20534761 GGCTTCCAGGAGCGAGGATAGGG + Intronic
1006047616 6:31310494-31310516 CCAGGCCAGGAACCAGGAGAAGG + Intronic
1006068560 6:31480233-31480255 CCTGGCCAGGAACCAGGAGAGGG + Intergenic
1006510972 6:34520860-34520882 AGGAGCCAGGAGCCAGGAGGGGG - Intronic
1007254763 6:40520877-40520899 CGCGCCCAGCAGCCAGGAGCAGG + Intronic
1007800078 6:44384757-44384779 AGCCACCAGAAGCCAGGAGAAGG - Intergenic
1009306926 6:62102672-62102694 GGCTGCCAGGCACCAGCAGAGGG + Intronic
1009370498 6:62894569-62894591 AGCTGGCAGGAACCAGCAGATGG - Intergenic
1009380451 6:63021806-63021828 TGCTGCTAGGAGACAAGAGAAGG - Intergenic
1009618316 6:66039083-66039105 TGCTGCCAGGAGATGGGAGAGGG - Intergenic
1009827513 6:68885646-68885668 GGCTACCAGAAGCCAGGAGTAGG + Intronic
1010735809 6:79442869-79442891 CCATGACAGCAGCCAGGAGAGGG - Intergenic
1012122242 6:95383870-95383892 AGCTTGCAGGAGCCAGGAGCAGG + Intergenic
1012749630 6:103140810-103140832 AGCTGGCAGGAGCCAGGAACAGG - Intergenic
1013606942 6:111759225-111759247 CTGTGCCAGAAGCCAGAAGAAGG - Intronic
1014955350 6:127608382-127608404 AGATGACAGGAGCAAGGAGAAGG - Intergenic
1015041691 6:128728188-128728210 GGCTGCCTGAGGCCAGGAGAAGG - Intergenic
1015454074 6:133405234-133405256 CACTTCCATGTGCCAGGAGATGG - Intronic
1015800789 6:137060516-137060538 AGCTGGGATGAGCCAGGAGAAGG + Intergenic
1015889794 6:137958935-137958957 GGTTGCCAGGAGCTAGGAGGAGG - Intergenic
1016853786 6:148645848-148645870 GGTTGCCAAGAGCCAGGTGATGG - Intergenic
1016936527 6:149452288-149452310 AGCTGCCAGGGGCCAGGTGAAGG + Intronic
1018248474 6:161844518-161844540 TGCAGCCAGTAGCCAGGATATGG - Intronic
1018628242 6:165800951-165800973 CCAGGCCAGGAGCCAGGTGATGG - Intronic
1018652174 6:166001826-166001848 CGCAGCCAGGAGAGAGGTGAGGG + Intergenic
1018652498 6:166003747-166003769 TGCAGGCAGGGGCCAGGAGAGGG + Intergenic
1019129399 6:169862654-169862676 TGCAGCCAGGAGCCAGGACCTGG - Intergenic
1019256520 7:55963-55985 AGCTGCCAGGCACCAGGAGCGGG - Intergenic
1019278349 7:187740-187762 CCCTGCCAGGAGGAGGGAGACGG - Intergenic
1019303344 7:320582-320604 CGTTGCCAGGAGCTGGGGGAGGG + Intergenic
1019504921 7:1385968-1385990 TGCCGCAGGGAGCCAGGAGAGGG + Intergenic
1019510971 7:1417136-1417158 CAGAGCCAGGGGCCAGGAGAAGG - Intergenic
1019549964 7:1597235-1597257 CGCTGCCAGGACCCTCAAGAAGG - Intergenic
1019653390 7:2172865-2172887 CGCTCCCAGGAGCCATCTGATGG - Intronic
1019762929 7:2827213-2827235 GGTTGCCAGGGGCCGGGAGAAGG + Intronic
1019884112 7:3889313-3889335 GGATGCCAGGGGCCAGGACAGGG - Intronic
1020021940 7:4874387-4874409 CTCTGCCTGGAGCCGGGGGAAGG - Intronic
1020230453 7:6314414-6314436 GGCTGCCAGGGGCTAGGAGAAGG - Intergenic
1021772246 7:24016646-24016668 GGTTGCCAGGAGCTAGGAGAAGG + Intergenic
1021810008 7:24394024-24394046 GGCTGCCAGGGATCAGGAGACGG + Intergenic
1022162257 7:27723211-27723233 TCCTGCCAGCAGCCAGCAGATGG - Intergenic
1022687237 7:32608560-32608582 AGCAGCCTGGGGCCAGGAGAAGG - Intergenic
1024073776 7:45808255-45808277 CGCTGACAGGAGGCAGGAGCTGG - Intergenic
1024751709 7:52473934-52473956 AGCTGCCAGCAGCTGGGAGAGGG - Intergenic
1025053639 7:55747275-55747297 TGCTGACAGGAGGCAGGAGCTGG + Intergenic
1025131742 7:56377749-56377771 TGCTGACAGGAGGCAGGAGCTGG + Intergenic
1025182101 7:56828470-56828492 GGCTGCCAGGAGGCAGGAATTGG + Intergenic
1025182892 7:56832622-56832644 GGCTGCCAGGAGTCAGAAGATGG + Intergenic
1025689034 7:63744352-63744374 GGCTGCCAGGAGTCAGAAGATGG - Intergenic
1025689392 7:63746166-63746188 CACTGACAGGAGGCAGGAGCTGG - Intergenic
1025689828 7:63748525-63748547 GGCTGCCAGGAGGCAGGAATTGG - Intergenic
1025934428 7:66023429-66023451 CGTTGCCAGGGGCTAGGAGGAGG + Intergenic
1026045673 7:66904076-66904098 CGCAGCCACGAGCAAGGAGCTGG - Intergenic
1026046105 7:66906159-66906181 GGCTGCCAGGAAGCAGGAGCTGG - Intergenic
1026453722 7:70553008-70553030 TGCTGTCACGAGCCAGCAGAAGG + Intronic
1026606239 7:71818410-71818432 GGCTTCGAGTAGCCAGGAGAAGG + Intronic
1028022477 7:85793197-85793219 AGCTGCCTGGAGCTAAGAGAAGG - Intergenic
1028709803 7:93893977-93893999 AGCTGACAGGAGCAAGGACATGG - Intronic
1028999575 7:97139094-97139116 CGCTGCCCGGTGCCGGCAGAAGG + Intronic
1029247883 7:99215634-99215656 CGCTGCCAACAGCCATGTGAAGG - Intergenic
1029608894 7:101616113-101616135 CTCTCCCAGAAGCCAGGAGCTGG - Intronic
1029885376 7:103864454-103864476 GGTTGCCAGGTGCCAGGAGGAGG - Intronic
1029987052 7:104931759-104931781 CGCTGACAGGAGCTTTGAGATGG + Intergenic
1030344959 7:108422936-108422958 AGCCTCCAGGAGCCAAGAGAAGG + Intronic
1031546063 7:123052879-123052901 AGCTGCCTGGAGCTAGGGGAGGG + Intergenic
1032051172 7:128651939-128651961 CGCTGACAGGAGGCAGGAGCTGG - Intergenic
1032438198 7:131919818-131919840 ATCTGCCAGAAGCTAGGAGAGGG + Intergenic
1032511630 7:132477266-132477288 CCCTGCCTGGAGCCTGGGGAGGG - Intronic
1034410258 7:150937441-150937463 GGCTGCCAGGAGCCAGGTCCTGG + Intergenic
1034435932 7:151062767-151062789 CGCTTAGGGGAGCCAGGAGATGG + Intronic
1034435976 7:151062933-151062955 CGGTGCCAGCAGCCAGAACAAGG - Intronic
1034481082 7:151320859-151320881 AGCTGGCAGGAGCCAGGAGCAGG + Intergenic
1034843066 7:154417567-154417589 CGCTCCCAGAAGCGAAGAGATGG + Intronic
1035408642 7:158619088-158619110 AGCTGCCAGGGGCTAGGGGACGG + Intergenic
1035521459 8:277782-277804 CCGGGCCAGGAGCCTGGAGAGGG - Intergenic
1035629868 8:1098807-1098829 CGCGGCCGGGAGCCTGGAGTGGG - Intergenic
1035822211 8:2605609-2605631 TGCTGGCAGGAGTTAGGAGAAGG - Intergenic
1036378495 8:8220651-8220673 GGTTGCCAGGAGCCAGGGGTGGG + Intergenic
1036793435 8:11738827-11738849 AGCTGGGAGGAGCCTGGAGAGGG + Intronic
1036851078 8:12201968-12201990 GGTTGCCAGGAGCCAGGGGTGGG - Intergenic
1036872442 8:12444248-12444270 GGTTGCCAGGAGCCAGGGGTGGG - Intergenic
1037366578 8:18128796-18128818 CTCTGCCTAGAGTCAGGAGAAGG - Intergenic
1037767028 8:21778362-21778384 GGCTCCCAAGACCCAGGAGAAGG + Intronic
1038436978 8:27543113-27543135 CACAACCAGGAGCCAGGAGAAGG - Intronic
1039917622 8:41871593-41871615 GACCACCAGGAGCCAGGAGAGGG + Intronic
1039946186 8:42130733-42130755 AGCTGCCAGGAGCTAGGAGGAGG - Intergenic
1042980361 8:74519442-74519464 AGCTGCCTGGAGCTGGGAGAGGG - Intergenic
1043101292 8:76050168-76050190 TGCTCTCAGGAGTCAGGAGAAGG + Intergenic
1044878072 8:96692456-96692478 AGCTGCCTGGAGCTGGGAGAGGG - Intronic
1045220849 8:100198794-100198816 GGTTGCCAGGGGCCAGGGGAAGG - Intronic
1045348515 8:101316646-101316668 AGCCACCAGCAGCCAGGAGAGGG + Intergenic
1046808200 8:118503657-118503679 CGCCACCTGGAGTCAGGAGAAGG + Intronic
1047909378 8:129510665-129510687 GGCTACCAGAAGCTAGGAGAAGG - Intergenic
1048236907 8:132699918-132699940 GGCTGCCAGGGGCCAGGGAAGGG + Intronic
1048331719 8:133475251-133475273 AGCTGGCAGGAGCCAGGAGCGGG + Intronic
1048333238 8:133485353-133485375 CGCTGCCTGGAGGTAGAAGAAGG - Intronic
1048603732 8:135946184-135946206 GGCAGCCAGGGGCCTGGAGATGG + Intergenic
1048869464 8:138785233-138785255 CTCTGCGTGGAGCCAGGAGACGG + Intronic
1048893366 8:138967136-138967158 CACTCACATGAGCCAGGAGAGGG + Intergenic
1049209273 8:141377912-141377934 CTCTGCCAGGGTCCTGGAGAAGG - Intergenic
1049427269 8:142543056-142543078 AGAGGCCAGGAGCCAGGATATGG - Intronic
1050226585 9:3464591-3464613 GGTTGCCAGGAGCAATGAGATGG + Intronic
1050751739 9:8946728-8946750 CTCTTTCAGGAGCCTGGAGAAGG + Intronic
1051464928 9:17367130-17367152 CACTGCCAGGAGATAGGGGAAGG - Intronic
1052332125 9:27280953-27280975 AGCTGCCAGAAACCAGAAGACGG + Intergenic
1055721021 9:79174986-79175008 AGCCACCAGGAGCAAGGAGATGG - Intergenic
1055983537 9:82031833-82031855 AGAGGCCATGAGCCAGGAGAAGG + Intergenic
1056854399 9:90113349-90113371 AGCTGACTGGAGCCAGAAGATGG - Intergenic
1057256695 9:93554920-93554942 CAGTGCAAGGGGCCAGGAGATGG + Intronic
1057266101 9:93619220-93619242 ACCTCCCAGGAGCCAGGAGATGG - Intronic
1057266887 9:93623061-93623083 AGCAGCCAGGGGCCAGGTGAGGG + Intronic
1057987731 9:99734233-99734255 GGTTGCCAGGGGCTAGGAGAGGG + Intergenic
1058100934 9:100916926-100916948 AGCTGCCAGCAGGCAGGAAAAGG + Intergenic
1058679780 9:107430812-107430834 GGCTGCCAGGTGCCAGATGATGG + Intergenic
1059041887 9:110823391-110823413 AGCTGCCTGGAGCTGGGAGAGGG - Intergenic
1059705650 9:116820843-116820865 CTCTTCCAGGAGGGAGGAGAGGG - Intronic
1059714986 9:116905254-116905276 TGCTGCCAGGAGCCACCAGCAGG + Intronic
1060621626 9:125072697-125072719 GGCTGCCAGGGGCTAGGAGGAGG - Intronic
1060812184 9:126615989-126616011 TGGAGCCAGGAGCCAGGAGGTGG + Intronic
1061100023 9:128485295-128485317 GGCTGCCAGGAGCTGGGAGCGGG - Intronic
1061238787 9:129357458-129357480 CTCAGCCAGGAGCCAGGACCAGG - Intergenic
1061412396 9:130428669-130428691 AGCTGCCAGGAGCCAGGGGAGGG - Intronic
1061503711 9:131018768-131018790 GGCTGGCAGGAGCATGGAGAGGG - Intronic
1061559459 9:131393764-131393786 AGGGGCCAGGAGCCAAGAGAAGG - Intergenic
1061783286 9:133008179-133008201 CACTGCCAGTGGCCAGGGGAGGG + Intergenic
1061945950 9:133908234-133908256 AGCTCCAAGGGGCCAGGAGATGG + Intronic
1061991852 9:134163564-134163586 GGGAGCCAGGGGCCAGGAGAGGG - Intergenic
1062020901 9:134319039-134319061 CCCTGCCAGCAGCCAAGGGAGGG - Intronic
1062162372 9:135087530-135087552 CGCTGCCAGCAGCCAGGGGGCGG + Intronic
1203577421 Un_KI270745v1:20087-20109 CGCTGACAGGAGGCAGGAGCTGG - Intergenic
1185822734 X:3220417-3220439 AGCTCCCAGGAGCTGGGAGAGGG - Intergenic
1186066615 X:5773030-5773052 CGTTGCCAGGGGCTGGGAGAGGG + Intergenic
1186525206 X:10241960-10241982 TGCTGCCAGGTGCCAGAGGAAGG + Intergenic
1187144658 X:16626411-16626433 GGTTGCCAGGGGCCAGGGGAAGG + Intronic
1187151700 X:16686994-16687016 AGCCACCAGAAGCCAGGAGAAGG + Intronic
1187473181 X:19587317-19587339 GGCTGCCAGGGGCTGGGAGAGGG + Intronic
1187928291 X:24270703-24270725 GGCTGACAGGGGCCAGGAAAGGG + Intergenic
1188434756 X:30148045-30148067 AGCTGGCAGGAGCCAGGAACAGG + Intergenic
1189100726 X:38186652-38186674 GGCTCCCAGCAGCTAGGAGATGG - Intronic
1192257538 X:69475667-69475689 GGCTACTAGGAGCCAGGGGAAGG + Intergenic
1192891034 X:75390475-75390497 AGCTGCCTGGAGCTAGGAGAGGG - Intronic
1195714218 X:107803061-107803083 AGCTTCCAGGAGCCAGGGGTGGG + Intergenic
1196285253 X:113871893-113871915 CTCTGACAGCAGCCAGGAGGGGG + Intergenic
1198111980 X:133509873-133509895 GGCAGGCAGGAGTCAGGAGAGGG + Intergenic
1198193789 X:134339063-134339085 GGTTACCAGGAGCCAGGGGAAGG + Intergenic
1199188451 X:144942352-144942374 AGCTGGCTGGAGCCAGGAGCAGG - Intergenic
1200141605 X:153905422-153905444 CTCTGCTAGGAGCCAGGAAGTGG + Intronic
1201365888 Y:13205633-13205655 AGCTGGGATGAGCCAGGAGAAGG + Intergenic