ID: 1151322529

View in Genome Browser
Species Human (GRCh38)
Location 17:73360416-73360438
Sequence CATTCTTGGCTGAAGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151322513_1151322529 22 Left 1151322513 17:73360371-73360393 CCTGAGTCAGGCTAATTGGGACT 0: 1
1: 0
2: 0
3: 9
4: 57
Right 1151322529 17:73360416-73360438 CATTCTTGGCTGAAGGGGGTGGG 0: 1
1: 1
2: 1
3: 19
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151322529 Original CRISPR CATTCTTGGCTGAAGGGGGT GGG Intronic
901549986 1:9989007-9989029 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
904487296 1:30835221-30835243 CATCCTTTGTTGAAGGGGCTAGG - Intergenic
904553994 1:31345707-31345729 CAGTCATGGCTGAAGGGTGAAGG + Intronic
906863482 1:49389162-49389184 CATTCTTAGCTGAAGGAAGGAGG - Intronic
907984796 1:59520054-59520076 AATTCTTTGTTGCAGGGGGTTGG - Intronic
908250301 1:62260539-62260561 GTGTCTTGGCTGAAGGAGGTGGG - Intronic
908318252 1:62955586-62955608 CATTTGGGGATGAAGGGGGTGGG + Intergenic
909002163 1:70231452-70231474 CATTTTTGGCTTAAGGAGTTTGG + Intronic
909185667 1:72482218-72482240 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
909747202 1:79112621-79112643 CATTTTTGGTGGAATGGGGTTGG + Intergenic
910700083 1:90063940-90063962 CATTTTTGGGAGATGGGGGTTGG - Intergenic
911235275 1:95405183-95405205 CATTCATGGCAGAAGGGGAAGGG - Intergenic
911286807 1:96004701-96004723 CATTCTTGGAAGAAGGGGTAGGG + Intergenic
911509192 1:98790975-98790997 AATTCTTGGCAGAAGAGAGTGGG + Intergenic
912776803 1:112510559-112510581 GAATCTTGGCTGAAGGGTGAGGG + Intronic
916368416 1:164061081-164061103 GACACTGGGCTGAAGGGGGTGGG + Intergenic
916577207 1:166078722-166078744 CATTCTTGGAGGCAGGGAGTGGG + Intronic
917539258 1:175897660-175897682 AATTTTTGGCTGGTGGGGGTAGG - Intergenic
919403118 1:197145271-197145293 CAGTCTTTGGTGAAGGGGATTGG + Intronic
920285966 1:204879974-204879996 CATTCTGGGGTGAAGTGGCTTGG + Intronic
922072828 1:222213200-222213222 CAATATTGGCAGAAGGGGGAGGG + Intergenic
922943227 1:229487039-229487061 GATACTTAGCTGAAGGGGTTGGG - Intronic
923070547 1:230560601-230560623 CATGCTCTGCAGAAGGGGGTAGG - Intergenic
923941404 1:238831518-238831540 CAGTCATGGCTGAAGGTGGAGGG - Intergenic
924902640 1:248418072-248418094 AATTCTGGGCCGAAGAGGGTGGG + Intergenic
1063617713 10:7616035-7616057 CATTCTTGGGTAAAGGAGGAAGG + Exonic
1065624842 10:27619784-27619806 CAATCATGGCTGAAGGGGAAGGG + Intergenic
1065645702 10:27831698-27831720 CATTCTTGGATGCCTGGGGTTGG + Intronic
1067823198 10:49549159-49549181 CATTCTTTGCTGATGGCTGTGGG - Intergenic
1067928489 10:50535845-50535867 CATTCATGTCTGAGTGGGGTTGG - Intronic
1068343257 10:55736942-55736964 CACTCATGGCAGAAGGGGATGGG + Intergenic
1068522216 10:58090026-58090048 CATTCATGGCTGTTGGGGATGGG - Intergenic
1069357066 10:67598435-67598457 GATCCTGGGCTGAAGGGGGGAGG - Intronic
1070073816 10:73115784-73115806 AGTTCTTGGGGGAAGGGGGTGGG - Intronic
1070756225 10:78995011-78995033 CATACTTGTCTGAAAGGGGAAGG - Intergenic
1070756373 10:78995942-78995964 CATACTTGTCTGAAAGGGGAAGG - Intergenic
1072695546 10:97600351-97600373 CCTTGTTGGCTGAAGGAGGATGG + Intronic
1075448390 10:122529820-122529842 CATACTGGGCTGCTGGGGGTGGG - Intergenic
1075904180 10:126066222-126066244 CATTCTTGGCTGGGCGGGGTTGG + Intronic
1076359019 10:129873743-129873765 CTTTTTTGGCTAATGGGGGTGGG + Intronic
1076423548 10:130351331-130351353 CAGTCATGGCTGCAGGGGGTGGG + Intergenic
1076528887 10:131131193-131131215 CATTCTTGGGAGAAGGCGGGAGG + Intronic
1078853051 11:15181413-15181435 AATACTGGGGTGAAGGGGGTGGG - Intronic
1079339135 11:19597756-19597778 CATTTTTAGCTGAAGGAGGTGGG + Intronic
1079396670 11:20069529-20069551 CAGACATGGCTGATGGGGGTGGG - Intronic
1080113970 11:28601218-28601240 CAATCATGGCTGAAGGTGGAGGG - Intergenic
1080504819 11:32902133-32902155 CATTCTTGGGTGAAGGAGTCGGG + Intronic
1080801312 11:35612878-35612900 CATTCTTGGCTGTCAAGGGTGGG - Intergenic
1081419190 11:42852765-42852787 CATTCTTGACTGAAGTTGATGGG + Intergenic
1083093088 11:60220773-60220795 CTTTCTTGGTTGTAGGGGGTGGG - Intronic
1083265544 11:61545208-61545230 CACTCTTGGCTGATGGACGTAGG - Intronic
1084870182 11:72093437-72093459 CTTTTTTGGCTTTAGGGGGTGGG - Intronic
1085861656 11:80243021-80243043 CAATGTTGGATGTAGGGGGTAGG - Intergenic
1086094216 11:83034358-83034380 GATTCTTAGCTGCAGGGGGAGGG - Intronic
1087854082 11:103069656-103069678 CTTTCTTGTCTGAAAGGGATAGG - Intronic
1088162699 11:106892616-106892638 CATTCTTTGTTGAAGGAGGAAGG - Intronic
1091992990 12:4971942-4971964 CATTCATGGCAGAAGGGGAAGGG + Intergenic
1092134450 12:6136822-6136844 CATTCTGGGGTGCAGGGTGTGGG - Intergenic
1094143779 12:27207736-27207758 CATTCCAGGCAGAAGGAGGTAGG - Intergenic
1096511719 12:52133678-52133700 CACTCTTGGCTGAGGGTGGTGGG - Intergenic
1096907795 12:54951299-54951321 CATTCATGGCAGAAGGGGAAGGG - Intronic
1097208207 12:57342310-57342332 CATTCAAGGGTGAAGGGGGCGGG - Intronic
1098003361 12:65969004-65969026 CATTCTGGCCAGAAGTGGGTGGG + Intergenic
1099852606 12:88121362-88121384 CCTTCTTAGCTGAAGGGGTATGG + Intronic
1099870793 12:88346831-88346853 CATTTTTGGCTGAGGGGTTTGGG + Intergenic
1100594629 12:96061248-96061270 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1101432771 12:104640818-104640840 AATTCTGGGCAGAAGAGGGTTGG + Intronic
1103054474 12:117807900-117807922 CACTCTTGACTGGAGGGGGCTGG - Intronic
1103983344 12:124750922-124750944 CTTTCTGGGGTGAAGGGGGCGGG + Intergenic
1105639683 13:22249648-22249670 AATTCTGGGCAGAAGAGGGTAGG + Intergenic
1106636812 13:31537695-31537717 CATTATTGGCTGGAGTGGGGTGG + Intergenic
1107950771 13:45459671-45459693 CATACTTGGATGATGAGGGTAGG - Intergenic
1111104718 13:83629934-83629956 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1111243300 13:85503585-85503607 CATTCCTGGTTGAGGGGGTTGGG + Intergenic
1112892782 13:104259419-104259441 CATTCTTGGCACTAGAGGGTTGG - Intergenic
1113432648 13:110264108-110264130 CATTCCTGGCTGGGAGGGGTTGG - Intronic
1113629584 13:111873071-111873093 CTTTCTTGTCTGAAGGGAATGGG + Intergenic
1117515001 14:56492081-56492103 CAATCATGGCAGAAGGGGGAGGG + Intronic
1121931420 14:97975936-97975958 CATTCTTGGAAGAAGGGTGATGG + Intronic
1122619809 14:103049286-103049308 CCTGCTTGGCTGAAGGAGGGTGG + Intronic
1122884611 14:104705477-104705499 CAGTGTGGGCTGAAGGGGGCCGG + Intronic
1123765206 15:23471165-23471187 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1125007398 15:34833195-34833217 CATTCTTGGCTGAAGGGGCTAGG + Intergenic
1125274901 15:37979403-37979425 CATTCTTGGCAGAATGTGGTAGG + Intergenic
1126086416 15:45014588-45014610 CATTCTTGCCTCAAGGGTTTAGG + Intergenic
1127134861 15:55909626-55909648 CTTTGTAGGCTGAAGGGGCTTGG - Intronic
1127328237 15:57916003-57916025 CTACCCTGGCTGAAGGGGGTTGG + Intergenic
1127491791 15:59472106-59472128 CCTTTTTAGCTAAAGGGGGTTGG + Intronic
1127979111 15:64021364-64021386 TTTTCTTGTCTGGAGGGGGTGGG - Intronic
1129019663 15:72504782-72504804 CATTCTAGGCAGACAGGGGTGGG - Intronic
1129384420 15:75188129-75188151 CACTCTATGCTGAAGGGGCTGGG - Intergenic
1130029017 15:80295259-80295281 AGTCTTTGGCTGAAGGGGGTGGG - Intergenic
1130466923 15:84197101-84197123 CATTCCTGGGTGCAGGGGGCTGG + Intergenic
1130497341 15:84476435-84476457 CATTCCTGGGTGCAGGGGGCTGG - Intergenic
1130573988 15:85074223-85074245 CATTCTTGCCTGTAGGGATTCGG - Intronic
1131052310 15:89357036-89357058 CGGGCTTGGCAGAAGGGGGTTGG + Intergenic
1133504040 16:6392915-6392937 CATTCATGGCAGAAGAGGGTGGG - Intronic
1133978902 16:10619293-10619315 CCTTCTGGGCTGGAGGAGGTGGG - Intergenic
1137265158 16:46862795-46862817 CACTCATGGCTGAAGGGGAAGGG + Intergenic
1138011679 16:53386587-53386609 CCTCCTTAGCTGAAGGTGGTGGG + Intergenic
1140756692 16:78074093-78074115 GATTCTTGGCTAGAGGTGGTAGG + Intergenic
1140917833 16:79509571-79509593 CATTCCTGGCTGGAGAGGGCCGG + Intergenic
1141008147 16:80372431-80372453 CACTCGGGGCTGAAGGGGCTGGG + Intergenic
1143184204 17:5000611-5000633 CTTTGGTGGCTGGAGGGGGTGGG + Intronic
1143503039 17:7350037-7350059 CATTCTTGGCCACACGGGGTAGG + Exonic
1143614575 17:8042248-8042270 CCCTCTTGGCTGAAGGGGTCTGG + Intronic
1146305955 17:31729951-31729973 TATTCCTGACTGATGGGGGTGGG - Intergenic
1148822391 17:50367131-50367153 CATTCCTGGCTGTTGGAGGTAGG - Intergenic
1149991836 17:61387759-61387781 CTTTCTTGGGGGATGGGGGTGGG + Intronic
1150007747 17:61480076-61480098 TATTCTTTGCTGAAGGGGTGGGG - Exonic
1150834648 17:68553245-68553267 CAATCATGGCAGAAGGGGGAGGG - Intronic
1151181657 17:72333495-72333517 CAATCATGGCTGAAGAGGGAGGG + Intergenic
1151322529 17:73360416-73360438 CATTCTTGGCTGAAGGGGGTGGG + Intronic
1151614016 17:75196278-75196300 CATTCTTGGGGGGAGGGGGGAGG + Intergenic
1159030584 18:63226395-63226417 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1159873460 18:73784938-73784960 CAATCATGGCTGAAGGGGAAGGG + Intergenic
1160553016 18:79707138-79707160 AATGCTTGGCTGGAGGGGTTTGG + Intronic
1160942530 19:1627118-1627140 CATGCTTAGCTGGAGGGGCTCGG - Intronic
1161270445 19:3386771-3386793 CATTATTGTCAGAAGGGGATGGG + Intronic
1166098560 19:40556943-40556965 CATTGTAGGCTGGAGGGGGCTGG + Intronic
1167135391 19:47612599-47612621 CATGCTTAGCTGTAGGGGCTGGG + Intronic
1168527957 19:57103735-57103757 GATTCTTTGCTGTTGGGGGTGGG + Intergenic
926737530 2:16084728-16084750 AATTCTTGGCTGAGGAGGATAGG - Intergenic
929620542 2:43349877-43349899 TATACTTGGCTGAAGGTGATAGG - Intronic
930062761 2:47304348-47304370 CATTGTTGGCTGAGGAGGGAAGG + Intergenic
930314432 2:49780419-49780441 CATACTTGCTTGAAAGGGGTGGG - Intergenic
931458611 2:62431861-62431883 AATTCTGGGCAGAAGTGGGTGGG + Intergenic
932912726 2:75821738-75821760 CATTCTTGCCAGATGGGGCTTGG + Intergenic
933053988 2:77638340-77638362 CACTCTTGGGAGAAGGGGGAGGG - Intergenic
933352708 2:81175675-81175697 CATCTTTGGCTGAAGGGCATGGG + Intergenic
933417214 2:82001966-82001988 CATTCCTGGCTGGATGGAGTAGG - Intergenic
935096633 2:99951120-99951142 CATTCTTTGCTTAAGGGTGAAGG - Intronic
935426980 2:102929892-102929914 CGTTCTAGGCAGAAGGGGGGAGG - Intergenic
936900860 2:117480763-117480785 CATCCTTGACAGAAGTGGGTGGG + Intergenic
938787830 2:134648506-134648528 AATTCTGGGCAGAAGAGGGTGGG - Intronic
940888866 2:159015313-159015335 CATTCATGGCTGGAGTGGCTTGG + Intronic
941303819 2:163835706-163835728 CCTTCTTCCCTGAAGGTGGTCGG - Intergenic
942437077 2:175990370-175990392 CATTCTTGGCAGAAGGTGACAGG - Intronic
943109966 2:183592587-183592609 AATTCTTGCCTCATGGGGGTGGG + Intergenic
944442641 2:199757980-199758002 TATCCTTGGCTAAAGGGGGCTGG + Intergenic
944454472 2:199878856-199878878 AATTCTTAGCAGAAGAGGGTGGG - Intergenic
944853613 2:203744848-203744870 CAGTCATGGCAGAAGGGGGAAGG - Intergenic
946216009 2:218184092-218184114 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
948532240 2:238616668-238616690 CATTCCAGGAAGAAGGGGGTGGG - Intergenic
948712972 2:239836663-239836685 GATCCTGGGCAGAAGGGGGTAGG + Intergenic
1168797751 20:622830-622852 CATTCTAGGGTGGACGGGGTGGG - Intergenic
1168828892 20:833685-833707 CATTCTGGTGTGAAGGGGGGCGG + Intergenic
1168953283 20:1817240-1817262 CAGCCTTGGCAGAAGGAGGTGGG + Intergenic
1169245266 20:4019890-4019912 AATTCTTGGATGAAGAGGCTCGG - Intergenic
1170299999 20:14872853-14872875 CAATCATGGCTGAAGGGGAAGGG + Intronic
1170734936 20:19006396-19006418 CTTTCTTGGCAGGAGGAGGTGGG + Intergenic
1172843390 20:37915373-37915395 AATTCATGGCTGAAGGGGTTGGG - Intronic
1173189242 20:40863529-40863551 CATTCATGGGTTCAGGGGGTGGG - Intergenic
1173639654 20:44591952-44591974 CCTTCTTGGCTGCAGGGAGAGGG - Intronic
1173834871 20:46118535-46118557 CGCTCCTGGCTGAATGGGGTGGG + Intronic
1175065932 20:56288702-56288724 CATTTTTGGCTGAAGGAGCTGGG - Intergenic
1175417896 20:58813610-58813632 CATTCTGGGATGAAGGGGTATGG - Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178447310 21:32658086-32658108 AATTCTGGGCAGAAGTGGGTGGG + Intronic
1179110253 21:38439957-38439979 TATTCTAGGCAGAAGGAGGTGGG + Intronic
1182412094 22:30195882-30195904 AACTCATGGCCGAAGGGGGTGGG + Intergenic
1183079493 22:35447401-35447423 CATTCCTGGGAGAAGGGTGTGGG + Intergenic
1184885394 22:47341949-47341971 CACCCTTGGCTGAAGGGGGAGGG + Intergenic
949788450 3:7767032-7767054 CATTTTTGGGTGACTGGGGTAGG + Intergenic
950374019 3:12555756-12555778 CAGTCGAGGCTGCAGGGGGTGGG - Intronic
950840039 3:15959261-15959283 CATTCTTGGGTCAAGGGGATTGG + Intergenic
950874680 3:16260781-16260803 CTTTGTTGGCTGAAGGGGCTGGG + Exonic
951453566 3:22866079-22866101 CCTTCTTAGCGCAAGGGGGTAGG - Intergenic
953038166 3:39231398-39231420 CCTCCTTGGCTGAAAGGGGTAGG + Intergenic
953382910 3:42487489-42487511 CATTCTTGGTTGAATGTGGGAGG - Intergenic
954033645 3:47838111-47838133 CATTCTTGTCAGAAGGGAGGCGG + Intronic
954214150 3:49115187-49115209 CACCCTTGGCTGGAGGGGGCGGG - Intronic
954822831 3:53346864-53346886 GATTCTTGGAAGGAGGGGGTGGG - Intronic
955030006 3:55206922-55206944 CATTTGTGGCTGGAAGGGGTGGG - Intergenic
955485453 3:59430284-59430306 CATTTTTGGCTGAAAGGGTGGGG + Intergenic
957243172 3:77685086-77685108 CAATCATGGCTGAAGGGGAAGGG - Intergenic
957764054 3:84598430-84598452 CACTCCTGGCTGAAGGGGAGGGG - Intergenic
958467387 3:94474022-94474044 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
958684698 3:97378166-97378188 CAGCCATGGCTGAAGGGGCTGGG - Intronic
959889505 3:111538834-111538856 AATTCTAGGCTAAAGGGTGTGGG - Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
963409669 3:144911514-144911536 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
963738794 3:149053445-149053467 CACTCTTGGCAGAAGGTGATGGG - Intronic
965431777 3:168597695-168597717 CATTCCAGGCTGAAGTAGGTGGG - Intergenic
966624816 3:182004650-182004672 GATTCATGGGGGAAGGGGGTAGG - Intergenic
966721177 3:183064151-183064173 CACTCTTTGCTGACGGCGGTCGG + Intronic
967691212 3:192475995-192476017 CATTCTTTGCTGAGTGGGCTAGG - Intronic
969632033 4:8344404-8344426 CATCCCTCGCTGAAGGGGGCCGG + Intergenic
973239189 4:47939181-47939203 CTTTCCTGGATGAAGGAGGTTGG - Intronic
974051956 4:56950000-56950022 CATTCTTTGCTGATGGCTGTGGG - Intergenic
974297358 4:60018874-60018896 CATTCATGGCAGGATGGGGTGGG + Intergenic
977809969 4:101347100-101347122 TATTCTTGGGGGAAGGGGGATGG + Exonic
979197096 4:117932963-117932985 CATTCTCTCCAGAAGGGGGTTGG - Intergenic
979727308 4:123978047-123978069 CATTTTTGATTGGAGGGGGTGGG - Intergenic
981080597 4:140635816-140635838 CATTCCTGGCTGCAGGGTGGAGG + Intronic
982786678 4:159544392-159544414 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
982798536 4:159673797-159673819 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
984441341 4:179774379-179774401 CACTCTTTGCTGAAGGCTGTGGG + Intergenic
984699989 4:182812972-182812994 CAATCATGGCAGAAGGGGATGGG + Intergenic
988350861 5:30106028-30106050 AATTCTGGGCTGAAGAGGGCAGG + Intergenic
993132312 5:83914390-83914412 CATTCTTGGCTGGAGTGGGCAGG - Intergenic
993231957 5:85247889-85247911 CTTTCTTGGTTGTAGGGGGATGG + Intergenic
993457477 5:88142619-88142641 CTTCCTTGGCTGAATAGGGTGGG - Intergenic
996057958 5:119001160-119001182 CATTCTTTGCTGAAGGCTATGGG - Intergenic
997348242 5:133209614-133209636 CTTTCTTGGCTGATGGGGGAAGG + Intronic
998224759 5:140318380-140318402 CTCTCTTTGCTGAAGGGGGTGGG - Intergenic
998273885 5:140733298-140733320 CAGCCTTTGCTGAAGTGGGTGGG - Intergenic
998725845 5:145013778-145013800 TATTCTTGGCTGTAGTGGTTTGG - Intergenic
1001542417 5:172548985-172549007 CATTCTTGGCTGTAGGACTTGGG - Intergenic
1002045604 5:176540176-176540198 CCCTCCTGGCTGAAGGGGTTTGG + Intergenic
1003170642 6:3719479-3719501 CACCCTTGGCTGCAGGGGCTTGG - Intergenic
1003926228 6:10880528-10880550 AAGTCCTGGCTGTAGGGGGTGGG - Intronic
1004661351 6:17712713-17712735 CATGCTTGTCTGATGGTGGTGGG - Intergenic
1005614102 6:27556295-27556317 CATTTTTGGCTGGAGGATGTTGG - Intergenic
1006848161 6:37077785-37077807 CCTTTTAGGCTGAAGGGGGCAGG - Intergenic
1007535007 6:42579195-42579217 CAGTCATGGCTGAAGGGGAAAGG + Intronic
1007697296 6:43741692-43741714 CAGTGTTGGCTGAAAGGGGCAGG + Intergenic
1008114768 6:47535657-47535679 CATTATTGCCTGAAGGTGGATGG + Intronic
1011899590 6:92275431-92275453 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1013492396 6:110660931-110660953 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1018206843 6:161444374-161444396 CATTCCTGGAGGAAGGTGGTGGG - Intronic
1018923640 6:168192392-168192414 CATTCTTAGTGGAAGGGAGTTGG - Intergenic
1019610747 7:1935509-1935531 CAGTCTTGGCTTATGGGGGTGGG + Intronic
1020739133 7:11990702-11990724 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1021307064 7:19045478-19045500 CATTCTCTGCTGGAGTGGGTGGG - Intronic
1022500087 7:30877283-30877305 CATTCTTGGGTCGAGGGCGTTGG + Intronic
1022770668 7:33469191-33469213 CATTCTGGGCTAAAGTGGTTTGG - Intronic
1023036860 7:36138776-36138798 CATTCTTGGTTGTAGGGGGTTGG - Intergenic
1023574745 7:41615194-41615216 CATACTCTGCTGAAGGAGGTAGG - Intergenic
1024929817 7:54658220-54658242 CATTCTAGGTTGAATGGTGTGGG - Intergenic
1025245471 7:57313353-57313375 CAGGCTTGGCTGAGGGGGCTGGG - Intergenic
1026280963 7:68921498-68921520 AATTCTAGGCAGAAGAGGGTGGG + Intergenic
1026919449 7:74144463-74144485 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1030546933 7:110907615-110907637 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1033790850 7:144790905-144790927 CAATCAAGGGTGAAGGGGGTGGG + Intronic
1038108465 8:24465157-24465179 CATTCTTTTATGCAGGGGGTGGG + Intronic
1040407139 8:47116400-47116422 CAATCATGGCTGAAGGGGAAGGG + Intergenic
1041479802 8:58307350-58307372 CAGTCATGGCTGAAAGGGGCCGG - Intergenic
1042004359 8:64165247-64165269 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1044731647 8:95233124-95233146 GCTTCTTGGAAGAAGGGGGTGGG - Intergenic
1046198071 8:110888996-110889018 CACTGGTGTCTGAAGGGGGTGGG + Intergenic
1046448240 8:114353502-114353524 CTTTCTTGATTCAAGGGGGTGGG + Intergenic
1047427419 8:124759382-124759404 CATTCTTGGTTGAATGGGCTTGG + Intergenic
1048280388 8:133101429-133101451 CCTCCTTGGCTGATGGTGGTTGG - Intronic
1049255173 8:141609948-141609970 CGTTCTGGGCTGAGAGGGGTGGG - Intergenic
1051491566 9:17672634-17672656 CTGTATTGGGTGAAGGGGGTGGG - Intronic
1052109035 9:24557197-24557219 CATTCTTGGCTGAAGGTTTCTGG + Intergenic
1052122234 9:24731555-24731577 AATTCTAGGCAGATGGGGGTGGG - Intergenic
1053314754 9:37041871-37041893 CATTCCAGGCTGAGGGTGGTTGG - Intergenic
1053545418 9:39018138-39018160 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1053809748 9:41839836-41839858 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1054620845 9:67347592-67347614 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1056728315 9:89142064-89142086 CATTCTTTGCTGATGGCTGTGGG - Intronic
1057052464 9:91935987-91936009 CAGTCCTGGCTGGAGGCGGTGGG - Intronic
1058179272 9:101777655-101777677 CATTGTTGGGGGAAGGTGGTGGG - Intergenic
1059118829 9:111623130-111623152 CAATCATGGCTGAAGGGGAAGGG + Intergenic
1059238143 9:112779720-112779742 CATTCATTGCTGAAGGGTGAGGG + Intronic
1059427649 9:114231183-114231205 CCTTCTGGGCTGAAATGGGTCGG - Intronic
1060098210 9:120812880-120812902 GATTCTTGGTGGAGGGGGGTGGG - Intergenic
1061267336 9:129514424-129514446 CTTCCTGGGCAGAAGGGGGTGGG + Intergenic
1062197586 9:135282823-135282845 CCTCCTTGGCAGAAGGAGGTTGG + Intergenic
1062400008 9:136368281-136368303 CAGTCTGGGCAGAAGGGGTTAGG - Intronic
1062479353 9:136744286-136744308 CTCTCTTGGGGGAAGGGGGTGGG - Intronic
1185871412 X:3667882-3667904 GTTTATTGGCTGAAAGGGGTGGG - Intronic
1186033268 X:5392613-5392635 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1186458442 X:9729197-9729219 CATTCTTGCTGGAAGGGGGCTGG + Intronic
1187944477 X:24412750-24412772 CATTCTAGGCTGAAAAGGCTTGG - Intergenic
1189128652 X:38475518-38475540 CATCCTTGGCTGAAGAGCATTGG - Intronic
1190765721 X:53473872-53473894 CAGTCTTGGCTTATGGGAGTAGG + Intergenic
1192316668 X:70057479-70057501 CAGTCTTTGCTGGTGGGGGTGGG - Intergenic
1192590312 X:72354190-72354212 CATTCTTTGCTGAAGCAGGCTGG + Intronic
1193248485 X:79259496-79259518 CATTCTTGGCTTTTGGGAGTGGG + Intergenic
1193952290 X:87814434-87814456 CATTCTTGATAGAATGGGGTAGG + Intergenic
1194098570 X:89674330-89674352 CTTTCTGGGCTCTAGGGGGTGGG - Intergenic
1194853352 X:98897121-98897143 CATTCTTTGCAGAAGGGTATAGG - Intergenic
1195179095 X:102339557-102339579 GTTTCTAGGCAGAAGGGGGTGGG - Intergenic
1195655002 X:107324854-107324876 GCTTCTGGGCTGAAGGGGGCGGG + Intergenic
1196209099 X:112974477-112974499 CATTTTTGGTGGCAGGGGGTTGG - Intergenic
1197609562 X:128623309-128623331 GCTTCTTGGCGGAAGGGGGTGGG - Intergenic
1198414794 X:136409164-136409186 CAATGCTGGCTGAAGGGGATGGG + Intronic
1198498165 X:137214841-137214863 CATTCTTTGCTGATGGCTGTGGG + Intergenic
1200451592 Y:3335705-3335727 CTTTCTGGGCTCTAGGGGGTGGG - Intergenic
1200792699 Y:7313810-7313832 GTTTATTGGCTGAAAGGGGTGGG + Intergenic