ID: 1151321477

View in Genome Browser
Species Human (GRCh38)
Location 17:73355074-73355096
Sequence CTGTCCTTGCAGAAGGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 242}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151321470_1151321477 18 Left 1151321470 17:73355033-73355055 CCAATTTGGGGAAGGCCATGGGG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1151321477 17:73355074-73355096 CTGTCCTTGCAGAAGGCTCCGGG 0: 1
1: 0
2: 2
3: 24
4: 242
1151321467_1151321477 22 Left 1151321467 17:73355029-73355051 CCTTCCAATTTGGGGAAGGCCAT 0: 1
1: 0
2: 1
3: 18
4: 147
Right 1151321477 17:73355074-73355096 CTGTCCTTGCAGAAGGCTCCGGG 0: 1
1: 0
2: 2
3: 24
4: 242
1151321473_1151321477 -6 Left 1151321473 17:73355057-73355079 CCCAGTCTACATCAGAGCTGTCC 0: 1
1: 0
2: 1
3: 5
4: 123
Right 1151321477 17:73355074-73355096 CTGTCCTTGCAGAAGGCTCCGGG 0: 1
1: 0
2: 2
3: 24
4: 242
1151321474_1151321477 -7 Left 1151321474 17:73355058-73355080 CCAGTCTACATCAGAGCTGTCCT 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1151321477 17:73355074-73355096 CTGTCCTTGCAGAAGGCTCCGGG 0: 1
1: 0
2: 2
3: 24
4: 242
1151321472_1151321477 3 Left 1151321472 17:73355048-73355070 CCATGGGGACCCAGTCTACATCA 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1151321477 17:73355074-73355096 CTGTCCTTGCAGAAGGCTCCGGG 0: 1
1: 0
2: 2
3: 24
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151321477 Original CRISPR CTGTCCTTGCAGAAGGCTCC GGG Intronic
900186654 1:1336176-1336198 CAGTCCTTCCAGAAGGCTATGGG - Exonic
901012410 1:6209251-6209273 CTCTCCCTGCAGAAGGCGGCGGG - Exonic
901248187 1:7750227-7750249 AGGTTCTTGCAGAAGGGTCCTGG + Intronic
901480023 1:9518729-9518751 CTGTCCTGGCAGGATGCTCGCGG - Intergenic
902835834 1:19046242-19046264 CTGTCCCTGCAGAAGTCCTCGGG + Intergenic
903667712 1:25018026-25018048 CTGGCCTTCCACAGGGCTCCTGG + Intergenic
904373473 1:30065575-30065597 CTGGCCTTGCCGGAGGCTCAGGG - Intergenic
905853362 1:41290650-41290672 CTGTCCTCTCAGATGGCTCTAGG + Intergenic
911615546 1:100006620-100006642 CTGTCCTTGCACAGGCCTCCAGG - Intronic
911846419 1:102757564-102757586 CTGTTCTTGTAAAAGGCTCACGG - Intergenic
912392413 1:109313195-109313217 CTGTCCTTGCGTAAGTCTACTGG + Exonic
915287056 1:154859741-154859763 CTGTCCTTGCAGATGTCGCGTGG + Intronic
915732005 1:158060481-158060503 ATGTCCTTCCAGAAGTCCCCTGG + Intronic
917452831 1:175161470-175161492 CTGCTGTTGCAGAAGGGTCCAGG - Intronic
918290840 1:183106538-183106560 CTATGTTTTCAGAAGGCTCCAGG - Intronic
921795330 1:219336970-219336992 CTGTTTTTTCTGAAGGCTCCAGG + Intergenic
922473210 1:225889102-225889124 CTGTCCCTTGAGAAGGCTGCAGG + Exonic
922888277 1:229037390-229037412 GTGTCCTTGCAGATGGTCCCAGG + Intergenic
922934006 1:229410134-229410156 CTCTCCTTTCTGGAGGCTCCTGG - Intergenic
1062988787 10:1795694-1795716 GTGGCCTTGCAGAGGGATCCTGG + Intergenic
1062990172 10:1807414-1807436 CTGTCCAGGCACAGGGCTCCCGG - Intergenic
1064254513 10:13732625-13732647 CTGTTACTGCAGAAGCCTCCAGG + Intronic
1065974208 10:30828427-30828449 CTGTCCTTGGACTAGGCTCACGG - Intronic
1067523961 10:47027338-47027360 CAGTCCTTGGAGAAGCCTGCTGG + Intergenic
1067751797 10:48976548-48976570 CTTTCCTGGCAGAAGGCACCTGG - Intronic
1070611078 10:77933041-77933063 CTGTGCTTGCAGAAAGCTTGAGG - Intergenic
1070794024 10:79206621-79206643 CTGCCTTTGCAGAAGGAGCCAGG + Intronic
1070808605 10:79285967-79285989 CTGACATTGCAGATGGCTTCTGG + Intronic
1071493036 10:86149295-86149317 CTGTCTGAGCAGAAGGCTCCTGG - Intronic
1075402446 10:122170963-122170985 CAGTGCTTGCAGCAGACTCCTGG - Intronic
1075421118 10:122301430-122301452 CTGTCTGTGCAGACAGCTCCTGG - Intronic
1076109718 10:127851268-127851290 CTGCTCCTGCACAAGGCTCCAGG - Intergenic
1076148032 10:128140715-128140737 CTGTCCTTGCAAATCTCTCCTGG + Intergenic
1076747035 10:132519699-132519721 CTCTCTTTCCAGAAGGTTCCCGG - Intergenic
1077230279 11:1455551-1455573 GAGCCCCTGCAGAAGGCTCCAGG + Intronic
1077293849 11:1814946-1814968 CTCCCCTTGCAGAAGGCTCTGGG + Intergenic
1077677535 11:4209423-4209445 CTGCCCTTCCAGAAAGGTCCAGG + Intergenic
1077905823 11:6532696-6532718 CTATACTGGCTGAAGGCTCCAGG + Intronic
1082278828 11:50247750-50247772 CTGTTCCTGCAGAAGTCTACGGG - Intergenic
1084745265 11:71166078-71166100 CTTCCCTTGAAGGAGGCTCCTGG + Intronic
1085528816 11:77179723-77179745 CTGTCCTTGCAGATGCGTCTGGG + Exonic
1088971177 11:114775842-114775864 CTTTTCTTCCAGAAGGCTGCTGG - Intergenic
1089162680 11:116451681-116451703 CTGTCCCTTCCGAAGGCTCCAGG + Intergenic
1091015579 11:132048292-132048314 CTCTCTTTGCAGGAGGCTCTTGG - Intronic
1091252601 11:134156173-134156195 CTGCCCTCCCAGAAGTCTCCGGG + Intronic
1091303064 11:134519976-134519998 CTTTCTTTACAGAAGCCTCCTGG + Intergenic
1091628125 12:2138347-2138369 CTGTGCTTGCAGATGGATCCTGG + Intronic
1091651468 12:2313424-2313446 GTGTCCTACCAGAGGGCTCCAGG - Intronic
1092265106 12:6974864-6974886 CTGTTCTTGCAGTAGCTTCCTGG + Intronic
1095965035 12:47861413-47861435 GTTGCCTTGCAGAAGGCTCATGG - Intronic
1096185566 12:49578302-49578324 CTGTGTTTGCAGTAGGCTCCTGG + Intronic
1096817744 12:54212314-54212336 CTGCCTTTGCAAAAGGATCCAGG + Intergenic
1100444533 12:94649468-94649490 CTGTTCTGGCAGGAGGCACCTGG - Intronic
1100744283 12:97628486-97628508 CTGTCATTTCAGAAGGATTCGGG + Intergenic
1100958297 12:99934276-99934298 CTGACCTTGCAGAATGAACCTGG + Intronic
1101773691 12:107775085-107775107 CTGTCTTTGCAGAAGTTTCTGGG - Exonic
1102562057 12:113769394-113769416 CTGTCCTTGCAGCTGGCCCTGGG - Intergenic
1102859876 12:116326520-116326542 TTGTCCTTGCAGAAGAAGCCTGG - Intergenic
1104332019 12:127855809-127855831 CTGACATAGCAGAAGGGTCCTGG + Intergenic
1106659784 13:31786832-31786854 CTGTACTTGAAGAAGGTTTCAGG + Intronic
1111824877 13:93255106-93255128 CTGTCCTTTCAGAAGGCAAGAGG + Intronic
1112109815 13:96283848-96283870 CTGTATTTCCAGCAGGCTCCAGG + Intronic
1113404366 13:110024241-110024263 CTGCCCCTGCAGAAGGCCCTGGG + Intergenic
1113900638 13:113794917-113794939 CCTTCCGTGCAGAAGGCGCCTGG + Intronic
1113950014 13:114066542-114066564 CTGTGCCTGCAGGAGCCTCCTGG - Intronic
1117248054 14:53906186-53906208 CTGTCCTTGCAGGGTGTTCCTGG - Intergenic
1117806940 14:59503402-59503424 CTATTCATGCAGCAGGCTCCAGG + Intronic
1119452406 14:74723162-74723184 CTGTCATTGCAAAAGTGTCCTGG + Intronic
1119559261 14:75577776-75577798 CTGTCCTTGGCGAGGGATCCTGG - Intergenic
1119640363 14:76310191-76310213 GGGGCCATGCAGAAGGCTCCTGG - Intergenic
1124353798 15:28979635-28979657 CTGGCCTTGCAGAGTGCCCCCGG + Intronic
1124374157 15:29120100-29120122 CTGTGCTTCCAGAAGCCTTCCGG - Intergenic
1125509680 15:40286272-40286294 CTGTCCTCCCAGCAGGCCCCAGG + Intronic
1128386669 15:67154047-67154069 CAGAGGTTGCAGAAGGCTCCTGG - Intronic
1128711024 15:69872105-69872127 CTGTTCCTGCAGAGGGCTTCAGG - Intergenic
1130882394 15:88066566-88066588 CTGTCCATCCAGGAGGCTGCTGG - Intronic
1131544588 15:93305419-93305441 CTGTCTTTTCAGCAGGCTCATGG - Intergenic
1132782696 16:1636827-1636849 CTGTCCTTGGTGACAGCTCCAGG + Intronic
1134022971 16:10934153-10934175 CTGCCCTTCCAGAGGGCTCAGGG - Intronic
1134348006 16:13409369-13409391 CTGTCCTTGCAGAAAGGTGGAGG + Intergenic
1137899107 16:52245947-52245969 AGGTCCTAGCAAAAGGCTCCTGG + Intergenic
1139199088 16:64954512-64954534 CTGTGCTTCCAGAAGGCTCAGGG + Intronic
1139709349 16:68763915-68763937 TTGTCCTTGCAGTGGGATCCAGG - Intronic
1140094048 16:71860131-71860153 CTGCCATGGCAGAAGGGTCCTGG + Exonic
1140108890 16:71986225-71986247 GTGTCATTGCAGAAGGCATCTGG - Exonic
1141694007 16:85611595-85611617 CCCGCCTTGCACAAGGCTCCGGG - Intronic
1142034780 16:87856201-87856223 CTGTCATTACAGATGACTCCTGG - Intronic
1144363592 17:14520476-14520498 GAGTCCTTGCAGAAGACTCTGGG - Intergenic
1144667738 17:17113107-17113129 CTGCCCTTGCAGACGGCTCCTGG + Intronic
1144791409 17:17861428-17861450 CTTTCCCTCCAGAAGACTCCAGG + Intronic
1145963371 17:28900700-28900722 CAGTCAGTGCAGATGGCTCCTGG + Intronic
1145964494 17:28907127-28907149 CTGTCCTTTCAGAAGGGGGCTGG + Intronic
1146832848 17:36084773-36084795 CTGTGTTTTCACAAGGCTCCAGG - Intergenic
1146847321 17:36191074-36191096 CTGTGTTTTCACAAGGCTCCAGG - Intronic
1148327211 17:46790202-46790224 CTCTCCTTGCAACAGGCGCCTGG + Intronic
1148633808 17:49132351-49132373 CTGTCCTGGCAAAAGACCCCAGG - Intergenic
1151321477 17:73355074-73355096 CTGTCCTTGCAGAAGGCTCCGGG + Intronic
1151333032 17:73422424-73422446 CTGTCCCTGCAGATGCCCCCTGG - Exonic
1152328384 17:79655989-79656011 GGGTCCCTGCAGAAGGCTCTGGG - Intergenic
1154165525 18:12011683-12011705 CTGTCCCTGCAGCTGGCTACTGG + Intronic
1154188615 18:12208807-12208829 CTGTCCTTGCTGTTGACTCCTGG + Intergenic
1157410796 18:47461433-47461455 GTGCTCTTGCTGAAGGCTCCAGG + Intergenic
1158253788 18:55521614-55521636 ATGGCCTTGCAGAAGGCACATGG - Intronic
1158390104 18:57038043-57038065 TTGGCCCTGCAGCAGGCTCCAGG + Intergenic
1158723005 18:59942570-59942592 ATGTCCTTGCTGAAGGCGCTTGG - Intergenic
1159573555 18:70147738-70147760 CTTTCCTTGCACTATGCTCCTGG + Intronic
1160742738 19:694960-694982 CCGTCCCTCCAGCAGGCTCCTGG - Exonic
1161596051 19:5151494-5151516 CTGTCCTAGAAGGGGGCTCCGGG - Exonic
1162721396 19:12664977-12664999 CTGTCCTGGCACAGGGCGCCTGG - Exonic
1163117715 19:15198245-15198267 CTGTCCTGCCAGAAGGGTCCAGG + Intronic
1163610877 19:18300984-18301006 CTGACCTTTGAGAAGGCTCTGGG + Intergenic
1165457220 19:35919793-35919815 CTATCCTTACACAAGGCTCCTGG - Intergenic
1165895164 19:39136918-39136940 CTGCCATTGCAGAGGTCTCCCGG + Intronic
1166251613 19:41575568-41575590 CTGTCCTTGGTGAAGGTTTCAGG - Intronic
1166270018 19:41708023-41708045 CTGTCCTTGGGGAAGGCTCCAGG - Intronic
1166407110 19:42529084-42529106 CTGTCCTTGGGGAAGACTTCAGG + Intronic
1166831679 19:45643255-45643277 CTGTCCTTGCAGCTGGCTCTAGG - Intronic
1167307298 19:48716545-48716567 CTGTCCTTTCCCAAGGATCCAGG - Intronic
1167720149 19:51173866-51173888 CTGCCCTTCCCAAAGGCTCCAGG - Intergenic
1168260592 19:55191827-55191849 CTGTCTTTGGACCAGGCTCCTGG - Intronic
1168555709 19:57338207-57338229 CTGTCTTTGGAGAGGGCTGCAGG + Intergenic
925159363 2:1673311-1673333 CTGTCCCTTCAGATGGCGCCTGG + Intronic
925671260 2:6311972-6311994 ATGTCCTTGCAGAAAGCCCCTGG + Intergenic
926235899 2:11043528-11043550 CCTTCCTTGCAGAAGGCCCCGGG + Intergenic
926476513 2:13329228-13329250 CTGTGCTCTCAGAAGGGTCCAGG + Intergenic
926686840 2:15704574-15704596 CTATCCTTGAAACAGGCTCCAGG - Intronic
927003088 2:18819558-18819580 CTGTTATTGCGGAAAGCTCCTGG - Intergenic
927518975 2:23687988-23688010 ATGGCCATGCAGAAGGGTCCCGG + Intronic
929780740 2:44955438-44955460 CTGTCCCCGCAGAAGAGTCCAGG + Intergenic
929784687 2:44980783-44980805 CTGTGCTTGAATAAGCCTCCAGG + Intergenic
929784877 2:44982235-44982257 CTGTGCTTGAATAAGCCTCCAGG - Intergenic
930747646 2:54901301-54901323 CTGTCTTTACACTAGGCTCCTGG + Intronic
931968609 2:67561285-67561307 CTGACCTTGCAGAAGGAGGCAGG + Intergenic
932159266 2:69446010-69446032 CTGTACTGCCACAAGGCTCCAGG - Intergenic
932357729 2:71080139-71080161 CTGTTCTTTCAGAAGGGACCTGG - Intergenic
932467680 2:71934050-71934072 CAGGGCTTGCAGAAGGCACCAGG + Intergenic
933715323 2:85355562-85355584 CTGTCCCTACTGAAGGCCCCAGG + Intronic
933836793 2:86252321-86252343 CTGACCTTCCAGGAGGCTCCAGG + Intronic
936227921 2:110674751-110674773 CTGCCCTTCCAGCAGGATCCAGG + Intronic
937049753 2:118878843-118878865 CTGACATTTCAGAAAGCTCCAGG - Intergenic
938056587 2:128220146-128220168 CTTTTCTGGCAGACGGCTCCTGG - Intergenic
939375321 2:141357983-141358005 GTGTCTTTGAAGAAGGTTCCTGG - Intronic
940550875 2:155154728-155154750 CTGTCCTTGAAGAAAGGGCCAGG - Intergenic
941592090 2:167432419-167432441 CTGTCTTTGCAGAAACCTCTGGG - Intergenic
942419561 2:175794213-175794235 CTGTCCTTCCTGGAGGCTCTAGG - Intergenic
945053267 2:205846107-205846129 CTTTTCTTGTAGATGGCTCCAGG - Intergenic
946994402 2:225374806-225374828 GTGTCATTTCAGAAGGCTGCAGG + Intergenic
947538810 2:230960159-230960181 CTGGCTTTGCACAAGACTCCAGG + Intronic
947660409 2:231862257-231862279 CTGTGGTTGAAGAAGCCTCCTGG + Intergenic
948290082 2:236818170-236818192 CTGTCCTGGCAGATGGGACCGGG + Intergenic
948542201 2:238699034-238699056 CTGTGCTTCCAGAAGGGCCCTGG - Intergenic
948760811 2:240189953-240189975 CTGTCCCTGCAGAGGCCACCAGG + Intergenic
948784289 2:240343393-240343415 CTGGGCTTTCAGATGGCTCCTGG + Intergenic
1170391075 20:15875099-15875121 CTTTCCTTTCTGGAGGCTCCAGG - Intronic
1171724353 20:28602683-28602705 CTCTCCGCGCAGAAGTCTCCCGG - Intergenic
1171859006 20:30377345-30377367 CTGTCCGCGCAGAAGTCTCCCGG + Exonic
1172329872 20:34068074-34068096 CTGACATTGCAGAAGTCTCTAGG + Intronic
1175551476 20:59820669-59820691 CTGTCCCTGCTGAGGGCTCCAGG + Intronic
1175728166 20:61333604-61333626 CTGTCCTTGCAGGTGGCTCTGGG - Intronic
1175878606 20:62243502-62243524 CTGTCAGGGTAGAAGGCTCCTGG + Intronic
1176085999 20:63295824-63295846 GTGTCTATGGAGAAGGCTCCGGG + Intronic
1178915840 21:36705205-36705227 CTGCCCGCGCAGAAAGCTCCAGG + Intronic
1180039284 21:45267743-45267765 CTGTCCTTACTGGAGGATCCCGG - Intronic
1180297904 22:10961357-10961379 CTCTCCGCGCAGAAGTCTCCCGG - Intergenic
1182576302 22:31275375-31275397 CTGTGCTTGCAGAGGGCTCAGGG - Intronic
1182904639 22:33924637-33924659 CTGGCCTAGCAGAAGCCTTCAGG - Intergenic
1183551558 22:38489970-38489992 CTTTCCTAGCAGAAAGCACCAGG + Intronic
1184610377 22:45599448-45599470 CTCTGCTTGCAGGAGGATCCAGG + Intronic
1184655141 22:45937282-45937304 CCTTGCTTCCAGAAGGCTCCAGG - Intronic
1185065577 22:48630213-48630235 CTCTGCTTGCAGAACGCTGCTGG + Intronic
1185294194 22:50045379-50045401 CTGTCCTTTCAGAAGACTTCCGG - Exonic
949517590 3:4821328-4821350 CTGTCATTCCACAAGTCTCCAGG - Intronic
950098120 3:10341973-10341995 CTCTCCTTACAGGAGCCTCCCGG - Intronic
950717222 3:14857582-14857604 GTTTCCTTGCTGAAGTCTCCCGG - Intronic
953766296 3:45746441-45746463 GTATCCCTGCAGCAGGCTCCAGG - Intergenic
953798451 3:46003073-46003095 CTATCCTTGTAGAAGGCAGCTGG + Intergenic
954136527 3:48584546-48584568 CTGTCCTTACAGGGGGCTCCCGG - Exonic
956910738 3:73814028-73814050 CTTTCATGGCAGAAGGCTCCAGG + Intergenic
959649247 3:108735844-108735866 CTGTCCCTGCAGAGGTGTCCAGG + Intergenic
961939711 3:130624555-130624577 TTGTCCCTGAAGAAGGCTCTAGG + Intronic
962240044 3:133744530-133744552 CTGCCCCTGCAGCAGGCTCTAGG - Intergenic
962747585 3:138408767-138408789 CTGCCTTTCCAGAAAGCTCCTGG - Intergenic
963062370 3:141235081-141235103 CTGTCCCTGGACAAGGTTCCTGG + Intronic
963913198 3:150832621-150832643 CTGTCGTAGCAGAGGGATCCGGG + Intergenic
965019393 3:163208244-163208266 CAGTCATTGCAGAAGGCTAAGGG - Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967723725 3:192842142-192842164 GGGTCGTTACAGAAGGCTCCTGG - Intronic
968982253 4:3856652-3856674 CTGTCCATGCACATGGCTCTAGG + Intergenic
969348943 4:6586984-6587006 CTGTCTTTGCAGAAGGACACGGG + Exonic
971239615 4:24876221-24876243 GTGTGTTTGCAGTAGGCTCCTGG - Intronic
971354011 4:25878169-25878191 CTGTCCGAGCAGAAGACACCGGG + Intronic
978761497 4:112359066-112359088 CTGTCCTTCCAGTGGGGTCCAGG - Intronic
981089818 4:140721017-140721039 CAGTCTTTGAAGAAGGTTCCCGG + Intronic
983279534 4:165662682-165662704 AAGTACTTGCAGAAGGCTCAGGG + Intergenic
983523568 4:168736636-168736658 CTGGACTTGCAGAAGGCCCTAGG + Intronic
985107189 4:186510778-186510800 CTGTCTTGGCAGCAGGGTCCGGG + Intronic
985337376 4:188911338-188911360 CTGACGTTGCAGAACTCTCCTGG - Intergenic
985516563 5:348263-348285 CTGTCCCTGCTGAGGACTCCGGG - Intronic
986053051 5:4108263-4108285 CAGTCCTAGGAGGAGGCTCCCGG + Intergenic
990997143 5:61744281-61744303 GTGTTCTTTCAGAAGGCTGCCGG - Intronic
991604592 5:68388047-68388069 CTCTCCTTTCAGAAAGCTTCTGG + Intergenic
991913257 5:71582233-71582255 CTGTCATGGCTGAAGGCCCCAGG - Intergenic
992140724 5:73794290-73794312 ATCTCTGTGCAGAAGGCTCCTGG + Intronic
992511841 5:77444430-77444452 CTCTCCAGGCAGAAGGCTCTGGG - Intronic
994842179 5:104939129-104939151 CTGTCCTAGCATAAGAATCCTGG - Intergenic
996332200 5:122342387-122342409 CTCTGCTTGCAGGAGGCCCCAGG - Intronic
996407010 5:123115330-123115352 CTTTCCTTGGAGAAGGATTCTGG - Intronic
997381738 5:133443436-133443458 ATGTCCTAGCAGAAGGGTCTGGG - Intronic
998527669 5:142857420-142857442 CTGTCTCTGCTGAGGGCTCCTGG + Intronic
999133855 5:149304593-149304615 CTCTCCCTGCACAAGGTTCCTGG - Intronic
999753413 5:154647091-154647113 CTCTTCCAGCAGAAGGCTCCCGG + Intergenic
1002427002 5:179182372-179182394 CTGACGTGGCAGCAGGCTCCGGG - Intronic
1003162387 6:3647124-3647146 CTGTCCTTACAGAGGAGTCCAGG + Intergenic
1004074903 6:12336215-12336237 CTTTCCTTGCAGAGCCCTCCAGG + Intergenic
1004775074 6:18834963-18834985 CTGGCCTTTCAGAAGAGTCCTGG + Intergenic
1007712600 6:43834100-43834122 CTGACAATGGAGAAGGCTCCAGG - Intergenic
1007712682 6:43834761-43834783 TTTTCCTTGGAGATGGCTCCTGG + Intergenic
1008603221 6:53116074-53116096 CTGTAGTAGCAGAAGGCGCCAGG - Intergenic
1011020875 6:82810487-82810509 CTGTCCTAGAAGAAACCTCCTGG - Intergenic
1013292922 6:108734069-108734091 CTGTGATTGCACAAGTCTCCAGG - Intergenic
1015254801 6:131166190-131166212 CTGTCCTTGCAGGATGCTCAAGG - Intronic
1016706153 6:147110601-147110623 TTGTCCTTTCTGAAGGCTCTAGG - Intergenic
1016996332 6:149964463-149964485 CGGTCCTTCCAGAAACCTCCTGG - Intronic
1017818554 6:158032319-158032341 CTGTCTTTGAGGAAGGCTCAAGG + Intronic
1019335362 7:480215-480237 GGGTCCATCCAGAAGGCTCCCGG + Intergenic
1019345908 7:530870-530892 CTGTCCGTTCAGAGGGCACCTGG - Intergenic
1020232860 7:6333311-6333333 CTGTCCTTGCTGAAGCTTCTCGG - Intronic
1021012566 7:15489508-15489530 CTTTCCTGGCTGAAGGTTCCTGG - Intronic
1023805787 7:43872056-43872078 CTGTCTCTGCATTAGGCTCCAGG - Intronic
1024360225 7:48460344-48460366 ATGTCCTCTCTGAAGGCTCCAGG + Intronic
1025965337 7:66264482-66264504 CTGTCTTTGCAGAAGGGCTCTGG - Intronic
1029424597 7:100488054-100488076 ATGTCCTTGCAGAAGGGTCAAGG + Intronic
1029601114 7:101563941-101563963 CAGTCCTGGCAGGAGCCTCCAGG + Intergenic
1032461429 7:132114292-132114314 CTGACCTGGCAGAGGCCTCCGGG + Intergenic
1034380581 7:150688741-150688763 TTGTCCTTGCAGTTGTCTCCTGG + Intronic
1036522109 8:9501344-9501366 CTCTCCATGCACCAGGCTCCCGG - Intergenic
1037740802 8:21607833-21607855 CTACCCTTGCAGCAGGCTACTGG - Intergenic
1038445160 8:27598525-27598547 CGGTCCCTGTAGAAGTCTCCAGG - Exonic
1040300567 8:46185867-46185889 CTCTCCTCCCAGAAGGCCCCAGG - Intergenic
1041676266 8:60543265-60543287 GTGTTCTCTCAGAAGGCTCCAGG + Intronic
1043115532 8:76249075-76249097 ATGTACTTGCAGATGGCTACAGG + Intergenic
1045320591 8:101079307-101079329 CAGTCCTTGCAAGGGGCTCCAGG - Intergenic
1048269519 8:133017465-133017487 CTGTTCTTTCAAAAGGCCCCAGG + Intronic
1048623607 8:136160948-136160970 CTTTCTTTGCAGAAAACTCCTGG - Intergenic
1049311452 8:141935935-141935957 CTGTCCTTCCGGAGGGCACCTGG - Intergenic
1049657092 8:143803738-143803760 CTGTGCATCCAGAAGGCACCTGG - Exonic
1050033666 9:1412835-1412857 CTGTCCTTGAAAATGGCTTCTGG + Intergenic
1050069105 9:1791826-1791848 CTGTCCCTGCAGACATCTCCAGG + Intergenic
1051564736 9:18484727-18484749 CTGTCTTGGCTGCAGGCTCCAGG + Intronic
1052592258 9:30513688-30513710 CTGTCCTTGCCGCAATCTCCTGG + Intergenic
1053725243 9:40992399-40992421 CTCTCCGCGCAGAAGTCTCCCGG + Intergenic
1054805952 9:69395931-69395953 CTTTCCTTGCAGAGGCCTCAGGG - Intergenic
1055418843 9:76114322-76114344 CAGTCCTGGCAGAAGGCCCGTGG - Intronic
1055674099 9:78637695-78637717 CTTTCCTTTCTGAAAGCTCCAGG + Intergenic
1056774787 9:89503335-89503357 CTCTCCTGTCACAAGGCTCCTGG + Intergenic
1058426217 9:104877110-104877132 CTGCCCTTCCAGAAAGCTCTGGG + Intronic
1058606508 9:106729180-106729202 CTTTCCCTGCTGAAGGTTCCAGG + Intergenic
1061140440 9:128763032-128763054 CTGTCCTGGCAAAAGGCCCTCGG + Intronic
1061667349 9:132168342-132168364 GTGTCCTTGGAGGAGCCTCCAGG + Intronic
1061685050 9:132269144-132269166 CTGTCCTGGCAGAAGAATGCCGG + Intronic
1061810768 9:133161826-133161848 CTGTCCTTCCATGAAGCTCCTGG - Intronic
1061855151 9:133437938-133437960 CTGTCCTATCGGAAGGCTCCTGG + Intronic
1062355076 9:136158089-136158111 TTGTACCTGCAGAAAGCTCCAGG - Intergenic
1186056301 X:5653302-5653324 CTTGCTTTGCAGGAGGCTCCAGG + Intergenic
1187532739 X:20111543-20111565 CTGTCCCGGCAGAAGTCTCGTGG + Intronic
1187943218 X:24401736-24401758 CTTTCCTTCCAGAAGGCCCTTGG - Intergenic
1188211997 X:27438107-27438129 CTGTCATTTCAAAAGCCTCCTGG + Intergenic
1188218994 X:27516829-27516851 CTGCCCTTCCAGAAAGGTCCAGG + Intergenic
1196774675 X:119327450-119327472 CTGCCCTTGCAGGAGGCTTAAGG + Intergenic