ID: 1151324163

View in Genome Browser
Species Human (GRCh38)
Location 17:73368594-73368616
Sequence CTGTGGGAACAGAAGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 379}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151324159_1151324163 -10 Left 1151324159 17:73368581-73368603 CCCAGAAATAAATCTGTGGGAAC 0: 1
1: 0
2: 0
3: 15
4: 224
Right 1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG 0: 1
1: 0
2: 1
3: 25
4: 379
1151324154_1151324163 3 Left 1151324154 17:73368568-73368590 CCCCGCTGGGCTTCCCAGAAATA 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG 0: 1
1: 0
2: 1
3: 25
4: 379
1151324153_1151324163 4 Left 1151324153 17:73368567-73368589 CCCCCGCTGGGCTTCCCAGAAAT 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG 0: 1
1: 0
2: 1
3: 25
4: 379
1151324155_1151324163 2 Left 1151324155 17:73368569-73368591 CCCGCTGGGCTTCCCAGAAATAA 0: 1
1: 0
2: 1
3: 18
4: 189
Right 1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG 0: 1
1: 0
2: 1
3: 25
4: 379
1151324156_1151324163 1 Left 1151324156 17:73368570-73368592 CCGCTGGGCTTCCCAGAAATAAA 0: 1
1: 0
2: 0
3: 21
4: 231
Right 1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG 0: 1
1: 0
2: 1
3: 25
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151324163 Original CRISPR CTGTGGGAACAGAAGGATGT GGG Intronic
902436211 1:16399466-16399488 CTGTGGGCAGAGCAGGATGCAGG + Exonic
902502745 1:16921853-16921875 CGGTGGGAGGAGCAGGATGTGGG - Intronic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
903062918 1:20682855-20682877 CTGTTGGAGCAGCAGGTTGTGGG - Exonic
903798460 1:25948185-25948207 CTGTGATAACATAAGAATGTTGG + Intergenic
904600245 1:31668928-31668950 GAGTGGGAACAGAAGGCAGTGGG - Intronic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
905697968 1:39989809-39989831 CTGGGAGAAGAGAAGGATGGGGG - Intergenic
907044993 1:51295114-51295136 CTCAGGGAACAGCTGGATGTGGG + Intronic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
907777907 1:57536820-57536842 CCATGGGAACAGAAGCATGGAGG - Intronic
907798608 1:57742375-57742397 ATGTGGGATCAAAAGGATGGGGG + Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908900727 1:68953380-68953402 CTTTGGAATCAGAAGGATTTGGG - Intergenic
910326360 1:86012647-86012669 CTGTGTGAACATAAGACTGTGGG - Intronic
910438895 1:87232178-87232200 CTGTGGGTACAGATGGTAGTAGG - Intergenic
910618531 1:89227285-89227307 CTTTGGTATCAGAATGATGTTGG + Intergenic
911622604 1:100082339-100082361 CCGTGGGAACTAAAGGAAGTGGG + Exonic
912502913 1:110134065-110134087 CTTTGGGATCCGAAGGATCTAGG + Intergenic
912875953 1:113359571-113359593 CTTTGGTATCAGAATGATGTTGG + Intergenic
913237588 1:116798130-116798152 ATGTGGGAAAAGAGGGCTGTAGG + Intergenic
915227739 1:154423161-154423183 CAGTGGGCACTGAGGGATGTCGG - Intronic
916256087 1:162789595-162789617 GTCTGAGAACAGAAGGTTGTAGG + Intergenic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
919985752 1:202673557-202673579 CTGTTGGGACCTAAGGATGTGGG - Intronic
920538410 1:206758038-206758060 CGGTGGGTACAGAAGCAGGTTGG - Intergenic
921240287 1:213173637-213173659 CTGTGGTCTCAGAAAGATGTGGG - Intronic
921681597 1:218039488-218039510 CTGAGGGATCAGATGGAGGTTGG + Intergenic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
923570042 1:235105265-235105287 CTGTGGGAGAGGAAGGCTGTGGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924658870 1:245997962-245997984 CAGTGGGATCAGAAAGAGGTTGG - Intronic
1063556430 10:7084062-7084084 TGGTGGGAACAGAAGGAGGAGGG + Intergenic
1064137284 10:12761970-12761992 CCGTTGGCACAGAAGGATCTGGG + Intronic
1064604559 10:17025641-17025663 CTATGAGAAAAGAAAGATGTTGG + Intronic
1066722549 10:38355249-38355271 GTCTGGGAACAGAAGGTTGTAGG + Intergenic
1067343536 10:45422297-45422319 CTGCTGGATCAGGAGGATGTGGG + Intronic
1068492741 10:57744307-57744329 GTATGGGAAGAGAAGGCTGTTGG - Intergenic
1068566113 10:58577327-58577349 CTTTGGCATCAGAATGATGTTGG - Intronic
1069465755 10:68637370-68637392 CTTTGGGAAAATAAGGTTGTTGG + Intronic
1070319960 10:75347362-75347384 CTGCGGGCCCAGATGGATGTGGG - Intergenic
1071515284 10:86292916-86292938 CTGTGTGAAGAGATGGATGGGGG + Intronic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1072029687 10:91506779-91506801 CTTTGGTATCAGAATGATGTTGG - Intronic
1073994391 10:109299144-109299166 CTGAAGGAACAGAGTGATGTTGG - Intergenic
1075923554 10:126233081-126233103 CTTTGGGGACAGATGTATGTGGG + Intronic
1076042470 10:127262495-127262517 ATATGGGGGCAGAAGGATGTGGG - Intronic
1076292756 10:129360378-129360400 CTGGAGGAACAGACGGATTTAGG + Intergenic
1076609544 10:131713478-131713500 AGCTGGGAACAGGAGGATGTGGG - Intergenic
1076680781 10:132170169-132170191 CTGTGGGACCAGAAGTCTCTGGG - Exonic
1077025742 11:439158-439180 CTGTGGGACAGGAAGGATGGGGG - Intronic
1077147689 11:1053300-1053322 CTGTGGGAACTGCAGGAAGGAGG - Intergenic
1077501916 11:2913154-2913176 CTGAGGGAGCAGCAGGATATGGG + Intronic
1077855476 11:6120073-6120095 CTTTGGTATCAGAATGATGTTGG - Intergenic
1077929599 11:6717239-6717261 CTGTGGACACAGAAGGACTTCGG - Intergenic
1078109599 11:8381988-8382010 CTGTGGTTACAGAGGGATATGGG - Intergenic
1078433576 11:11306315-11306337 CTTGGTGATCAGAAGGATGTAGG + Intronic
1078632486 11:13015979-13016001 CTCTGGGTACATGAGGATGTGGG + Intergenic
1078928877 11:15898131-15898153 CTAAGGGAACAGAAGAATCTTGG + Intergenic
1079098005 11:17523268-17523290 CTGTGGGGACAGAAGGACAGTGG + Intronic
1080032946 11:27681113-27681135 TTGTGGAAACACAAGGATGGGGG + Intronic
1081800996 11:45859238-45859260 CTGTGTGAACAGAGGTCTGTTGG - Intronic
1082112129 11:48288658-48288680 CTGTGGTATCAGGATGATGTTGG + Intergenic
1082303838 11:50546558-50546580 CTTTGGTATCAGAATGATGTTGG - Intergenic
1082578135 11:54834801-54834823 CTTTGGTATCAGAATGATGTTGG - Intergenic
1082599892 11:55136347-55136369 CTTTGGTATCAGAATGATGTTGG - Intergenic
1083504565 11:63143678-63143700 ATTAGGGAACAGTAGGATGTTGG + Exonic
1085140876 11:74140250-74140272 CTATTGGAACAGAGGGATGAAGG - Intronic
1085316888 11:75550722-75550744 CTGTGGGAACTGCAGAATTTGGG + Intergenic
1085564463 11:77500866-77500888 CTGTGGTAAGAGAAGTCTGTTGG - Intergenic
1086245125 11:84742549-84742571 TTGTGGGGACAGAGGTATGTAGG - Intronic
1089018351 11:115186035-115186057 CGGTGGAAACAGGAGCATGTTGG + Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1090024087 11:123152931-123152953 CTGGAGGGAGAGAAGGATGTTGG + Intronic
1090034279 11:123234905-123234927 CTTTGGGGACAGAAAGATCTGGG + Intergenic
1090510199 11:127366682-127366704 CTTTGGTATCAGAATGATGTGGG - Intergenic
1090544927 11:127754401-127754423 TTGGGGGAACAGAAGGTTTTTGG + Intergenic
1090908081 11:131094750-131094772 CTGTGGAAAGAGAAGGAGTTGGG + Intergenic
1090923239 11:131226728-131226750 CTGTGGCAACTGAATGTTGTAGG - Intergenic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1093494875 12:19744989-19745011 ATGTGGTAAATGAAGGATGTGGG - Intergenic
1094046216 12:26169836-26169858 ATGTGGAAGCAGAAGGATATTGG + Intronic
1095911443 12:47430419-47430441 CTTTGGTATCAGAAGGATGCTGG - Intergenic
1096927393 12:55164086-55164108 CTTTGGTAACAGAATGATGCTGG + Intergenic
1098052340 12:66467699-66467721 CTTAAGGAACAGAAGGATGATGG - Intronic
1098266498 12:68726802-68726824 CTGTGGCCACAGAATGCTGTTGG + Intronic
1098747497 12:74258455-74258477 CTGTGGGAAGATAAGGATAAAGG + Intergenic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1099217389 12:79869833-79869855 CTGTGGTAACTGAAGTATTTTGG - Intronic
1099511719 12:83546853-83546875 CTTTGGTAACAGGATGATGTTGG + Intergenic
1100067872 12:90672302-90672324 CTGGAGTAACAGAAGAATGTGGG + Intergenic
1100177453 12:92047262-92047284 CAGTAGGAACAGAAGGTTGCTGG - Intronic
1101769341 12:107734261-107734283 CTGTGGGGACAGAAGACTGTAGG - Exonic
1101869995 12:108558301-108558323 CTGTGGGATCAGGATGAGGTGGG + Intronic
1102982437 12:117252651-117252673 GTGTAGGGACAGGAGGATGTGGG + Intronic
1103627483 12:122231082-122231104 CTGTGGGACCAGTTGGATGTTGG + Exonic
1103932098 12:124456320-124456342 CAGTGGGCACAGATGGCTGTGGG + Intronic
1103971187 12:124673932-124673954 CAGTGGGAGCAGAAGGATCTGGG - Intergenic
1104610805 12:130226179-130226201 CTGGGGGACCAGCAGGACGTGGG - Intergenic
1106072877 13:26430345-26430367 CTTTGGTATCAGAATGATGTTGG - Intergenic
1106817189 13:33421600-33421622 CTGTGGTATCAGGATGATGTTGG - Intergenic
1107018586 13:35729126-35729148 CTGTGGAATCAGAAAGATGCAGG + Intergenic
1108107897 13:47032926-47032948 CTGTGAGAACAGAAAAAGGTGGG - Intergenic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1112628608 13:101135696-101135718 CTGTGGCAACACAAGGAAGCAGG + Intronic
1113110222 13:106814658-106814680 CTGTGACCACAGAAGGATCTAGG + Intergenic
1113800570 13:113084344-113084366 CTGGGGGTACAGAAGGTTCTGGG - Intronic
1113944071 13:114033845-114033867 CTGAGGGGCCACAAGGATGTTGG + Intronic
1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG + Exonic
1114885564 14:26845402-26845424 CTGAGGGAACATAAGGATTCTGG + Intergenic
1114923149 14:27360028-27360050 CTTTGGGATCAGGATGATGTTGG + Intergenic
1117003489 14:51395092-51395114 CTTTGGGAACAGTAGGAGGTGGG - Intergenic
1117391568 14:55267493-55267515 CTGTGGGGATAGGAGGATCTGGG + Intergenic
1117532267 14:56671048-56671070 CTTTGGTATCAGAAGGATGCTGG - Intronic
1117755125 14:58966908-58966930 CTTTGGGAACAAAAGGAGATAGG + Intergenic
1118114439 14:62759451-62759473 CTGTGCTTACAGAAGGATATTGG + Intronic
1118544766 14:66873804-66873826 CTGTGGGAAGGGGCGGATGTGGG + Intronic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1119425830 14:74534156-74534178 CTGTGGCCACAGTGGGATGTGGG + Intronic
1120428987 14:84389834-84389856 CTGTGGGAACAGATGTAAGTTGG - Intergenic
1121087620 14:91158367-91158389 CTGTGGGAACAAAGTGCTGTGGG - Intronic
1121151849 14:91642695-91642717 CTTTGGTATCAGAAGGATGCTGG + Intronic
1121797087 14:96744184-96744206 CTGTGGGAAGAGAAGTAAGGAGG + Intergenic
1122006261 14:98706308-98706330 CTCTGGGAACAGTGGGGTGTGGG - Intergenic
1125492592 15:40159262-40159284 CTACGGGAAAAGAAGGAGGTAGG - Intergenic
1126183078 15:45804972-45804994 TTGTGGGAACAGAAGTGGGTAGG - Intergenic
1127580360 15:60333366-60333388 CTTTGGGATCAGGAGGATGCTGG - Intergenic
1127882859 15:63173599-63173621 GTCAGGGAGCAGAAGGATGTTGG + Intergenic
1128095220 15:64949135-64949157 CTGTGGAAACAGACAGATGCTGG - Intronic
1128698985 15:69790154-69790176 CTGAGGGAAAAGGAGGATGTGGG - Intergenic
1131266784 15:90920184-90920206 CTGTGGCAACAGCAGGCTCTAGG + Exonic
1131484319 15:92807859-92807881 CTCCGGGGAGAGAAGGATGTAGG - Intronic
1133033001 16:3020570-3020592 CTGGGGGAACAGGCGGATGTGGG + Intronic
1134522591 16:14925421-14925443 GTGTGGGAACAGACGTATGTGGG - Intronic
1134550038 16:15134635-15134657 GTGTGGGAACAGACGTATGTGGG + Intronic
1134718431 16:16368360-16368382 GTGTGGGAACAGACGTATGTGGG - Intergenic
1135153447 16:20031156-20031178 CTGTGGGAATAGAAGAGTATTGG - Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1138188559 16:54995898-54995920 CTGTGGGAGAAGTAGGAGGTGGG + Intergenic
1139012740 16:62652905-62652927 CTCTGGGAACAGATGGCTCTTGG - Intergenic
1139532457 16:67549057-67549079 CTGAGGGGACAGATGGAAGTGGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141403570 16:83772046-83772068 CTGTGGGTGGAGAAGGATGGGGG + Intronic
1141762035 16:86034902-86034924 CTGTGCGCACAGGAAGATGTTGG + Intergenic
1142031403 16:87840281-87840303 CTCTGGGGCCAGCAGGATGTGGG - Intronic
1142226176 16:88878621-88878643 CTGTGAGAACAGGAGGATCCAGG - Intronic
1143139570 17:4733721-4733743 CTGCGGGTACAGGAGGATGCAGG + Exonic
1144191876 17:12853941-12853963 CTGCGGGAACAGAATGAGCTGGG - Intronic
1145014539 17:19387671-19387693 CTGGGGGAGCAGAAGGCTGAGGG + Intergenic
1146637993 17:34520169-34520191 CTTTGGGAGCAGAAAGATCTAGG - Intergenic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1147953970 17:44122365-44122387 TTATGGGAACAAAAGGAGGTGGG - Intronic
1148130342 17:45258362-45258384 CTGGGGGAACAGCAGGACCTGGG - Intronic
1148543904 17:48502416-48502438 CTGGGGGAAAAGAGGGCTGTGGG - Intergenic
1148777460 17:50103751-50103773 CTGTGTGAACAGAAGCGTGGAGG + Intronic
1149009179 17:51836987-51837009 CTGGGGAGAAAGAAGGATGTGGG + Intronic
1149548249 17:57520320-57520342 CCATGGGAACTGAAAGATGTGGG - Intronic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1151188197 17:72379136-72379158 CAATGGGAACAGCAGGATGGGGG + Intergenic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151572450 17:74933646-74933668 CTCTGGGACCAGAAGGAAATGGG - Exonic
1152096209 17:78273145-78273167 ATGGGGGAACAGCAGGAGGTAGG + Intergenic
1153136704 18:1925743-1925765 ATGTGAGAACAGAAGGAGTTTGG - Intergenic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1155161042 18:23196295-23196317 GTGTGGGAACCGCAGGCTGTAGG + Intronic
1155408434 18:25515298-25515320 CTGGGGGAAAAAAAGGATTTTGG - Intergenic
1157074472 18:44449996-44450018 CTGTGGGAACAGAAAGCAGAAGG - Intergenic
1157621947 18:49021750-49021772 CTGTGGGGACAGCAAGGTGTAGG - Intergenic
1158678806 18:59547870-59547892 CTGTGAGAACAGGATGATCTCGG - Intronic
1160005156 18:75063834-75063856 CTGTGGGAACATCTGGATCTCGG - Exonic
1160311005 18:77790069-77790091 CTGTGGGAGCAGAAGGCTGCAGG + Intergenic
1160752907 19:743113-743135 CTCTGAGAACAGAAGGCTTTGGG - Intronic
1160955251 19:1688313-1688335 CTGTGGGACCAGAATGGGGTGGG + Intergenic
1161064103 19:2229123-2229145 CTTTGAGACCAGAAGGAAGTTGG + Intronic
1161568019 19:5014030-5014052 CTGTGGGAAGATATGGAAGTCGG + Intronic
1162823025 19:13234846-13234868 CTATGGGAACAGAAGGATGAAGG + Intronic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165593936 19:36995815-36995837 AGGTGGGAACAGAAGTATTTTGG - Intronic
925117478 2:1392490-1392512 CTTTGGGATCAGGATGATGTTGG + Intronic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
926248331 2:11137785-11137807 CAGTGGGAGCAGGAGGATATGGG + Intronic
926259544 2:11245754-11245776 CAGTGGGATCAGAATGAGGTTGG - Intronic
926357888 2:12057637-12057659 CCGTGGGGACAGCAGGATTTGGG + Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
928902548 2:36335954-36335976 CTGTAAGAATAGAAGGATGAGGG + Intergenic
930005570 2:46893466-46893488 GGGTGGGAACAGGAGGGTGTGGG - Intergenic
930886247 2:56330478-56330500 ATCTGGGAACAGAATGATGAGGG + Intronic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
931431758 2:62214185-62214207 CTGAGGGAACAGTAGCATATTGG + Intronic
931501941 2:62878470-62878492 TTTTGGTATCAGAAGGATGTTGG - Intronic
932666795 2:73704728-73704750 CTCTGGGAACAGGATGATGGTGG + Intergenic
933664721 2:84955718-84955740 CTGTAGGGCCAGAAAGATGTTGG + Intergenic
933984694 2:87580868-87580890 CTCTGGTAAAAGAAGGCTGTGGG + Intergenic
934521452 2:95022645-95022667 CTCTGGGAACACAAGGAAGTGGG - Intergenic
934564145 2:95329242-95329264 CTATGGGATAAGAAGGTTGTAGG - Intronic
936309157 2:111369932-111369954 CTCTGGTAAAAGAAGGCTGTGGG - Intergenic
937535142 2:122877046-122877068 CTGAAGGAACAGATAGATGTGGG + Intergenic
937927372 2:127177463-127177485 CTGTGGGCACAGGAGGCTGCTGG - Intergenic
939208598 2:139141584-139141606 GTATGGGCACAGAAAGATGTTGG + Intergenic
939299519 2:140317467-140317489 AGGTGGGAACACAAGGATGATGG + Intronic
941763287 2:169268262-169268284 CTTTGGTATCAGAATGATGTTGG - Intronic
942587809 2:177503536-177503558 TTGTGGGGACAGCAGGAAGTAGG + Intronic
942623892 2:177878097-177878119 CTGTGTGACCAGATGAATGTAGG + Intronic
942841641 2:180368991-180369013 ATGTGGGAAAAGAAGGCTGGAGG + Intergenic
943132604 2:183873326-183873348 AAATTGGAACAGAAGGATGTGGG - Intergenic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
943876667 2:193074677-193074699 CTCTGGGAGCAGAAGGGTCTAGG - Intergenic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
944630153 2:201616212-201616234 CTTTGGTATCAGAATGATGTTGG - Intronic
945355536 2:208835224-208835246 CTTTGGTAACAGAATGATGCTGG - Intronic
945409842 2:209495230-209495252 CTGGGGGAAGAGGGGGATGTGGG + Intronic
946204012 2:218090196-218090218 CTGTGGGCAGAGTAGGGTGTGGG + Exonic
946237612 2:218333679-218333701 CTCTGGCAACAGAAAGATCTGGG - Intronic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
948467563 2:238159463-238159485 CTTTTGGGACAGAAGGAAGTTGG + Intronic
1168868648 20:1110174-1110196 GAGTGGGAACAGGAGTATGTGGG - Intergenic
1169803175 20:9532384-9532406 CTGTGGGCACAAGAGGATGTTGG + Intergenic
1172155861 20:32823930-32823952 AGGTGGGAACAGAAGGAGTTAGG - Intronic
1172189962 20:33056021-33056043 CTGTGGGAAGGGCAGGATGGAGG - Intronic
1173493757 20:43504311-43504333 TTGTAGGAACAGAATGGTGTGGG + Intergenic
1173575025 20:44107352-44107374 CAGGGAGAAGAGAAGGATGTGGG - Intergenic
1173597045 20:44265257-44265279 CTGTGGGAGCAAAAGCATGGAGG - Intronic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174871277 20:54185202-54185224 CTGTGGGAAGAGGTGCATGTGGG - Intergenic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1178021175 21:28410160-28410182 CTGTTGCAACAGACTGATGTTGG + Intergenic
1178156833 21:29863954-29863976 CTATTGGAACAGGAGGATGAAGG - Intronic
1178186465 21:30227689-30227711 CTGTGGGAAAATCAGGATGGGGG - Intergenic
1178572313 21:33750231-33750253 CTGTGGGAACAGAAGATACTAGG - Exonic
1179241481 21:39597031-39597053 ATGTGGGAAGAGAAGGAGCTTGG - Intronic
1179280097 21:39926550-39926572 CTCTGGGAGTAGAAGGATTTGGG + Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1180598747 22:16999126-16999148 CTTTGGTAACAGGATGATGTTGG + Intronic
1180798744 22:18621400-18621422 TTGTGGGAAGCGAGGGATGTGGG + Intergenic
1181175919 22:21035508-21035530 GTGTGGGAGCAGAAGTATATGGG - Intergenic
1181222970 22:21373862-21373884 TTGTGGGAAGCGAGGGATGTGGG - Intergenic
1181255769 22:21561757-21561779 TTGTGGGAAGCGAGGGATGTGGG + Intronic
1181433519 22:22896960-22896982 CTGCAGGAGCAGGAGGATGTGGG + Intergenic
1182234730 22:28866358-28866380 CTGAGGGAATAGCAGGATGAGGG + Intergenic
1182646602 22:31815135-31815157 GTGTGGGATCATCAGGATGTTGG - Exonic
1182979598 22:34656382-34656404 GAGTGGGAACATCAGGATGTTGG + Intergenic
1183778514 22:39983703-39983725 CTGTGGGTACAGATGGTGGTGGG - Intergenic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184616539 22:45641664-45641686 CAGAGGGAACACACGGATGTAGG + Intergenic
1184631931 22:45788462-45788484 CAGTGGGGACAGAAAGATGCAGG - Intronic
949456303 3:4242759-4242781 CTTTGGGATCAGGATGATGTTGG + Intronic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
949863656 3:8529361-8529383 CCATGGCAACAGAAGTATGTGGG - Intronic
950471589 3:13189763-13189785 CTGGGGGAACAGGAGGACCTGGG - Intergenic
953192650 3:40702059-40702081 GTGTGGGGACAGAAGTATATGGG - Intergenic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954349096 3:50027498-50027520 CTGGGGGTAGAGAAGGAAGTAGG - Intronic
954929227 3:54266462-54266484 CTGTGGAAAGAGAAAGGTGTTGG + Intronic
957876347 3:86151609-86151631 CTGTTGGAAGAGAAGCAAGTAGG - Intergenic
958858094 3:99410976-99410998 CTGTGGGAAAAGAAGTGTATCGG + Intergenic
959465560 3:106682013-106682035 CTGTGGCACAAGAGGGATGTGGG + Intergenic
960546228 3:118917762-118917784 CTTTGGTATCAGAATGATGTTGG - Intronic
960553596 3:119003949-119003971 CTTTGGTATCAGAATGATGTTGG + Intronic
960592392 3:119378625-119378647 CTGTGTGCACAGCAGAATGTGGG + Intronic
960627929 3:119699625-119699647 CTGTGAGAAGATAAGGAGGTGGG + Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961513408 3:127418356-127418378 ATATGGGAACAGCAGGCTGTAGG + Intergenic
961829823 3:129617743-129617765 CTGTGGAGCCAGAAGGATCTGGG + Intergenic
961880121 3:130055977-130055999 GTTTGGGGACAGGAGGATGTTGG + Intergenic
962221612 3:133569091-133569113 ATGTGTGAACTGAAGGATGAGGG - Intergenic
962313187 3:134340203-134340225 CTGCAGGAAGAGAAGGGTGTAGG + Intergenic
962880658 3:139573528-139573550 CTGTGAGAACTGAAGGGGGTAGG - Intronic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
965186432 3:165471345-165471367 CTGTGTGAACCTAAGGGTGTGGG - Intergenic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
969354468 4:6617357-6617379 CTTTGGGGACAGAAGGAAGGTGG - Intronic
969559882 4:7939978-7940000 CTGAGGGAACAAAGGGAGGTTGG + Exonic
970749222 4:19337142-19337164 CTTTGGTATCAGAATGATGTTGG + Intergenic
972203383 4:36742391-36742413 GTGTGGGAACAAAAGGATTGAGG - Intergenic
973298345 4:48552160-48552182 CAGTGGGGTAAGAAGGATGTTGG - Intronic
974229113 4:59086588-59086610 CTGCGGAAAGAGAAGGATGGAGG + Intergenic
974429549 4:61778279-61778301 GTGTGGGACCAGAAGCATTTTGG - Intronic
975546100 4:75561883-75561905 TTGTGGTAACAGAGTGATGTTGG - Intronic
977324208 4:95554285-95554307 TTGTGGGAATATAAGGATATGGG + Intergenic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
978864468 4:113491629-113491651 CTTTGGTATCAGAATGATGTTGG + Intronic
979038869 4:115761343-115761365 CTTTGGGAACAGAAACATTTAGG + Intergenic
979166299 4:117535914-117535936 CTGTGTGATCAGAAAGATTTAGG - Intergenic
980170041 4:129278298-129278320 ATATGAGAACAGAAGGTTGTGGG + Intergenic
980500069 4:133638840-133638862 CTGCGGGTACAGGAGAATGTAGG - Intergenic
980597265 4:134970666-134970688 CTTTGGTATCAGAATGATGTTGG - Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
986475866 5:8131681-8131703 CTGTGGCTACAGATAGATGTGGG - Intergenic
986478648 5:8162056-8162078 CTTTGGTATCAGAATGATGTTGG - Intergenic
986955586 5:13146444-13146466 CTCTGGGAACAAGGGGATGTGGG + Intergenic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
989579735 5:43020649-43020671 CTCTGGGTTCAGAAGGTTGTGGG + Intergenic
990544757 5:56812218-56812240 TAGTGGGAACAGAAGTATGCAGG + Intergenic
990987106 5:61650696-61650718 CTGTTGGAAAAGATGCATGTTGG - Intronic
992032035 5:72731247-72731269 CTTTGGTAACAGGATGATGTTGG - Intergenic
994791840 5:104237153-104237175 GAGTGAGAACAGAAGGAGGTGGG + Intergenic
994963217 5:106631317-106631339 CCCTGGGGACAGAAGTATGTAGG + Intergenic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
998679883 5:144455236-144455258 ATGTGGAAGCAGAAGGAAGTTGG - Intronic
999806923 5:155090110-155090132 CTGTTGGAAGAGAAGGGTATGGG + Intergenic
1001240232 5:170063320-170063342 CTCTGGGAACAGAAGGGAGCAGG + Intronic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1001554222 5:172625265-172625287 CTTTGGGCACAGAAAGATCTGGG + Intergenic
1004262978 6:14124415-14124437 CTTTAGGAAAAGAAGGATGCTGG + Intronic
1004349045 6:14875049-14875071 CTTGGGGGACAGATGGATGTTGG + Intergenic
1004550969 6:16646757-16646779 CTGTGGGAACACAAAGGAGTGGG - Intronic
1004852634 6:19715822-19715844 TTGTGGGAATTGAAGGATGGGGG + Intergenic
1006193318 6:32222573-32222595 CTTTTGGAACAGAAGGAGGGAGG + Exonic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1007962518 6:45973196-45973218 CTGTGGGACCAGTCAGATGTCGG + Intronic
1008212390 6:48740865-48740887 CTTTGGTATCAGAATGATGTTGG - Intergenic
1008621227 6:53273345-53273367 CTGCAGGAACAGAGGGATTTGGG + Intronic
1010121121 6:72377191-72377213 GTTTGGGAACAGAAGAAGGTGGG - Intronic
1010349438 6:74854793-74854815 CTGAGGGATCTGAAGGATGCAGG + Intergenic
1012660035 6:101876763-101876785 ATTTGAGAACAGAAGGATGCTGG - Intronic
1013762516 6:113534638-113534660 CTTTGGTAACAGAATGATGCTGG - Intergenic
1014246491 6:119075900-119075922 TTGTAGAAACAGAAAGATGTTGG + Intronic
1014269003 6:119314802-119314824 CTGTGAGAATTGAAGGATGTAGG - Intronic
1015026522 6:128539605-128539627 CTGATGGAACAGAAGGCAGTTGG + Intergenic
1016042680 6:139447587-139447609 GTGTGGTGAAAGAAGGATGTAGG - Intergenic
1016254643 6:142089117-142089139 CTGTGGGAAAAGCAGGTTGCAGG - Intergenic
1016688953 6:146913493-146913515 ATGTTGTAACACAAGGATGTAGG + Intergenic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1019215264 6:170439040-170439062 CTGGGGGGACAGAAGGCTGAGGG + Intergenic
1020951833 7:14689013-14689035 GTGTGGGGAGAGAAGCATGTGGG - Intronic
1021069589 7:16219948-16219970 CTTTGGTATCAGAATGATGTTGG - Intronic
1021303107 7:18996766-18996788 GTGTGAGAACACAAAGATGTTGG - Intronic
1022376396 7:29815643-29815665 CTGTGAGAACACAAGCATGCTGG - Intronic
1022463952 7:30639297-30639319 CTTTGGTATCAGAATGATGTTGG + Intergenic
1024548481 7:50541192-50541214 CTGTGGGAATAGCATGGTGTTGG + Intronic
1025144650 7:56493165-56493187 CTGTGGGATCAGCAGCCTGTAGG - Intergenic
1025260236 7:57413623-57413645 CTGTGGGATCAGCAGCCTGTAGG - Intergenic
1026185648 7:68080843-68080865 CTGTGAGAACAGGAGAACGTGGG + Intergenic
1026382533 7:69813877-69813899 CTGTGGGCACACAGGGATTTTGG + Intronic
1029284482 7:99456411-99456433 CACTGGGAACAGCAGGAAGTGGG - Exonic
1029478726 7:100800495-100800517 CTGGGGGAAGATCAGGATGTAGG + Intergenic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1033247165 7:139727322-139727344 CTGTGGGAAAAGAGGGCTATTGG - Intronic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034349989 7:150409301-150409323 CTGTGAGGACAGACTGATGTGGG + Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035645013 8:1211981-1212003 CTGTGGAAACACAAGGCTCTTGG + Intergenic
1037038122 8:14194516-14194538 CTGAGGTTAAAGAAGGATGTTGG + Intronic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1037833305 8:22201566-22201588 CTGTGGGGAGAGGAGGATGGGGG - Intronic
1037974588 8:23200441-23200463 CTGTGGGAACAGAAGAAGGCAGG + Intronic
1038104204 8:24414964-24414986 CTGTGGGCACAGAGGCCTGTGGG - Intergenic
1038214870 8:25552299-25552321 CTGAGGGGTCAGAAGGAAGTGGG + Intergenic
1038346296 8:26735440-26735462 CTGTGGACAAAGTAGGATGTGGG + Intergenic
1039430119 8:37519407-37519429 CTCTTGGAACAGCAGGAGGTGGG + Intergenic
1039493005 8:37961868-37961890 ATTTGGGTACAGGAGGATGTGGG - Intergenic
1042018142 8:64340179-64340201 CTGTGGGAACACATGGATTTTGG - Intergenic
1042128779 8:65565737-65565759 CTGTGGTAAGAGAAGGGTGTTGG + Intergenic
1042640834 8:70932469-70932491 CTGTTAGAAGAGAAGGAGGTAGG + Intergenic
1043088875 8:75872862-75872884 CTTTGGTATCAGAATGATGTTGG + Intergenic
1044410121 8:91873029-91873051 CTTTGGTATCAGAATGATGTTGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045173138 8:99693200-99693222 CTTTGGTATCAGAATGATGTTGG - Intronic
1045327546 8:101127799-101127821 GTGTGGGAGCAGAGGGATGGGGG + Intergenic
1045705728 8:104920375-104920397 CTGGGGTCCCAGAAGGATGTGGG + Intronic
1046728223 8:117697248-117697270 CTGTGGGAATAGAACCATGAAGG + Intergenic
1047345424 8:124023421-124023443 CTGTGGGAATAGAGGGAGTTGGG - Intronic
1047499149 8:125429299-125429321 CGGTGGGAAACAAAGGATGTGGG - Intergenic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1048334052 8:133490094-133490116 CTTTGGGCAGAGAAGGAAGTTGG + Intronic
1048435130 8:134409272-134409294 CTGAGGAAGCAGATGGATGTTGG + Intergenic
1049010006 8:139881039-139881061 TTGTGGGCACAGAGGCATGTTGG - Intronic
1050871555 9:10577534-10577556 CTGGGTGAAAAGAAAGATGTTGG - Intronic
1052404735 9:28045111-28045133 ATGTGGGATCATAAGGATGGGGG - Intronic
1052834515 9:33240574-33240596 CTGTGGGGACAGAAGGGAGCAGG + Intronic
1053302311 9:36960821-36960843 CTGTGGGAAGAGAGGAATGCAGG - Intronic
1056213353 9:84385749-84385771 CAGTAGGAAGAAAAGGATGTGGG - Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1056938326 9:90935003-90935025 CAATGGGAACTGAAGGCTGTGGG + Intergenic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060085306 9:120694612-120694634 CTCTGGGAAGAAAAGGCTGTTGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060750471 9:126165279-126165301 CTGCAGGAACAGGAGGAAGTGGG - Intergenic
1061927482 9:133813090-133813112 CTGTGGGAACAGGGGGTGGTTGG - Intronic
1062198887 9:135290282-135290304 CTGTGGAAACAGAAGGTCCTTGG - Intergenic
1187213792 X:17254919-17254941 CTCTGGGAACAGAAGGGACTAGG + Intergenic
1188043042 X:25392715-25392737 CTTTGAGAAGAAAAGGATGTGGG + Intergenic
1189703016 X:43731235-43731257 CTGTAGGAACGGAAGTTTGTAGG + Exonic
1190736383 X:53258033-53258055 ATTTGGGAAAAGCAGGATGTGGG - Intronic
1191057146 X:56254009-56254031 CTTTGGGAACACAAAGAGGTGGG - Intronic
1192132189 X:68562263-68562285 CTTTGGAATCAGAATGATGTTGG + Intergenic
1192623833 X:72707380-72707402 CTGTGGGAACACACAGAGGTGGG - Intronic
1193064791 X:77247787-77247809 CTTTGGTATCAGAATGATGTTGG - Intergenic
1193953122 X:87824913-87824935 CTTTGGTATCAGAATGATGTTGG - Intergenic
1194772707 X:97924701-97924723 CTTTGGTATCAGGAGGATGTTGG - Intergenic
1196375205 X:115025871-115025893 CTCTGGCAACAGGGGGATGTGGG - Intergenic
1196468244 X:115994130-115994152 CTGTGGCAACTGAGGAATGTGGG + Intergenic
1197713470 X:129688862-129688884 CTGAGGGAAGAGCAGGAAGTAGG - Intergenic
1198507266 X:137313025-137313047 CTTGGGGCACACAAGGATGTAGG + Intergenic
1198666160 X:139025542-139025564 CAGAAGGAACAGAAAGATGTGGG - Intronic
1198713836 X:139534944-139534966 GTCTGGGAAGAGAAGGATGAAGG + Intronic
1199617652 X:149670666-149670688 GTGTGGGAAGAGATGGAGGTGGG - Intergenic
1199624991 X:149732583-149732605 GTGTGGGAAGAGATGGAGGTGGG + Intergenic
1200088448 X:153623347-153623369 CTCTGGGGCCCGAAGGATGTAGG - Intergenic