ID: 1151322915

View in Genome Browser
Species Human (GRCh38)
Location 17:73362218-73362240
Sequence TCCCATGGGATGCTGCATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151322915_1151322919 0 Left 1151322915 17:73362218-73362240 CCCTTATGCAGCATCCCATGGGA 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1151322919 17:73362241-73362263 CTAGAATTATATCCTTTTTCAGG 0: 1
1: 0
2: 3
3: 17
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151322915 Original CRISPR TCCCATGGGATGCTGCATAA GGG (reversed) Intronic
904320152 1:29691373-29691395 TGCCATGGGATGATGCAGTAAGG + Intergenic
909349164 1:74629489-74629511 TCCCCTGGGATTCTGCATTCAGG - Intronic
915003173 1:152612475-152612497 TCCCATGGGAAGCTAAATATGGG + Intergenic
919762781 1:201108724-201108746 TCCCATGGAAACCAGCATAAAGG + Intronic
921948277 1:220904076-220904098 TCCTGTGGGAGGCTGAATAACGG - Intergenic
1066756974 10:38721240-38721262 TTCCATGGCAGGCTGAATAATGG + Intergenic
1067048791 10:43000395-43000417 GCCCATGGGAGGCAGCATGATGG + Intergenic
1067773995 10:49148422-49148444 TCCCATGGAAAGCTCAATAAAGG + Intergenic
1070559283 10:77553666-77553688 TCCCAGGGGATGCCCCATCAGGG + Intronic
1071890460 10:90000799-90000821 TTCCATGGTAGGCTGAATAAAGG - Intergenic
1072420535 10:95287385-95287407 TCCCAAGGGATGCTTAATAATGG - Intronic
1073700467 10:105921038-105921060 ACCCATGGGAAGCTTCACAAAGG + Intergenic
1074525332 10:114258110-114258132 CCCCTTGGCATGCTGCAGAAGGG + Intronic
1074689401 10:115990815-115990837 TCCCATGGGCAGCTGGATACAGG + Intergenic
1075416140 10:122265777-122265799 TCCCATGGGATCCACAATAAAGG - Intergenic
1075676082 10:124296535-124296557 GCCCATGGGATGCTGGCTAAAGG - Intergenic
1078135189 11:8646027-8646049 TGCCATGGGATGCTGGCTGATGG + Intronic
1078599101 11:12715097-12715119 CCCCATGGTATGCTCCATAAGGG - Intronic
1079621161 11:22556466-22556488 TCACATGGAATACTGTATAAAGG - Intergenic
1080577209 11:33610877-33610899 TGCCATGGGATGATGCAGCAAGG - Intronic
1081072944 11:38632549-38632571 TCCCGTGGGATAATTCATAAAGG - Intergenic
1084051099 11:66600507-66600529 CCCCATGAGATGCTCCATCAGGG - Exonic
1085570331 11:77552926-77552948 TCCCATGGCATGCTTTAAAAGGG + Intronic
1087096750 11:94326395-94326417 ACCCATGGGTAGCTGCAGAAAGG - Intergenic
1087594867 11:100240384-100240406 TCCAATGGCACACTGCATAATGG + Intronic
1088802185 11:113316222-113316244 CCCTAAGGGATGCAGCATAATGG - Exonic
1090062198 11:123473675-123473697 TCCCATGGGAACCTGCAGCAAGG - Intergenic
1090846571 11:130534514-130534536 TCCCATGTGCTGATGCATCAGGG + Intergenic
1092722719 12:11457904-11457926 TACGATGGGATGCTTCATTAGGG - Intronic
1093861171 12:24169716-24169738 CCACGTGCGATGCTGCATAATGG + Intergenic
1095349380 12:41189961-41189983 TCACACGGGATGCTGCAAAGAGG - Intronic
1096636016 12:52960123-52960145 TCCTATGGTAGGCTGAATAATGG - Intergenic
1102048080 12:109842217-109842239 TGCCAGGGGGTGCTGGATAAAGG - Intergenic
1109190509 13:59317475-59317497 TCCCATGGGATTCTGCCAACAGG + Intergenic
1109721788 13:66284464-66284486 TCCCATGGGATGATGGAATAAGG - Intergenic
1113191025 13:107746066-107746088 TCCCAGGGGAAGCTGAATTAGGG - Intronic
1113617749 13:111693091-111693113 TCCCAGGGAATGCTGCTGAAAGG - Intergenic
1113623280 13:111778352-111778374 TCCCAGGGAATGCTGCTGAAAGG - Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1124473003 15:30004863-30004885 TCCCATGGGGCACTGCATCATGG - Intergenic
1126768992 15:52036457-52036479 TACCATGGGCTGATGCAGAAAGG - Intronic
1130710428 15:86275312-86275334 TCCCATGGAAGGATGCATGATGG - Intronic
1131432802 15:92400250-92400272 GTCCATGGGGTGCTGCATGATGG - Intronic
1131611113 15:93965084-93965106 TTCCATGGGGTACAGCATAATGG - Intergenic
1133170964 16:3982299-3982321 TGCCCTGGGATGTTGGATAAGGG + Intronic
1136725607 16:32354883-32354905 TTCCATGGCAGGCTGAATAATGG - Intergenic
1136843935 16:33560945-33560967 TTCCATGGCAGGCTGAATAATGG - Intergenic
1139079311 16:63495728-63495750 TCTCAAGGGATGGAGCATAAAGG - Intergenic
1141623965 16:85251745-85251767 TCCCAGGTGATTCTGCATCAAGG + Intergenic
1203000826 16_KI270728v1_random:162871-162893 TTCCATGGCAGGCTGAATAATGG + Intergenic
1203132426 16_KI270728v1_random:1699276-1699298 TTCCATGGCAGGCTGAATAATGG + Intergenic
1203154100 16_KI270728v1_random:1861244-1861266 TTCCATGGCAGGCTGAATAATGG - Intergenic
1144630624 17:16870349-16870371 GCCCCTGGGATGCTGGCTAAGGG + Intergenic
1145108561 17:20141204-20141226 ACACATGGGGTGCTGCAGAAGGG - Intronic
1148097960 17:45067114-45067136 TACAGGGGGATGCTGCATAAAGG - Intronic
1150207781 17:63421746-63421768 CCCCATGGGATGCTGGCTAACGG + Exonic
1151322915 17:73362218-73362240 TCCCATGGGATGCTGCATAAGGG - Intronic
1157364713 18:47054046-47054068 TCCCATGTAATGCAGCAAAATGG + Intronic
1161747188 19:6068185-6068207 TCCCTTGGGATGCAGCATCCAGG - Intronic
1161902129 19:7126687-7126709 TCTCATGGGACTCTGCAGAAAGG + Intronic
1164480007 19:28604061-28604083 TCCCAGGGGATGCTGATCAATGG - Intergenic
1164514413 19:28921799-28921821 TCCCATGAGATGCTGCAAGCTGG - Intergenic
926476012 2:13323407-13323429 TCCTACTGGATGCTGCACAAGGG + Intergenic
926932584 2:18055214-18055236 TCCCATGGGCTGTTGGATGAGGG + Intronic
930909409 2:56612950-56612972 TCCTAAGGGAAGCTGTATAATGG - Intergenic
934058199 2:88270095-88270117 TCTCATGGGTGGCTGCATCAGGG + Intergenic
934320280 2:91965683-91965705 TTCCATGGCAGGCTGAATAATGG + Intergenic
934908771 2:98230765-98230787 TCCCGTGCTATGCTGAATAAGGG - Intronic
935457713 2:103289375-103289397 TTCCAGGAGATACTGCATAAGGG + Intergenic
939410677 2:141820827-141820849 CCCCATGGCAGGCTGAATAATGG + Intronic
940700811 2:157040568-157040590 ACCCATGGCATCCTACATAAAGG + Intergenic
942369863 2:175272111-175272133 TCCCCAGGGATCCTGCAGAAAGG + Intergenic
944900462 2:204208695-204208717 TGACATGGGATGATGCACAAAGG - Intergenic
945655878 2:212623201-212623223 TCTCATAGGATGCAGCAAAAGGG + Intergenic
946132796 2:217620461-217620483 TCCCTTGGGATTCTGCTTCAAGG - Intronic
1168771166 20:417816-417838 TCCCATGGGGTGCGGCAGAATGG + Exonic
1174668731 20:52285437-52285459 TCCCCTTGGATGCTGGACAAAGG - Intergenic
1178749431 21:35286335-35286357 TCCTATGAGATGCTGCACAGAGG - Intronic
1181715966 22:24729091-24729113 CTCCATGGGAAGTTGCATAAGGG + Intronic
1182212171 22:28685794-28685816 TTCCATGGTAGGCTGAATAATGG - Intergenic
1182562719 22:31173637-31173659 TCCCTTGGGATGTTAAATAAAGG - Intronic
954755622 3:52837905-52837927 TCTCATGGGATGGTGCACCACGG + Exonic
957268362 3:77997041-77997063 CTCCATGGGATGCTGCATTTTGG - Intergenic
973812827 4:54588850-54588872 TCCCATGGCATGCTGAACATAGG + Intergenic
976744697 4:88391513-88391535 TCCTATGGTAGGCTGAATAATGG - Intronic
976867761 4:89751320-89751342 TCCCATGGGATCCTGCTGTAAGG + Intronic
986034686 5:3926300-3926322 TCTGATGGGTTCCTGCATAAAGG - Intergenic
988860740 5:35275521-35275543 TGGTATGGGATGCTGCATCAAGG + Intergenic
992475587 5:77098755-77098777 TGCCATGGGATAATGCAAAAAGG - Intergenic
997338063 5:133121775-133121797 TCCCATGGGGGTCTGCACAATGG + Intergenic
997618660 5:135270738-135270760 TCCAAGGGAAGGCTGCATAAGGG - Intronic
997717684 5:136054157-136054179 TCCCATGGGGTGCTGTAAATCGG - Intronic
1004888192 6:20071933-20071955 TCACATGGGATGGTGCAGGATGG - Intergenic
1011519941 6:88194380-88194402 TCCCATGGGCTGCTCCTGAATGG + Intergenic
1013486334 6:110599814-110599836 TCCCATGGCAGACTGCAGAAAGG - Intergenic
1015006933 6:128294347-128294369 TCTCTTGGAATGATGCATAAAGG + Intronic
1015581630 6:134731215-134731237 TCCCATGGTATGCTATATAGCGG + Intergenic
1016354528 6:143203739-143203761 TCCCTTGAGATGCTGTATCATGG + Intronic
1019739867 7:2667319-2667341 TCCCATGGTAGGCAGGATAATGG - Intergenic
1020961493 7:14809856-14809878 TGCTAGGGGATGCTGAATAAAGG - Intronic
1023752296 7:43384332-43384354 ACCCATGGGTTGCTGGATCATGG - Intronic
1024501858 7:50118599-50118621 TCTCCAGGGATGCTCCATAAAGG - Intronic
1028725484 7:94082492-94082514 ACCCCTGTGATGCTGCACAAAGG - Intergenic
1029715661 7:102324087-102324109 TCCCAAGGGATGCAGCAGGAAGG + Intergenic
1031296636 7:120011229-120011251 TCCAATGGGGTCCTGCATGATGG - Intergenic
1031349731 7:120715817-120715839 TCACATGGGAAGCTGCATGTTGG - Intronic
1031692062 7:124800836-124800858 GCCCTTGGGCTGCTGCATGAAGG - Intergenic
1033832652 7:145272043-145272065 TCACAAGGGATGGTGAATAATGG + Intergenic
1035566276 8:643421-643443 TCTCATGGGATGCTCCATCCAGG + Intronic
1037682536 8:21109525-21109547 TCCCATGGGCTGGTGGATACTGG - Intergenic
1038479912 8:27894771-27894793 CCCCATGGGAAGCTGCGTGAAGG + Intronic
1042081235 8:65054268-65054290 TCACGTAGGATGCTACATAAGGG + Intergenic
1046526150 8:115384489-115384511 TCCCATAGGATGCGCCACAAGGG + Intergenic
1050771751 9:9209952-9209974 TCCCATGGGGTGATGCAGAAGGG + Intronic
1052981049 9:34449891-34449913 TCCTTTGGGATGCTTCATGAGGG - Intronic
1053009260 9:34624090-34624112 TCCCTGGGGATGCTGCAGACAGG - Intronic
1056899977 9:90589078-90589100 ACCCATGGTAGGCTGAATAATGG - Intergenic
1061561412 9:131406266-131406288 TCCCATGGGCAGGTGCATCAGGG + Intronic
1187421576 X:19138667-19138689 TCCCATTGGATTCTGCATATTGG + Intergenic
1189308193 X:40003062-40003084 TCCTAGGGAATGGTGCATAAAGG + Intergenic
1192708475 X:73554206-73554228 TCCAATGGTATGCTGCCTACAGG + Intergenic
1194092829 X:89599989-89600011 CCCCCTGGGGTACTGCATAATGG - Intergenic
1200445466 Y:3256093-3256115 CCCCCTGGGGTACTGCATAATGG - Intergenic
1200899840 Y:8418127-8418149 TCTCATGGGAAGCTGCAGTATGG - Intergenic
1201187793 Y:11420796-11420818 TTCCATGGCAGGCTGAATAATGG + Intergenic